ID: 1006166977

View in Genome Browser
Species Human (GRCh38)
Location 6:32070893-32070915
Sequence ATAAGAAAGGGAACGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 899
Summary {0: 1, 1: 0, 2: 4, 3: 95, 4: 799}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006166977_1006166984 -4 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166984 6:32070912-32070934 TTATTCTGCACCGGCTGGCCCGG No data
1006166977_1006166992 23 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166992 6:32070939-32070961 ACTAAGGCTCCCACTGGGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 170
1006166977_1006166985 -3 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166985 6:32070913-32070935 TATTCTGCACCGGCTGGCCCGGG 0: 1
1: 0
2: 3
3: 10
4: 98
1006166977_1006166993 29 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166993 6:32070945-32070967 GCTCCCACTGGGCCTGGTGAAGG 0: 1
1: 0
2: 0
3: 28
4: 272
1006166977_1006166983 -9 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166983 6:32070907-32070929 CTTTCTTATTCTGCACCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1006166977_1006166987 7 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166987 6:32070923-32070945 CGGCTGGCCCGGGAGAACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1006166977_1006166990 17 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data
1006166977_1006166991 18 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166991 6:32070934-32070956 GGAGAACTAAGGCTCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006166977 Original CRISPR ATAAGAAAGGGAACGGAGAA GGG (reversed) Intronic
901004263 1:6164235-6164257 ATAAGGAAGGGTGCGGAGAGTGG + Intronic
903033967 1:20482478-20482500 AGAAAAGAGGGAACGGGGAAGGG + Exonic
903866536 1:26402685-26402707 ACAAGACAGTAAACGGAGAAAGG + Intergenic
904509962 1:30996574-30996596 ATATGACAAGGAACTGAGAAAGG + Intronic
904576773 1:31509919-31509941 AAGAGAAAGGGAATGGAGGAAGG - Intergenic
905124157 1:35705581-35705603 ATGGGAATGGGAACTGAGAATGG - Intergenic
906563931 1:46783229-46783251 ATAAGGGAGGGACCAGAGAAAGG - Intronic
907917059 1:58881062-58881084 ATTAGCAAGGGCAAGGAGAAGGG + Intergenic
908101594 1:60796705-60796727 ATAAGAAAGGGAGTGGAGAAGGG - Intergenic
908414365 1:63898607-63898629 AGAAGAGAGGGAAAGTAGAAAGG + Intronic
908553811 1:65237002-65237024 AAAAGAAAGGAAAGGAAGAAAGG - Intergenic
908781519 1:67695293-67695315 TTAAGGAAGGGAGTGGAGAAAGG + Intergenic
908930761 1:69313950-69313972 AGAAGAAAGAGAAAGGAGAAGGG + Intergenic
908996572 1:70163061-70163083 AAAAGAAAAGGAAAGGAAAAAGG - Intronic
909363170 1:74788807-74788829 GTAGGAAGGGGAAAGGAGAAAGG + Intergenic
909573208 1:77141377-77141399 ATCAGATAAGGAACAGAGAACGG + Intronic
909742180 1:79043811-79043833 AAAAGAAAGGGAAATGAGGAGGG - Intergenic
910184418 1:84521618-84521640 ATAAGGCAGGGAAGGGAGAAAGG - Intergenic
910189765 1:84583567-84583589 AAAAGAAAAAGAAAGGAGAAAGG - Intergenic
910397019 1:86803773-86803795 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic
911428230 1:97749096-97749118 TTGAGAAAGGGAAGGGAGATAGG - Intronic
911569163 1:99501909-99501931 ATAAGAAAAGCAACAGTGAAAGG + Intergenic
911620874 1:100065548-100065570 AAAAGGAAAGGAAAGGAGAAAGG - Intronic
911760920 1:101615642-101615664 ATAAGAAGGGAAATGGAGGAGGG - Intergenic
912471079 1:109907301-109907323 AGGAGAAAAGGAAGGGAGAAAGG + Intergenic
912476773 1:109942981-109943003 AGAGGAAAGGGTATGGAGAAGGG + Intergenic
912500708 1:110120232-110120254 AAAAGACAGAGAAAGGAGAAAGG - Intergenic
912548707 1:110470133-110470155 AGAAGGAAGGGAAGGGAGGAGGG - Intergenic
913026566 1:114849071-114849093 TTAACAAAAGGAATGGAGAAGGG - Intergenic
913094895 1:115507186-115507208 ATGAAAAAGAGCACGGAGAATGG + Intergenic
913437977 1:118866741-118866763 AGAAGAAGGGGAAGGAAGAAGGG + Intergenic
913451933 1:118998518-118998540 AAAAGAAAAGGAATGGAAAAAGG + Intergenic
914245854 1:145885485-145885507 ACAAGAAAGGGGCCGGGGAAAGG + Intronic
914936834 1:151989061-151989083 TTAAGAAAGGGAATGCAGCAGGG + Intronic
916285923 1:163105066-163105088 AGAAGAAAAGGAAGGGAGGAAGG + Intergenic
916517900 1:165537212-165537234 TTGAGAAATGGAACTGAGAATGG - Intergenic
916680951 1:167104575-167104597 AAAAGAAATGTAAAGGAGAAAGG - Intronic
916690861 1:167188708-167188730 AGAACAAGGGGAAGGGAGAAAGG + Intergenic
916790830 1:168123682-168123704 AGGAGAAAGGGAAAGGAGAAGGG - Intronic
917602756 1:176594460-176594482 ATACAAAGGGGAATGGAGAAAGG - Intronic
918284461 1:183038347-183038369 GTAAGAAAGGAAACTGAGCAAGG - Intronic
918620377 1:186597250-186597272 AAAAGAAAGGGAAAGAAGGAAGG - Intergenic
919459014 1:197854691-197854713 ATGTGAAAGGAAAGGGAGAAAGG + Intergenic
919563380 1:199152849-199152871 AGAAGAAAGGAGAAGGAGAAAGG + Intergenic
919961040 1:202468937-202468959 AAAAGAAAGGGAAGGTAAAATGG + Intronic
920154561 1:203937863-203937885 AAAAGAAAGGAAAGGAAGAAAGG + Intergenic
920275996 1:204804765-204804787 AAAAGAAAGGGAAAGAAGGAAGG + Intergenic
920659150 1:207900646-207900668 AGAAGAAAAGGAAAGGCGAATGG - Intronic
920935353 1:210428642-210428664 ATAAGAAACAGAAGGGATAAAGG - Intronic
920965134 1:210694984-210695006 ATGAGAAAGGGAAGGGGGATGGG + Intronic
921599222 1:217089386-217089408 ATAAGCAAGTGAAGGGGGAAGGG + Intronic
921615398 1:217260570-217260592 AAAAGAAAGAGAACAGAGTAGGG + Intergenic
921648305 1:217646529-217646551 AGAAGAAAGGGAAAGTAAAATGG - Intronic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922554392 1:226521792-226521814 AAAAGAAAGGGAAAGAAAAAAGG + Intergenic
922791865 1:228315346-228315368 ATGAGAAAGGGAGGGGAGAGCGG + Intronic
923084455 1:230692581-230692603 AAAAGAAAGGGAAGGAAGGAAGG + Intronic
923090454 1:230736596-230736618 ATATAAATGGGAACGGAGCAAGG + Intergenic
923282615 1:232459373-232459395 GGAAGAAAGGAAACAGAGAAAGG + Intronic
924321302 1:242854092-242854114 ATCAGAGAGGGACCAGAGAAAGG - Intergenic
924815837 1:247441208-247441230 ATAAGGAAAGGAAAGGGGAAAGG - Intronic
1063138403 10:3236608-3236630 CAAAGGAAGGGGACGGAGAACGG - Intergenic
1063241688 10:4176030-4176052 ATAAGAAGGGGAACAGACAGTGG + Intergenic
1063911645 10:10836205-10836227 ATAAGAAAAGAAAAGGAGAAAGG + Intergenic
1063918877 10:10912134-10912156 ATAAGAAAGGGAGGTGAGGATGG + Intergenic
1064288839 10:14015043-14015065 AGAAGAAAAGGAAGGAAGAAAGG - Intronic
1064595711 10:16942826-16942848 AAAAGGAAGGGAAGGGGGAAGGG + Intronic
1064753993 10:18558488-18558510 ATATGGAATGGAATGGAGAAAGG + Intronic
1064753997 10:18558517-18558539 ATATGGAATGGAACGGAGAATGG + Intronic
1064754251 10:18560217-18560239 GTATGGAATGGAACGGAGAATGG + Intronic
1064754331 10:18560812-18560834 ATATGGAACGGAATGGAGAATGG + Intronic
1064755211 10:18567020-18567042 ATATGGAATGGAATGGAGAATGG - Intronic
1064755339 10:18567928-18567950 ATATGGAATGGAATGGAGAATGG - Intronic
1064755383 10:18568263-18568285 AAAAGGAATGGAATGGAGAATGG - Intronic
1064756045 10:18572555-18572577 AAAAGGAAAGGAATGGAGAATGG - Intronic
1064756184 10:18573435-18573457 ATATGGAATGGAATGGAGAATGG - Intronic
1064971054 10:21067622-21067644 AGAACAAAGGCAAGGGAGAAGGG + Intronic
1065459402 10:25941510-25941532 AAAAGATAGGGAGAGGAGAATGG - Intronic
1065470830 10:26080468-26080490 ATCAGGGAGGGAACAGAGAAAGG - Intronic
1065656749 10:27959270-27959292 AAAGGAAAGGGAAGGAAGAAAGG + Intronic
1065690640 10:28329928-28329950 ACAATAAAGAGAAGGGAGAAAGG - Intronic
1066074103 10:31855047-31855069 ATAGGAGAGGGAAAGGGGAAGGG + Intronic
1066162523 10:32748877-32748899 CTAAGAGAGGGAAAGGAAAAAGG - Intronic
1066385768 10:34940022-34940044 AAAAGAAAAGGAAAGGAAAAAGG - Intergenic
1069068596 10:63972444-63972466 TTAAGATAGGGAACGGGAAAAGG + Intergenic
1069183725 10:65396036-65396058 ATGAGGAAGGGAAGGGAGAATGG + Intergenic
1069618915 10:69824351-69824373 ATAAGGCAGGGAAGGGAGAAAGG - Intronic
1069619204 10:69826123-69826145 ATAAGAAAAGGGACAGATAATGG - Intronic
1070456760 10:76624764-76624786 AGAAGAAAGGGGACGGAAAGGGG - Intergenic
1070723512 10:78772747-78772769 TTACGAGAGGGAAGGGAGAAGGG + Intergenic
1071053085 10:81474326-81474348 CTAAGATAGGGAACAAAGAAAGG + Intergenic
1071117458 10:82238600-82238622 AGGGGAAAGGGAATGGAGAATGG - Intronic
1071169206 10:82843708-82843730 AAAATGAAGGGAAGGGAGAAGGG + Intronic
1072571519 10:96661855-96661877 AAAGGAAAGGGAAAGGAGAGGGG + Intronic
1072723232 10:97793733-97793755 AAAAGAAAGGGAAGGAAGGATGG - Intergenic
1072800634 10:98390225-98390247 AAAAGAAAGGCTACGGAGCAGGG + Intronic
1073062912 10:100742921-100742943 AGAAGAAAGAGAACAGAAAAGGG + Intronic
1073857822 10:107697595-107697617 AGAAGAAAAGGAGAGGAGAAGGG - Intergenic
1073994739 10:109302150-109302172 AGCAGAAAGGAAAAGGAGAAAGG + Intergenic
1074531624 10:114302301-114302323 ATAAGAGAGTGTACGGAGGAAGG + Intronic
1074983429 10:118637697-118637719 ATTTGAAAGGGAAGGGGGAAAGG - Intergenic
1075537134 10:123280907-123280929 ATAAGAAAGGGAGGGAAGGAAGG - Intergenic
1075863711 10:125699005-125699027 ATAAGAGATGGAGCAGAGAAAGG + Intergenic
1076197063 10:128526449-128526471 AGAAGCAGGGGAATGGAGAATGG + Intergenic
1076240404 10:128900757-128900779 AGAGGAGAGGGATCGGAGAAGGG + Intergenic
1076257626 10:129040856-129040878 AAAAGACAGGGAAAAGAGAAAGG + Intergenic
1076666820 10:132097929-132097951 ATGGGAAAGGGAAAGGGGAAGGG - Intergenic
1076850489 10:133090088-133090110 AGAGGACAGTGAACGGAGAAGGG + Intronic
1077547081 11:3177584-3177606 ATACAAAAGGCAATGGAGAAAGG + Intergenic
1077747718 11:4925679-4925701 ACTAGAAAGGGGACAGAGAATGG + Intronic
1078578756 11:12522958-12522980 ATGAGAGAGGGAATGTAGAAGGG + Intronic
1078759942 11:14243784-14243806 AAAAGAAACGGGACTGAGAATGG - Intronic
1079227372 11:18619063-18619085 GAAAGAAAGGGAGAGGAGAAAGG + Intronic
1079811227 11:25001921-25001943 ATCAAAAAGGGAAAGGAGAAGGG - Intronic
1080125313 11:28727045-28727067 ACAAGAAAGGGAACTGAGCCTGG - Intergenic
1080828383 11:35867437-35867459 ATGAGAAAAGGAAGGAAGAAAGG + Intergenic
1081499393 11:43651201-43651223 AGAAGAAAGGGAGAGGATAATGG + Intronic
1081916455 11:46734307-46734329 ATAAGAAAGGGACCAAAAAATGG - Intronic
1082058447 11:47839820-47839842 GTAAGAATGGGAACTGAGCATGG - Intronic
1082828700 11:57599383-57599405 ATTAGGAAGGGAACGAAGAAAGG - Intronic
1083150790 11:60790599-60790621 GGAAGAAAGGGAAAAGAGAAAGG + Intronic
1083703832 11:64499625-64499647 AGAAGAATGTGAAGGGAGAAAGG + Intergenic
1083835106 11:65261525-65261547 ATGACAAGGGGAATGGAGAAGGG + Intergenic
1083942831 11:65907026-65907048 ATCAGCAGGGGAATGGAGAATGG - Intergenic
1084384830 11:68836842-68836864 AAAAGAAAGGGAAGGAAGGAAGG + Intronic
1084513562 11:69622083-69622105 AAAAGAAAGGGAAGGAAGGAAGG + Intergenic
1085069036 11:73525091-73525113 AAAAGAGAGGGAATGGAGAGGGG - Intronic
1085140142 11:74132621-74132643 ATAAGAACGGTAAGGTAGAATGG + Intronic
1085233070 11:74989372-74989394 AGATGAAAGGGAACTGAGACTGG + Intronic
1085562372 11:77484069-77484091 ATTAGAAAGGCAATGTAGAATGG + Intergenic
1085773913 11:79348626-79348648 ATAAGAAGAGGAAGAGAGAAAGG + Intronic
1086231097 11:84570739-84570761 ATGATGAAGGGAAGGGAGAAAGG - Intronic
1086297459 11:85386782-85386804 AGAAAAAAAGGAAGGGAGAAAGG + Intronic
1086559155 11:88147119-88147141 AGAAGAAAGGGAAAAAAGAAAGG - Intronic
1087465242 11:98495594-98495616 AGCAGAAAGGAAAAGGAGAAAGG + Intergenic
1087526049 11:99314694-99314716 ATAGGGTAGGGAAAGGAGAAAGG + Intronic
1087698899 11:101413282-101413304 AGAGCAAAGGGAAGGGAGAATGG - Intergenic
1088209418 11:107437628-107437650 ACATGAAGGGGAAGGGAGAAGGG + Intronic
1088391920 11:109323901-109323923 GAAAGGAAGGGAAGGGAGAAGGG - Intergenic
1089562544 11:119351527-119351549 AGAGGAAAGGAAAGGGAGAAAGG - Intergenic
1089589806 11:119533090-119533112 AGGAGGAAGGGACCGGAGAAGGG - Intergenic
1089759704 11:120714358-120714380 TTAAGAAAGGGAAGGCAGGAAGG - Intronic
1090503376 11:127283636-127283658 AGAAGAAAGAGAACTGACAAGGG - Intergenic
1090757424 11:129804547-129804569 ATCAGAGAGGGACCAGAGAAAGG + Intergenic
1090824486 11:130374651-130374673 AAAAGAAACGGAAGGGAGAGGGG + Intergenic
1091192446 11:133706896-133706918 GACAGAAAGGGAACGGGGAAGGG + Intergenic
1091210405 11:133853750-133853772 ATCAGGGAGGGAACAGAGAAAGG - Intergenic
1092069596 12:5621876-5621898 AAAGGAAAGGGAAGGAAGAAAGG + Intronic
1092447963 12:8575195-8575217 ATAAGAAGGAAAATGGAGAAAGG + Intergenic
1092844864 12:12574784-12574806 AAAAGAAAGGGAAAGGGGAAGGG - Intergenic
1092964613 12:13629601-13629623 AAGAGGAAGGGAAAGGAGAAAGG - Intronic
1093073252 12:14729116-14729138 ATTAGAATTGGAAGGGAGAATGG + Intergenic
1094152933 12:27305703-27305725 ATATAAAAAGGAATGGAGAAAGG + Intronic
1094430357 12:30361633-30361655 AGAAGAAAGGGAAATGTGAAAGG - Intergenic
1094524929 12:31225262-31225284 GGAAGAAAGGGAGCTGAGAAGGG + Intergenic
1094678255 12:32643412-32643434 ATAAGGAAGGGAAATGGGAAGGG + Exonic
1094716648 12:33020681-33020703 ATAAAAAGGGGAATTGAGAATGG - Intergenic
1095531966 12:43198396-43198418 GAAAGAAAGGGAAAGGAAAAGGG + Intergenic
1096813387 12:54185889-54185911 AGAAGAAAGGGAAGAGAGAAGGG + Intronic
1096887275 12:54730651-54730673 AAGAGAAAGGGAAAGGGGAAGGG - Intergenic
1096984660 12:55748449-55748471 ATAAGATAGGCATGGGAGAAGGG + Intronic
1097096248 12:56550864-56550886 ATAATAAAAGGAAGGGAGGAAGG + Intronic
1097257829 12:57694143-57694165 ATAAGAAGGGGAACGAAAGATGG + Exonic
1097578942 12:61430169-61430191 ACAAGCAGGGGAAAGGAGAAAGG + Intergenic
1097694251 12:62761648-62761670 ATAAAAAAAGGGATGGAGAAGGG + Intronic
1099257502 12:80331925-80331947 AAAAGGAAGGGAAGGAAGAAGGG + Intronic
1100011318 12:89956990-89957012 GAAAGAAAGGGAAAGGAAAAGGG - Intergenic
1100032923 12:90215017-90215039 AAAAGAAAGGGAAAGAAGGAAGG - Intergenic
1100333274 12:93605723-93605745 AAAAGAAAGGGAGCAGGGAAAGG + Intergenic
1100634275 12:96420044-96420066 ATAAAACAAGGAACTGAGAAAGG - Intergenic
1100782517 12:98044373-98044395 GTAAGGAAGGGAATGAAGAAAGG - Intergenic
1100853692 12:98739648-98739670 AAATGAAAGGAAAAGGAGAAGGG - Intronic
1100893657 12:99155182-99155204 GAAAGAAAGGAAAAGGAGAAAGG - Intronic
1101111533 12:101491281-101491303 ATAAAAAAAAGAAAGGAGAAAGG + Intergenic
1102061680 12:109937224-109937246 ATAAAAAAGGGTACAGAAAAGGG + Intronic
1102270448 12:111530471-111530493 ATAAGAAAGGGGAAGTAAAATGG + Intronic
1102427413 12:112855057-112855079 ACAGGAAAGGGCAGGGAGAAGGG + Intronic
1102680206 12:114685810-114685832 GATGGAAAGGGAACGGAGAAAGG + Intergenic
1102906392 12:116678845-116678867 AGAAGAAGGGGAACGAAGAGAGG - Intergenic
1103228670 12:119309450-119309472 GGAAGAAAGGGAAAGGGGAATGG + Intergenic
1103304225 12:119951704-119951726 ATAGGAAGGGGAAGGAAGAAGGG + Intergenic
1103304249 12:119951768-119951790 ATAGGAAGGGGAAGGAAGAAAGG + Intergenic
1103304277 12:119951844-119951866 ATAGGAAGGGGAAGGAAGAAGGG + Intergenic
1103304300 12:119951908-119951930 ATAGGAAGGGGAAGGAAGAAGGG + Intergenic
1103304323 12:119951972-119951994 ATAGGAAGGGGAAGGAAGAAGGG + Intergenic
1103586660 12:121961282-121961304 AGAAGAAAGGGAAGGAAGGAAGG - Intronic
1104301406 12:127568401-127568423 ATGAGAGAGGGAGAGGAGAAAGG + Intergenic
1104504390 12:129318083-129318105 ATAAGGGAGGGACCAGAGAAAGG - Intronic
1104900247 12:132186149-132186171 AAAAGAAAAGGAAGGAAGAAAGG - Intergenic
1106023754 13:25938834-25938856 AAAAAAAAAGGAAAGGAGAAGGG - Intronic
1106583659 13:31038500-31038522 AAAACAGAGGGAAGGGAGAAAGG + Intergenic
1106849032 13:33768640-33768662 ATCAGAAACGGAAAGGAGAATGG - Intergenic
1106849039 13:33768695-33768717 CTCAGAAAAGGAAAGGAGAACGG + Intergenic
1107038926 13:35928520-35928542 ATGAAATAGGGAAGGGAGAAAGG - Intronic
1107200756 13:37714076-37714098 AAAAGAAAAGAAAGGGAGAAAGG - Intronic
1107691554 13:42958462-42958484 ACAAGAAAGTGAGAGGAGAAAGG + Intronic
1108267588 13:48728220-48728242 ATAAGAAATGGACCTCAGAAGGG + Intergenic
1108480722 13:50867508-50867530 AAAGGAAAGGGAAGGGAGAAGGG - Intergenic
1108793055 13:53996180-53996202 AAAAGAAAAGAAAAGGAGAATGG + Intergenic
1108879215 13:55088586-55088608 AGAAGACAGAGAAAGGAGAAAGG - Intergenic
1108928914 13:55790013-55790035 GAAAGAAAGAGAAAGGAGAAAGG - Intergenic
1109322249 13:60825629-60825651 AAAAAAAAGGCAACGGAGGAGGG - Intergenic
1109401476 13:61834958-61834980 ATAAGAAATGAAAATGAGAATGG - Intergenic
1109991399 13:70062095-70062117 ATGGGAAAGGTAACGGAGACAGG - Intronic
1110775124 13:79399663-79399685 AGAAGAACTGGAAGGGAGAAAGG + Intronic
1110809912 13:79800925-79800947 AGAACAAAAGGAAGGGAGAAAGG - Intergenic
1111209913 13:85064259-85064281 AAAAGAAAGGTAACTGAAAAGGG + Intergenic
1111259187 13:85712720-85712742 ATTAAAAAGGGAAGGAAGAATGG + Intergenic
1111795224 13:92910702-92910724 AGGAGAAATGGAAGGGAGAAAGG + Intergenic
1112119268 13:96392092-96392114 GTCAGAAAGGGCATGGAGAAGGG - Intronic
1112404621 13:99107919-99107941 GGAGGAAAGGGAAGGGAGAAAGG + Intergenic
1113292054 13:108918166-108918188 ATATGAAAAAGAAAGGAGAAGGG - Intronic
1114013913 14:18407123-18407145 AATAGAAACAGAACGGAGAATGG + Intergenic
1114197953 14:20495625-20495647 GGAAGGAAGGGAAGGGAGAAAGG - Intergenic
1114593398 14:23891063-23891085 GAAAGAAAGAGAAAGGAGAAAGG + Intergenic
1114919274 14:27306660-27306682 AGCAGAAAGGAAAAGGAGAAAGG - Intergenic
1114962701 14:27914022-27914044 ATAAGAAGGGAAACAAAGAAGGG + Intergenic
1115299372 14:31866352-31866374 ATAAGCAAGGCACCAGAGAAAGG + Intergenic
1115340154 14:32285171-32285193 GTAAGAAAGGGAGAGAAGAAAGG - Intergenic
1116239430 14:42322431-42322453 ATAAGGAAGGGAGGGGCGAATGG + Intergenic
1116512415 14:45762912-45762934 AAAAGAAAAGGAAGGAAGAAGGG - Intergenic
1117308432 14:54498631-54498653 GGAGGAAAGGGAAGGGAGAAAGG + Intergenic
1117433322 14:55692649-55692671 AAAAGAGAGGGGACAGAGAAAGG - Intronic
1117879644 14:60299975-60299997 ATAAAAAAGGAAAAAGAGAAGGG - Intergenic
1118663633 14:68042603-68042625 ATGGGAAAGGGGAGGGAGAAAGG - Intronic
1118870116 14:69734331-69734353 AGAAGAAAGGGAACCAAGGATGG + Intronic
1119177587 14:72580553-72580575 ATGAGATAGGGCAAGGAGAAAGG + Intergenic
1119607455 14:76032940-76032962 ATAAGAGAGGGAAGGCAGGAGGG + Intronic
1119697735 14:76726875-76726897 AAATGATAGGGAAGGGAGAAGGG - Intergenic
1119872301 14:78028152-78028174 CTAAGAAAAGGAAAGGAGAGGGG - Intergenic
1120445945 14:84596512-84596534 ATCAGAAAGTGAAAGGATAAAGG - Intergenic
1120609502 14:86623036-86623058 AGAAGAAATGGAAGGGAGTAAGG + Intergenic
1120686746 14:87546674-87546696 ATAGGAAATGGAACGATGAATGG - Intergenic
1121593310 14:95137322-95137344 AGAGGAAAGGGAAAGGGGAAGGG + Intronic
1121782825 14:96633134-96633156 AAAAGAAAAGGAAGGAAGAAAGG - Intergenic
1121933027 14:97990603-97990625 ACAAGCAAGGGAGAGGAGAAAGG - Intergenic
1121962532 14:98274617-98274639 AAAAGAAAGAGAAAGGAGACAGG + Intergenic
1124475387 15:30028621-30028643 ATAAGAAAGGGAGGGGAAAGTGG + Intergenic
1124841302 15:33244545-33244567 ATGAGAAAGGGAAGAGAGAATGG + Intergenic
1125055821 15:35358322-35358344 ATCAGAGAGGGACCAGAGAAAGG - Intronic
1126047476 15:44656013-44656035 AAAAGAGAGGAAATGGAGAAAGG + Intronic
1126207435 15:46061125-46061147 ATAAAACAGGCAAGGGAGAATGG - Intergenic
1126357573 15:47812607-47812629 ATACCAAAGAGAACTGAGAAGGG + Intergenic
1126744248 15:51809729-51809751 GGAAGAAAGGGAGGGGAGAAAGG - Exonic
1126764805 15:52001491-52001513 AAAAGAAAGGAAAAGGACAAAGG - Intronic
1126922508 15:53543403-53543425 ATAAGAAAATGAAGGTAGAAAGG + Intronic
1126947842 15:53844042-53844064 ATAAAAAGGGGAACTGATAATGG + Intergenic
1127189989 15:56519138-56519160 AAAAGGAAAGGAAAGGAGAAAGG + Intergenic
1127262977 15:57339207-57339229 ATCAGGAGGGGAAGGGAGAAAGG + Intergenic
1127354759 15:58187864-58187886 ATAAGAAAGAGATTGGAGCATGG - Intronic
1127496717 15:59519609-59519631 AAAAGAAAAGGAAGGAAGAAGGG - Intronic
1127606989 15:60596359-60596381 ACAAGAAAGGGATCAGTGAAAGG + Intronic
1128241775 15:66106154-66106176 CTTAAAAAGGGAAAGGAGAAAGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128741719 15:70088457-70088479 AGAAGAAAGGAAAAGGAAAAAGG + Intronic
1128931293 15:71706964-71706986 ATAAGAGATGGGAGGGAGAAGGG + Intronic
1129059341 15:72848429-72848451 ACAAGAAAGGTGAAGGAGAATGG + Intergenic
1129353837 15:74974281-74974303 AAAAGAAAAGGAAGGGAGGAAGG + Intronic
1130171782 15:81522703-81522725 GGAAGAAGGGGAAAGGAGAAGGG + Intergenic
1130330163 15:82916246-82916268 ATAAGAATGGGAGCAGAGGATGG - Intronic
1131449298 15:92525900-92525922 ATAAGAAAGGCAAGGAAGGAAGG - Intergenic
1131717352 15:95127736-95127758 ATAACACTGGGAAGGGAGAAAGG + Intergenic
1131955402 15:97729937-97729959 ATAAGGAAGGAAAAAGAGAAGGG - Intergenic
1132128983 15:99256989-99257011 ATAGGGAAGGGAATGAAGAATGG - Intronic
1133720206 16:8487732-8487754 ATGAGAAATGGGAAGGAGAATGG + Intergenic
1133752842 16:8737931-8737953 AAAAGAAAGGAAAGGAAGAAAGG + Intronic
1133885361 16:9822461-9822483 AAAAGAAAGAGAAGGGAGGAGGG + Intronic
1133900908 16:9973480-9973502 ACAAGAAAGAGAATGGAGAAGGG + Intronic
1134352620 16:13451930-13451952 AGGAGAAGGGGAAGGGAGAAGGG + Intergenic
1134634670 16:15783312-15783334 ATAAGGAAGGGAAAGCAGGAGGG - Intronic
1135079645 16:19423095-19423117 AGAAGGAAGAGAAAGGAGAAGGG - Intronic
1135088102 16:19490818-19490840 AAAGGAAAGGGAAGGGAGAAAGG - Intronic
1135375646 16:21944664-21944686 AAGAGAATGGGAACAGAGAATGG + Intergenic
1135390625 16:22090236-22090258 AGAAGAAAGGAAGCTGAGAAAGG + Intergenic
1135901707 16:26465627-26465649 ATCAGAGAGGGACCAGAGAAAGG + Intergenic
1136948940 16:34691446-34691468 GCAAGAAAAGGAAGGGAGAAAGG + Intergenic
1137246506 16:46710473-46710495 AAAATAAAGGGAACAGAGAAAGG - Intronic
1137686990 16:50393178-50393200 ATATGAAAAGGAAGGAAGAAAGG - Intergenic
1137743198 16:50801075-50801097 GTCTGAAGGGGAACGGAGAAGGG - Exonic
1137768068 16:50993011-50993033 TGAAGAAAGGGAGAGGAGAAAGG + Intergenic
1138090753 16:54172140-54172162 ACAGAAAAGGGAACGGGGAAAGG + Intergenic
1138255731 16:55557675-55557697 ATAAGAAAAGAAAAGAAGAAAGG - Intronic
1138364489 16:56462973-56462995 ATAAAAAAGAGAAGGGAGAATGG - Intronic
1138816059 16:60204052-60204074 AAAAGAAAGAGAAAGGAGAAAGG - Intergenic
1138908890 16:61372367-61372389 ATAAGAGAGGGTAAGGAGCAGGG + Intergenic
1139368960 16:66453217-66453239 AGAAGAAAGGAAAAGAAGAAAGG - Intronic
1139908750 16:70383607-70383629 GGAAGGAAGGGAAAGGAGAAAGG + Intronic
1140206237 16:72935913-72935935 ATAAGAATGGGAAAGGAACAAGG + Intronic
1140257713 16:73351022-73351044 ATAAGAAAGGGAAGTGACACTGG + Intergenic
1140449367 16:75058088-75058110 AAAAGAAAAGGAAAGGAAAAAGG - Intronic
1140638422 16:76943772-76943794 AGAAGAAAGGGAAGGAAGGAAGG - Intergenic
1141640182 16:85336270-85336292 ATAATCAAGGGAACGAACAAAGG - Intergenic
1142251411 16:88993670-88993692 AGAAGAAGGGGAAAGGAGGAGGG - Intergenic
1142421738 16:89974873-89974895 TGAAGAAAGGGAATGGAGGAGGG + Intergenic
1142542503 17:671243-671265 AGAAGAAAGGAAAAGGAAAAGGG + Intronic
1142739508 17:1922860-1922882 AAAAGAAAGAGAAAGGAGAAAGG + Intergenic
1143112738 17:4561514-4561536 AAAAGAAAGGTAAAGGAAAAAGG - Intergenic
1143623740 17:8096222-8096244 GGAAGAAAGAGAACGTAGAAAGG + Intronic
1143696238 17:8621565-8621587 ATAAGAAAGCGACTGGAGAGTGG - Intronic
1144076899 17:11727733-11727755 ATAATAAAGGGGATGGAGAATGG + Intronic
1144193946 17:12872799-12872821 AAAAGAAAGGGAAAATAGAATGG - Intronic
1144400322 17:14891607-14891629 AAAAGAAAGCAAACGGTGAAAGG + Intergenic
1144534815 17:16077602-16077624 AAAAGAAAAGGAAGGGAGGAAGG + Intronic
1145992769 17:29089085-29089107 ATAATAAAGGGAGAGGAGAATGG + Intronic
1146583509 17:34060545-34060567 ATCAGGAAGGGACCAGAGAAAGG + Intronic
1146663162 17:34678650-34678672 ATGAGAAAGGGAGCTGAGAGTGG - Intergenic
1146755427 17:35427986-35428008 ATAAGAAATGGAACCTTGAAGGG + Intronic
1147243558 17:39106197-39106219 GAAAGAAAGGGAAGGGAAAAGGG - Intronic
1147463069 17:40588379-40588401 ATCAGGAAGGGACCAGAGAAAGG - Intergenic
1147799667 17:43074968-43074990 AAAAGAAAAGGAAGGGAGGAAGG + Intronic
1147818600 17:43228388-43228410 AGCAGGAAGGGAATGGAGAATGG - Intergenic
1147831883 17:43303090-43303112 AGCAGGAAGGGAATGGAGAATGG - Intergenic
1147875411 17:43617266-43617288 AGGAGGAAGGGAAGGGAGAATGG + Intergenic
1148011626 17:44486719-44486741 CTAAGAAATGAAACGGAGAAAGG - Intronic
1148158111 17:45434980-45435002 AAAAAAAAGGGAGGGGAGAAGGG + Intergenic
1148290431 17:46443433-46443455 AAAAGAAAGGTAACTGGGAAGGG - Intergenic
1148312599 17:46661006-46661028 AAAAGAAAGGTAACTGGGAAGGG - Intronic
1148320663 17:46749176-46749198 TGAAGAAAGGGAACTGAGAATGG + Intronic
1148728636 17:49816096-49816118 ATAAAAAAAGGAAGGGAGGAGGG - Intronic
1149572288 17:57680949-57680971 AATAGAAAGTGAATGGAGAAAGG - Exonic
1149586035 17:57787482-57787504 GTAAGGAAGAGAAAGGAGAAAGG - Intergenic
1150191028 17:63239470-63239492 GTAGGAAAGGGAACTGGGAATGG - Intronic
1150890599 17:69144837-69144859 AGAAGAAAGGGAAGGAAGGAAGG - Intergenic
1150938203 17:69660379-69660401 ATAAGACAGGGTATGGAGAAAGG - Intergenic
1151447712 17:74178023-74178045 GTAAGAAAGAGAACGGAGTCAGG + Intergenic
1152012526 17:77727166-77727188 AACAGAAAGGGCAAGGAGAAGGG - Intergenic
1152109018 17:78347053-78347075 AGAAGAAAGGGAAGGAAGGAAGG - Intergenic
1152243023 17:79170062-79170084 GGAAGAAAGGAAACGGAGGAAGG + Intronic
1152258249 17:79252766-79252788 AAAAGGAAGGGAAAGGAGAGGGG - Intronic
1203171014 17_GL000205v2_random:147942-147964 TTAAGATAGGGAAGTGAGAAAGG - Intergenic
1153168799 18:2292296-2292318 AGCAGAAAGGAAAAGGAGAAAGG - Intergenic
1153278208 18:3389955-3389977 GAAGGAAAGGGAAAGGAGAAAGG + Intergenic
1155048976 18:22130061-22130083 GAAAGAAAGAGAAAGGAGAAAGG - Intergenic
1155051142 18:22148889-22148911 AGAAGTAAGAGAACAGAGAATGG - Intergenic
1155389020 18:25313439-25313461 ATATGAAAGGGAAAGGGGAGGGG + Intronic
1155803976 18:30142843-30142865 AGAAGAAAGGAAAAAGAGAAAGG + Intergenic
1157272455 18:46286875-46286897 ATAAGAAAAGGAAGAGAGTATGG - Intergenic
1157428088 18:47601356-47601378 AAGAGAAAGGGAAGGGAGGAGGG - Intergenic
1157793098 18:50550470-50550492 AAAAGAAAGGGAACTGTAAATGG - Intergenic
1159202177 18:65201711-65201733 AAAAGAAAGGGAAAGAAGGATGG + Intergenic
1159246913 18:65818197-65818219 ATTAGAAATGAAATGGAGAATGG - Intronic
1159258682 18:65981399-65981421 ATGAGCAAGGGAACGGAAAAGGG - Intergenic
1159571521 18:70119468-70119490 AGGAGAAAGGGAAGGGAGAAGGG + Intronic
1160918663 19:1509648-1509670 GGAAGGAAGGGAAGGGAGAAAGG + Intronic
1161095416 19:2387571-2387593 AAAGGGAAGGGAAGGGAGAAAGG + Intergenic
1161918734 19:7250334-7250356 AAAAGAAAGAGGAGGGAGAAAGG + Intronic
1162254908 19:9482428-9482450 ATAAGGAAGGGAGGGGGGAAGGG + Intronic
1163963717 19:20723399-20723421 AAAAGAAAGAGATGGGAGAAAGG - Intronic
1164220877 19:23192616-23192638 ATTAGAAAGAGAAGGTAGAATGG - Intergenic
1164466065 19:28488686-28488708 AAAAGAAAGGGAAGGAAGAGAGG - Intergenic
1164581344 19:29437226-29437248 AGATGAATGGGAATGGAGAAGGG + Intergenic
1164992650 19:32695645-32695667 ATCAAAAAGGGGAAGGAGAAGGG - Intronic
1165243850 19:34486667-34486689 ATAAGAGAGGAAACTGACAAAGG - Intronic
1165694700 19:37892077-37892099 ATAGGAAAAGCAATGGAGAAAGG + Intronic
1166134392 19:40766819-40766841 AAAAAAAAGGGAAGGGAGATTGG + Intergenic
1166297595 19:41896631-41896653 ATGAGAAAAGGAAAGAAGAAGGG - Intronic
1166647784 19:44544982-44545004 ATAAGAAAAGGATCTCAGAAGGG + Intergenic
1167240785 19:48342068-48342090 AGAAGGGAGGGAAGGGAGAAAGG + Intronic
1167328999 19:48842721-48842743 AAGAGAAAGGGACTGGAGAAGGG - Intronic
1168539715 19:57199959-57199981 AGAAGAAAGAGAAAGGAAAATGG - Intronic
925343437 2:3152213-3152235 ATCAGAGAGGGACCAGAGAAAGG + Intergenic
925506281 2:4568811-4568833 GAAAGAAAGGGAAGGGAGAGTGG - Intergenic
925640152 2:5979334-5979356 ATAATAATGGGAAAAGAGAACGG + Intergenic
925807094 2:7661195-7661217 ATGAGAAAGGGAGAGGGGAAGGG + Intergenic
926974006 2:18495288-18495310 ATAGGAAGGGGAAAGGAGAAAGG - Intergenic
927138970 2:20117195-20117217 ATAAGAAAGGGAAAGGCCATAGG + Intergenic
927732910 2:25491101-25491123 TTAAGAAAGCAAACTGAGAAGGG + Intronic
927909681 2:26888190-26888212 AAAAGAAAGGGAAGGAAGGAAGG - Intronic
928287328 2:30004113-30004135 AAAAGAAAGTGAAAGGACAATGG + Intergenic
928329776 2:30348742-30348764 ATAGGAAAGGCAGTGGAGAAAGG + Intergenic
929139792 2:38656805-38656827 ATAAGAAAGGGGACAGGGGAGGG - Intergenic
929967764 2:46548377-46548399 ATGAGAAAAGGGAAGGAGAAAGG + Intronic
930679174 2:54237836-54237858 AGAAGAGAGGGAAGAGAGAATGG - Intronic
930706571 2:54510244-54510266 ATTAGAAAAGGAACAAAGAATGG - Intronic
930799099 2:55423916-55423938 ATAAGACAGGGAAGAGAGAAGGG + Intergenic
931402132 2:61941007-61941029 AAAAAAAAGGGAAAGGAAAAAGG - Intronic
931799401 2:65743890-65743912 ATAACAGAGGGAAGGGAGGAGGG - Intergenic
931947338 2:67324798-67324820 AGAAGAAAAGGAAGGGGGAAGGG + Intergenic
932136652 2:69236963-69236985 ACAAAAAAAGGAAGGGAGAAGGG - Intronic
932553569 2:72797468-72797490 ATAAGAAAAGGAACAAAGTAGGG + Intronic
932584510 2:73018249-73018271 GGAAGAAAAGGAAAGGAGAAAGG + Intronic
932601892 2:73133384-73133406 AAAAAAAAGGGAAGGGAGAGGGG + Intronic
932878731 2:75479523-75479545 ATAACAACAGGAACTGAGAAAGG - Intronic
933060004 2:77725255-77725277 AGATGGAAGGGAAGGGAGAAGGG + Intergenic
933383435 2:81580814-81580836 GTAAGACAGGGAAGGGGGAATGG + Intergenic
933794131 2:85906401-85906423 AAAAGAAAGGGAAGGAAGGAAGG - Intergenic
933990152 2:87628091-87628113 AAAAAAATGGGAAGGGAGAATGG + Intergenic
934165437 2:89290045-89290067 ATAAGAAAGGGAGGGAAGAAGGG - Intergenic
934201836 2:89892417-89892439 ATAAGAAAGGGAGGGAAGAAGGG + Intergenic
934700489 2:96435869-96435891 ATAAAAAAGGGTGTGGAGAAAGG - Intergenic
934789618 2:97047492-97047514 GGATGAAAGGGAAAGGAGAATGG + Intergenic
934790383 2:97054916-97054938 ATTAGAGAGAGAAGGGAGAAAGG - Intergenic
934816085 2:97327621-97327643 ATTAGAGAGAGAAGGGAGAAAGG + Intergenic
934816848 2:97335048-97335070 GGATGAAAGGGAAAGGAGAATGG - Intergenic
934820848 2:97373436-97373458 GGATGAAAGGGAAAGGAGAATGG + Intergenic
934821611 2:97380863-97380885 ATTAGAGAGAGAAGGGAGAAAGG - Intergenic
935205999 2:100896829-100896851 AGAAGAAAAGGAAGGGAGGAAGG - Intronic
935434168 2:103010506-103010528 ATAAAAGAGGAAACAGAGAAAGG + Intergenic
935726936 2:106031653-106031675 ATAATAAAGTGAACAGAGAATGG - Intergenic
936098242 2:109550796-109550818 ATAATACAGGGTACGAAGAAGGG - Intronic
936303694 2:111322733-111322755 AAAAAAATGGGAAGGGAGAATGG - Intergenic
936504117 2:113091351-113091373 AAAAGGAAGAGAAAGGAGAATGG + Intergenic
937989708 2:127655329-127655351 AGAAGGAAGGGAACGCAGGAAGG + Intronic
938266493 2:129931880-129931902 ATAATCCAGGGAAGGGAGAAAGG + Intergenic
938618271 2:133021944-133021966 TTAAGCAAGGGAATGGACAATGG + Intronic
938657278 2:133447408-133447430 AAAAGAAAGGGAAGGAAGGAAGG - Intronic
939326437 2:140695946-140695968 ATAAGAAATGGATGGGATAAAGG - Intronic
939856731 2:147367302-147367324 ATAAGAAAGGGAATTGATCAAGG - Intergenic
940172251 2:150842305-150842327 ATCAGAAAGGCACCAGAGAAAGG - Intergenic
940983388 2:160027311-160027333 AAAAGAGAAGGAACGGAGAAAGG + Intronic
941187610 2:162336535-162336557 AAAAGAAAGGGAGAGGAGATGGG - Intronic
941410813 2:165155392-165155414 AAAAGAAAGGGAAAGGGAAAGGG - Intronic
941491965 2:166153751-166153773 ATAAGAAGGGACAAGGAGAAAGG + Intergenic
942516936 2:176764166-176764188 GGAAGAAAGGGATAGGAGAAGGG + Intergenic
942737279 2:179128814-179128836 ATAAGAGACAGACCGGAGAATGG - Intronic
942739176 2:179154260-179154282 AGAAGAAAGGGAAGGAAGGAAGG + Intronic
943340681 2:186677011-186677033 AAAAGTAAGGGAAGGAAGAAAGG + Intronic
943456407 2:188112862-188112884 AAAAGAAAGGAAAGGAAGAAAGG + Intergenic
943757330 2:191570097-191570119 AAAAGAAAGGGAAGGAAGGAAGG - Intergenic
944171570 2:196784932-196784954 AAAAGAATGGGAAAGAAGAAAGG + Intronic
944354751 2:198773970-198773992 ATAAGAAATGGGATGGGGAAGGG - Intergenic
944526844 2:200627974-200627996 GGAAGAAAGAGAAAGGAGAAAGG - Intronic
944564424 2:200973126-200973148 TAAAGAAAGGGAAAGGAAAAAGG + Intergenic
944787782 2:203090938-203090960 AAAGGGAAGGGAAGGGAGAAAGG + Intronic
944827515 2:203500280-203500302 ATATGTAAGAGAAAGGAGAAGGG + Intronic
944929666 2:204503678-204503700 ACAAAAAAGGGAACGGGGCAAGG + Intergenic
945098481 2:206241798-206241820 ATAAAAAATGGATCTGAGAATGG + Intergenic
945297094 2:208181587-208181609 ACAAGAAAGGGAAAGGATAATGG - Intronic
945702246 2:213186579-213186601 AGAACAAAGAGAACAGAGAAAGG - Intergenic
945815190 2:214596898-214596920 ACAAGAAAGGAAAAGGCGAATGG + Intergenic
946012321 2:216575412-216575434 AGAATAAAGGGATGGGAGAATGG - Intronic
946492241 2:220160011-220160033 AAAAGAAAGGGAAAAAAGAAGGG - Intergenic
946531798 2:220578321-220578343 TTGAGAAAGGGAAAGGAGATGGG + Intergenic
946890145 2:224267067-224267089 ATAAGAAAATGAAGGAAGAAGGG - Intergenic
947185178 2:227448599-227448621 AAAAGAAAGGGAAGGGAAGAGGG - Intergenic
947382584 2:229559628-229559650 AGAAGAAAGGGAAGGAAGGAGGG + Intronic
1169465915 20:5838336-5838358 ATGGGAAATGGAAAGGAGAATGG + Intronic
1169518843 20:6349694-6349716 AGAAGAAAGGAAAGGAAGAAGGG - Intergenic
1169539762 20:6586674-6586696 AGGAGAAAGGGAAAGGGGAAAGG + Intergenic
1169709735 20:8548105-8548127 AAAAGAAAAGGAAGGAAGAAGGG - Intronic
1169893847 20:10481374-10481396 TTAAGAAATGGAACAGACAATGG - Intronic
1169951540 20:11049689-11049711 AGAAGAAAGGGAAGGGAAGAAGG - Intergenic
1170361638 20:15552886-15552908 ATAGGAAAGGCAACTGAGAAGGG - Intronic
1170400136 20:15973267-15973289 ATGAGGAAGGGAATGAAGAAAGG + Intronic
1170509026 20:17058005-17058027 AGAAGGAAGGGAAGGGAGGAGGG + Intergenic
1171103296 20:22407205-22407227 AAAAGAAAGAGAAGAGAGAAGGG + Intergenic
1171210811 20:23315572-23315594 ATGGGAAAGGGCACGGAGATGGG - Intergenic
1171319334 20:24225794-24225816 CAAAGAAAGGGATGGGAGAAAGG + Intergenic
1171445735 20:25203368-25203390 CTAAGAAAGAGAAGAGAGAATGG - Intronic
1171906934 20:30906926-30906948 AAAAGAAAGAAAACGGGGAAGGG - Intergenic
1172043224 20:32060884-32060906 AAAAGAAAAGGAAGGAAGAAAGG + Intronic
1172806967 20:37619030-37619052 GAAGGAAAGGGAAAGGAGAAAGG - Intergenic
1173103905 20:40113335-40113357 ATAAGAAAGGAAGAGGAGGAAGG - Intergenic
1173478942 20:43384124-43384146 AGAAGAAAGGGACCAGAGAGAGG - Intergenic
1173937560 20:46880699-46880721 AGAAGAAAGGCAAAGGGGAAAGG - Intergenic
1174062764 20:47844138-47844160 AGGAGAAAGAGAAGGGAGAAAGG + Intergenic
1174202078 20:48813666-48813688 AGAAGAAAGGAAAGGGAGAGGGG + Intronic
1174334995 20:49853628-49853650 AGAAGAAAGGGAAGGAAGAAAGG - Intronic
1174417891 20:50379600-50379622 ATAAAAACTAGAACGGAGAAGGG + Intergenic
1174604501 20:51751049-51751071 ATAAAGAAGGGAAGGAAGAAGGG + Intronic
1175140449 20:56857019-56857041 AAAAGGAAGGGAAAGGAGAAGGG + Intergenic
1176326998 21:5509773-5509795 TTAAGATAGGGAAGTGAGAAAGG - Intergenic
1176330712 21:5546438-5546460 TTAAGATAGGGAAGTGAGAAAGG + Intergenic
1176397045 21:6274513-6274535 TTAAGATAGGGAAGTGAGAAAGG - Intergenic
1176400759 21:6311178-6311200 TTAAGATAGGGAAGTGAGAAAGG + Intergenic
1176436398 21:6677926-6677948 TTAAGATAGGGAAGTGAGAAAGG - Intergenic
1176440112 21:6714591-6714613 TTAAGATAGGGAAGTGAGAAAGG + Intergenic
1176460660 21:7004996-7005018 TTAAGATAGGGAAGTGAGAAAGG - Intergenic
1176464374 21:7041660-7041682 TTAAGATAGGGAAGTGAGAAAGG + Intergenic
1176484221 21:7386774-7386796 TTAAGATAGGGAAGTGAGAAAGG - Intergenic
1176487935 21:7423439-7423461 TTAAGATAGGGAAGTGAGAAAGG + Intergenic
1176945744 21:14979279-14979301 ATAAGAAATGTAATGGAAAATGG + Intronic
1176989343 21:15476281-15476303 AGAAGAAAGAAAATGGAGAATGG + Intergenic
1177299258 21:19219575-19219597 AGCAGAAGGGGAAGGGAGAAGGG + Intergenic
1177383174 21:20371901-20371923 AGAAGAAAGGAGACTGAGAAGGG + Intergenic
1178059503 21:28835687-28835709 ATAAGGGAGGGACCAGAGAAAGG + Intergenic
1178744795 21:35238431-35238453 ATAAGAAAGGAAATGGAGCAAGG + Intronic
1178761654 21:35408727-35408749 AGAAGAAAATGAATGGAGAATGG + Intronic
1178965805 21:37116326-37116348 GTAAGAGAGGGAAAGGAGATTGG + Intronic
1179045135 21:37837189-37837211 ATAAGAAAAAAAATGGAGAAGGG - Intronic
1179341247 21:40512070-40512092 ATGAGAAAGGCAAGGGAGATAGG + Intronic
1179378601 21:40877574-40877596 AGTAGAAAGAGAACAGAGAATGG + Intergenic
1180438411 22:15337937-15337959 AATAGAAACAGAACGGAGAATGG + Intergenic
1180607082 22:17067006-17067028 AAAAGAAAGAAAACGGGGAAGGG + Intergenic
1182068190 22:27444909-27444931 AGAAGAAAAGGAAGGAAGAACGG + Intergenic
1183011199 22:34948165-34948187 ATAAGAAAGGAAACTGAGGAAGG + Intergenic
1183153190 22:36053822-36053844 AAAGGGAAGGGAAGGGAGAAGGG - Intergenic
1183464977 22:37975108-37975130 ATAGGAAAGTGAACAGACAAAGG - Intronic
1184520108 22:44988465-44988487 AAAGGAAAGGGAAAGGAAAAAGG + Intronic
1184959385 22:47917970-47917992 AGAAGAGAAGGAAGGGAGAAAGG - Intergenic
949283932 3:2379252-2379274 AAAAAAAAGGAAACGGAAAAAGG - Intronic
951111556 3:18810331-18810353 GAAAGAAAGGGACCAGAGAAAGG + Intergenic
951494378 3:23309934-23309956 AAGAGAAAAGGAAAGGAGAAGGG + Intronic
951597252 3:24331866-24331888 ATAAAAAGGGGAACGATGAAAGG - Intronic
951870235 3:27353904-27353926 GAAAGAAAGAGAAGGGAGAAGGG + Intronic
952302220 3:32113502-32113524 GGAGGAAAGGGAAAGGAGAATGG - Intronic
952358535 3:32606544-32606566 AAAAGAAAGAGAAAGAAGAAAGG + Intergenic
952652995 3:35748386-35748408 AAAAGAAAAGAAAGGGAGAAAGG + Intronic
953061603 3:39432834-39432856 ATAAGAAAATGAAGGGAGGAAGG - Intergenic
953189327 3:40669080-40669102 ATAAGAAAGGAGAGAGAGAAAGG + Intergenic
953740114 3:45530816-45530838 ATAAGAAAAGAAATGAAGAAAGG - Intronic
954108820 3:48423108-48423130 ATAAAAAAGGGAAGAGAGACTGG - Intronic
954597117 3:51835468-51835490 AAAAGAAAGGGAAAGAATAAAGG - Intergenic
954940223 3:54365462-54365484 AGAAGAAAGGGAAGGAGGAAAGG - Intronic
955010244 3:55006815-55006837 ATAAGAACTAGAACTGAGAATGG - Intronic
955150680 3:56363857-56363879 AAAAGAAAGGGAAAGGGAAAGGG + Intronic
955175514 3:56610510-56610532 ATCAGAGAGGGACCAGAGAAAGG - Intronic
955769791 3:62375385-62375407 AAAAGAGAGGGAACAGAGAGAGG + Intergenic
956864589 3:73356688-73356710 GAAAGAAAGGGAAAGAAGAAGGG - Intergenic
957644098 3:82897124-82897146 ATAAGGAAGGAAAATGAGAAAGG + Intergenic
958181597 3:90067544-90067566 AGGAGAAAAGGAAGGGAGAAAGG + Intergenic
958682301 3:97346579-97346601 ATTAGTAAGGGAAAGGAGGAAGG + Intronic
958766283 3:98372118-98372140 AAAGGAAAGGGAAAGGGGAAGGG + Intergenic
958908446 3:99967036-99967058 ATAAGAGAGGGAAAGGATATGGG + Intronic
959491360 3:106992377-106992399 AAAAGTAAAGGAATGGAGAAGGG + Intergenic
959678115 3:109060376-109060398 ATAAGAAAGGTAACTGGGCATGG - Intronic
959899175 3:111640182-111640204 ATCAGAGAGGGACCAGAGAAAGG + Intronic
959927925 3:111945704-111945726 ATAAGAGAGGGGAGGGAGAAAGG - Intronic
959992693 3:112646277-112646299 ATACCTAAGGGCACGGAGAAAGG - Intronic
960062213 3:113335022-113335044 TAAAGAAAAGGAAAGGAGAAAGG + Intronic
960094003 3:113670606-113670628 AAAAAAAAGGGAAGGGGGAAGGG + Intronic
961119408 3:124360750-124360772 AAAAGAAAGGGAGAAGAGAAAGG - Intronic
961192210 3:124971422-124971444 GAAAGAAAGGGAAAGGAGAAAGG - Intronic
961379112 3:126485956-126485978 AGGAGAAAGGGACAGGAGAATGG + Intronic
961660277 3:128464948-128464970 AGAAGGGAGGGAAGGGAGAAGGG - Intronic
962291098 3:134136936-134136958 GTAGGAAAGGGGACGGAGAGCGG + Intronic
964244067 3:154630290-154630312 ACAAGAAGGGGAAGGGAGGAAGG - Intergenic
965406457 3:168275471-168275493 ATACAGAAGGGAACAGAGAAAGG + Intergenic
965468965 3:169066314-169066336 ATAAGAAAGGGCAGAGAAAAAGG - Intergenic
965684030 3:171282827-171282849 CTAAGAAAGAGAAGGCAGAATGG + Intronic
966521905 3:180882372-180882394 AGAAGAAAGGGGAAGAAGAAGGG - Intronic
966920328 3:184607097-184607119 ATAAGAATGTGCACCGAGAAAGG - Intronic
967336827 3:188353212-188353234 ATAAAAAGTGGAAGGGAGAAAGG - Intronic
967763277 3:193249596-193249618 ACAAGAAAGGGAAGAGAGAAAGG - Intronic
967936394 3:194731270-194731292 AAAGGAAAGAGAAAGGAGAAAGG + Intergenic
970274854 4:14387403-14387425 AGAAGAAATGGAAAGGAGAATGG - Intergenic
970867219 4:20772927-20772949 ATAAGAAAGGGAAAGGGGCCGGG - Intronic
971063582 4:23001236-23001258 GAAAGAAAGGGAAAGGAGGAAGG + Intergenic
971631871 4:29002984-29003006 AGAAGAAAGAGAAGGAAGAAAGG - Intergenic
971878519 4:32336997-32337019 ATAAGGAAGGCAAAAGAGAAAGG + Intergenic
971978958 4:33729724-33729746 AGAAGAAAGAGAACGGAAAAAGG + Intergenic
972132085 4:35850408-35850430 CTAAGAAAGGAGACTGAGAAGGG - Intergenic
972343308 4:38171747-38171769 AAAAAAAAGGCAAGGGAGAAAGG + Intergenic
972794419 4:42401014-42401036 ATGAGAAAGGGGACGTAGACAGG - Exonic
972924344 4:43984830-43984852 AAAGGAAAGGGAAGGGAGGAAGG + Intergenic
973085100 4:46048675-46048697 GAAGGAAAGGGAAGGGAGAAAGG + Intronic
973611404 4:52638914-52638936 CTATAAAAGGGAAGGGAGAATGG - Intronic
973894502 4:55397727-55397749 AAAAGGAAAGGAAGGGAGAAAGG - Intronic
973953724 4:56042362-56042384 GGAAGAAAAGGAACGAAGAAAGG - Intergenic
974010451 4:56601756-56601778 CTAAGAAAGAGAAAGGAAAAAGG + Intronic
974137915 4:57842588-57842610 AAAAGAAACGGAATTGAGAAAGG + Intergenic
974187753 4:58463473-58463495 ATCAAAAAGGGGAAGGAGAAGGG + Intergenic
974838438 4:67276920-67276942 ATCAGAAAGGGGAAGGAGAGGGG - Intergenic
974951085 4:68583299-68583321 ATCAGGGAGGGAACAGAGAAAGG + Intronic
975239503 4:72041143-72041165 ACAAGAAGGGGAAGGGAGGAAGG - Intronic
975895482 4:79084924-79084946 AAAGGGAAGGGAAGGGAGAAAGG + Intergenic
976064359 4:81166769-81166791 TTAAGAAATGGAGCAGAGAAAGG - Intronic
976259063 4:83128498-83128520 AAGAGAAAGGGAACGGGAAAGGG - Intronic
976825360 4:89254830-89254852 AAAAGAAAGGGAAGGAAAAAGGG - Intronic
977047487 4:92085762-92085784 AAAAGAAAGGAAAGAGAGAAAGG + Intergenic
977141204 4:93374769-93374791 ATATGAAAGAGAACGAAGGAAGG + Intronic
977257778 4:94758758-94758780 ATAAGGAGAGGAAGGGAGAAAGG - Intronic
977504428 4:97883920-97883942 ATAGGAAAAGGAAGGAAGAAAGG + Intronic
977517373 4:98037598-98037620 AAAAGAAAGGGAAAGAGGAAAGG + Intronic
979002126 4:115235147-115235169 AAAAGAAAGCCAATGGAGAAAGG + Intergenic
979129959 4:117031296-117031318 ATAAGAATGGGAATTGAGACAGG - Intergenic
979231222 4:118351594-118351616 AAAAGAAAGGGAAAAGAGATGGG - Intronic
979821611 4:125180476-125180498 GAAAGAAAAGGAAAGGAGAAAGG + Intergenic
980240361 4:130165507-130165529 AGAAGAAAAGGAAGGGAGATAGG + Intergenic
980776667 4:137445744-137445766 AAAAAAAAGGGAATGGAGATAGG + Intergenic
981495644 4:145389171-145389193 ATAAGGAGGGAAAAGGAGAATGG - Intergenic
982018414 4:151178905-151178927 AAAAGGAAGGGAAAAGAGAAGGG - Intronic
982804676 4:159748990-159749012 AAAGGAAAGGGAAAGGGGAAGGG - Intergenic
982804696 4:159749054-159749076 AGGAGAAAGGGAAGGGAAAAGGG - Intergenic
983173360 4:164559953-164559975 ATAAGAGACAGAAAGGAGAAGGG + Intergenic
983225036 4:165077848-165077870 AAAAAAAACGGAAGGGAGAAAGG + Exonic
983441042 4:167785226-167785248 ATGAGACAGGGAATGAAGAAGGG - Intergenic
984086277 4:175315917-175315939 CTAAGAATGGGAACAAAGAAAGG + Intergenic
984859025 4:184220124-184220146 AAAGGAAAGGGAAAGGGGAAGGG + Intronic
984911488 4:184677052-184677074 AAAGGAAAGGGAAAGGGGAAGGG - Intronic
985817639 5:2138352-2138374 AAAGGGAAGGGAAGGGAGAAAGG - Intergenic
986608968 5:9547776-9547798 CCAAGCAAGGGAAGGGAGAACGG - Intergenic
986982937 5:13469858-13469880 ATAGGAGAGTGAACAGAGAAAGG - Intergenic
987517054 5:18924123-18924145 AGAAGAAAGGGAAAGGAGGAAGG + Intergenic
987697006 5:21344791-21344813 ATAAGAAAAGGAAGGAAGGATGG - Intergenic
988554074 5:32221404-32221426 AAATGATGGGGAACGGAGAAAGG - Intergenic
988755235 5:34241906-34241928 ATAAGAAAAGGAAGGAAGGATGG + Intergenic
988868062 5:35357119-35357141 AGAAGAAAGGGAAAGGGAAAAGG - Intergenic
989069670 5:37497294-37497316 AAAGGGAAGGGAAGGGAGAAGGG - Intronic
989131021 5:38106501-38106523 ATAAAACAGGGACCAGAGAATGG - Intergenic
989367009 5:40667466-40667488 AGGAGGAAGGGAAGGGAGAAAGG - Intergenic
989386369 5:40858497-40858519 AAAAGAAAAGGAAAGAAGAATGG - Intronic
989768389 5:45113629-45113651 GCAAGAAAAGGAACAGAGAATGG - Intergenic
990200342 5:53365900-53365922 ATAAAGAAGGGAAGGGAGAGAGG - Intergenic
990354519 5:54952983-54953005 ATAAAAAAGAGAATGGATAAAGG - Intergenic
990421710 5:55642031-55642053 ACAAGGAAGGGAAAGGGGAAGGG - Intronic
990728083 5:58778462-58778484 ATAAGAAAGGGAACAAAGGCAGG + Intronic
990951058 5:61298905-61298927 AGGAGAAAGGGAAAGGGGAACGG + Intergenic
990958070 5:61363832-61363854 AAAGGAAAGGGAAGGGAGGAAGG - Intronic
991106171 5:62844261-62844283 AAAAGAAAGAGAAAGGAGAACGG - Intergenic
991616843 5:68505752-68505774 AAAAAAAAGGGAGGGGAGAAGGG - Intergenic
991743451 5:69707591-69707613 ATAAGAAAAGGAAGGAAGGATGG + Intergenic
991754249 5:69847613-69847635 ATAAGAAAAGGAAGGAAGGATGG - Intergenic
991795024 5:70287327-70287349 ATAAGAAAAGGAAGGAAGGATGG + Intergenic
991822834 5:70582901-70582923 ATAAGAAAAGGAAGGAAGGATGG + Intergenic
991833573 5:70722760-70722782 ATAAGAAAAGGAAGGAAGGATGG - Intergenic
991887397 5:71286865-71286887 ATAAGAAAAGGAAGGAAGGATGG + Intergenic
992160570 5:73996811-73996833 GTGAGAGAGGGAAAGGAGAATGG - Intergenic
992455606 5:76912749-76912771 ATCAAAAAGGGGAAGGAGAAGGG + Intronic
992778270 5:80106476-80106498 AGAAGAAGGGGAACAGAGGAAGG + Intergenic
993575772 5:89598458-89598480 GTAAGAAAGCAAAAGGAGAAAGG - Intergenic
993691915 5:91012329-91012351 ATAAGAAAATGGGCGGAGAAAGG - Intronic
993956924 5:94245520-94245542 ATAAAAAAAGAAAGGGAGAAAGG - Intronic
994000825 5:94776897-94776919 ATAAGAAATGGAAATGAGAAAGG - Intronic
994051196 5:95364948-95364970 ATCAGAGAGGCAACAGAGAAAGG - Intergenic
994490952 5:100442822-100442844 AAAAGAAAAGGAAAAGAGAAAGG + Intergenic
995397507 5:111702925-111702947 AAAAGGAAGGGAGGGGAGAAGGG + Intronic
995735855 5:115298387-115298409 AGAAGAAGGAGAAGGGAGAAGGG + Intergenic
995901798 5:117077997-117078019 AGAAGAAAGGGAGAGGAGTAAGG + Intergenic
996022238 5:118604088-118604110 ATAAGGAAGGGGAAGGAGAAGGG - Intergenic
996734788 5:126748717-126748739 GAAAGAAAGGGAAGGAAGAAAGG - Intergenic
997092591 5:130875069-130875091 AGAAGACAGAGAACAGAGAAGGG + Intergenic
997708852 5:135986123-135986145 AGAAGAAAGGGAAGAGGGAAGGG - Intergenic
998250890 5:140551553-140551575 AAAAGAAAGGGAAAGTAGCATGG - Intronic
999059587 5:148619024-148619046 AAAAGAAAGTGAATGAAGAAAGG + Intronic
999230234 5:150057446-150057468 ATAACAAGGGAAAAGGAGAAGGG - Intronic
999236191 5:150097255-150097277 AAAAGAAAGGGAAAGAAGGAAGG + Intronic
999432646 5:151537387-151537409 AAAGGAAAGGAAAGGGAGAAAGG + Intronic
999751661 5:154632194-154632216 AGAAGAGAGGGAAGGAAGAAAGG - Intergenic
1000428805 5:161125513-161125535 AAAAGAAAGTGAACAGTGAAGGG - Intergenic
1000814296 5:165900931-165900953 AAAAGAAAGGGAATGAAGATGGG - Intergenic
1001002167 5:168017888-168017910 AGAAGAAAGTGACGGGAGAAGGG - Intronic
1001596869 5:172904132-172904154 ATAAGAAAGGAAAGGAAGGAGGG - Intronic
1001609992 5:172992643-172992665 ATAAGACAGGAAAGGGAGACGGG - Intronic
1001640367 5:173239468-173239490 ATAGGAGAGGGAAGGGAGAAGGG - Intergenic
1001935645 5:175701775-175701797 ATGAGAAGGGGAACTGAGGATGG + Intergenic
1002096884 5:176836653-176836675 ATCAGAAAGGGCTCGGAGAAGGG + Intronic
1002482632 5:179513327-179513349 ACAAAAAAGGGAAGGAAGAAAGG - Intergenic
1002947984 6:1780922-1780944 ATGTGAAAGGAAAAGGAGAAGGG - Intronic
1003210287 6:4057619-4057641 ATAAGAAAAGGTACCAAGAAAGG - Intronic
1003432584 6:6053435-6053457 ATGGGAAAGGGAAAGGAGAATGG + Intergenic
1003686000 6:8302864-8302886 ATAAGGAAGGGAAGGGAGCAGGG - Intergenic
1004285261 6:14315568-14315590 AAAAGAAAGGGAAAGAAGAAAGG + Intergenic
1004387562 6:15185684-15185706 AAAAGAAAGGGAAGGAAGGAAGG + Intergenic
1004956268 6:20731124-20731146 ATAAGGGAAGGAACGCAGAAGGG + Intronic
1004990995 6:21138623-21138645 AGAAGAAAGGGAAAGGAAATAGG - Intronic
1005074865 6:21897003-21897025 ATCTGAAAGGGACTGGAGAAAGG - Intergenic
1005219166 6:23566357-23566379 ATAAGAAAAGGAACCAAGAGAGG + Intergenic
1005553856 6:26953619-26953641 ATAAGAAAAGGAAGGAAGGATGG + Intergenic
1005684290 6:28237527-28237549 ACAAGAAAGGGAAATAAGAAAGG - Intergenic
1005845431 6:29773304-29773326 AGAAGAAAGGGAAGGAATAAAGG - Intergenic
1006166977 6:32070893-32070915 ATAAGAAAGGGAACGGAGAAGGG - Intronic
1006452465 6:34113084-34113106 AGAAGAAAGGGAAGGGAGGAAGG - Intronic
1006684576 6:35821769-35821791 ATAAAAAAGGGAGCCGAGCACGG - Intronic
1006696476 6:35934441-35934463 ATAAGACTGGGAAGGGGGAAAGG + Intergenic
1007160825 6:39790724-39790746 TTGAGAAAGGCAAGGGAGAATGG + Intergenic
1007903675 6:45437131-45437153 ATAAGAAGGGGAAAAGAGACAGG - Intronic
1008041635 6:46807624-46807646 AGAAGGAAGGAAAGGGAGAAAGG + Intronic
1008221369 6:48857694-48857716 ATAAGAAAAGGAAAGAAGAAAGG + Intergenic
1008389694 6:50935610-50935632 GGAAGAAAGTGAAAGGAGAAAGG - Intergenic
1008543564 6:52566302-52566324 ATGAGAAAGAGAGCTGAGAATGG + Intronic
1008862978 6:56173370-56173392 AAAGGAAAGGGAAAGGAGAAGGG + Intronic
1009929275 6:70157008-70157030 AAAAGTAAGGGAAAGGAGGAAGG + Intronic
1010095988 6:72046507-72046529 AGAAGGATGGGAACGGGGAAAGG + Intronic
1010926511 6:81752182-81752204 AAAAGAAAGGGAAAGGAGCGCGG + Intronic
1011124474 6:83992703-83992725 AAAGGAAAGGGAAAGGAGAAAGG - Intergenic
1011794312 6:90936192-90936214 TTAAGACAGGGAACGGAAAAAGG - Intergenic
1011902157 6:92312513-92312535 AAAAGAAAAGGAAGGAAGAAAGG - Intergenic
1012045513 6:94267688-94267710 AGAAGAGAGGGAACATAGAAAGG - Intergenic
1012071187 6:94618852-94618874 AAAGGAAAGGGAAGGGGGAAAGG - Intergenic
1012852743 6:104466541-104466563 ATAATAAAGGGAAGGGAAACTGG - Intergenic
1013831920 6:114282720-114282742 GGAAGAAAGGGGAGGGAGAAAGG - Intronic
1014360729 6:120470549-120470571 ATAAAAAATGGAACAGTGAAAGG - Intergenic
1014377689 6:120696429-120696451 AGAAGAAAGGGAAGGAAGGAAGG + Intergenic
1014433092 6:121392071-121392093 AGAAGAAAGAAAAGGGAGAAAGG + Intergenic
1014448839 6:121560062-121560084 GGAAGAAAGGGAAGGAAGAAAGG - Intergenic
1014586520 6:123204037-123204059 ATAAGAAAGTGATGGGAGGAAGG - Intergenic
1014626546 6:123733228-123733250 GTAAGAAAAGGAAAGAAGAAAGG + Intergenic
1014714068 6:124843145-124843167 ATAAGAAAGGCAATGAAGACAGG - Intergenic
1014829562 6:126086396-126086418 ATAGGTATGGGAATGGAGAAAGG - Intergenic
1015392327 6:132696762-132696784 AGAAGAAAGGAAAGAGAGAAGGG + Intronic
1015484551 6:133753759-133753781 ATAAAACAGGAAATGGAGAAAGG + Intergenic
1015876852 6:137831172-137831194 ACAAGAAAGGGCAGGGGGAAGGG - Intergenic
1015900668 6:138062094-138062116 AAAAGAAAAGAAACGGAAAACGG + Intergenic
1015915343 6:138210562-138210584 AAAAGAAAGGGAAAGCAGGAGGG - Intronic
1016021507 6:139240984-139241006 AGAGGAAAGGGAAGGAAGAAAGG - Exonic
1016063598 6:139655749-139655771 AACAGAGAGGGAAAGGAGAAGGG + Intergenic
1016165644 6:140939154-140939176 ATCAGGAAGGGAATGGAGCATGG - Intergenic
1016945599 6:149529801-149529823 AAGAAAAAGGGAAAGGAGAAAGG + Intronic
1018174743 6:161168752-161168774 ACATGACAGGGAAAGGAGAAAGG + Intronic
1018331622 6:162733884-162733906 ATAAAACAGGGAAGGGAGATGGG - Intronic
1018888424 6:167962019-167962041 ATTAAAAAGGGAGAGGAGAAAGG + Intronic
1019410706 7:905362-905384 AAGGGAAAGGGAAAGGAGAAAGG + Intronic
1019410721 7:905447-905469 GGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410725 7:905467-905489 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410756 7:905613-905635 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410759 7:905626-905648 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410762 7:905639-905661 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410767 7:905666-905688 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410775 7:905714-905736 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410779 7:905727-905749 AGGAGAAAGGGAAAGGAGAAGGG + Intronic
1019410816 7:905901-905923 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410831 7:905974-905996 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410837 7:906008-906030 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410841 7:906028-906050 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410849 7:906070-906092 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410864 7:906143-906165 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410869 7:906170-906192 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410876 7:906211-906233 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410891 7:906284-906306 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410897 7:906318-906340 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410901 7:906338-906360 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410910 7:906393-906415 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410915 7:906414-906436 GGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410921 7:906448-906470 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410927 7:906482-906504 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410934 7:906517-906539 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410942 7:906552-906574 GGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410945 7:906565-906587 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410954 7:906607-906629 GGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410959 7:906634-906656 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019939304 7:4276689-4276711 AAATGAAAGGGAAAGGAAAAAGG - Intergenic
1020361135 7:7327993-7328015 AGAAGGAAGGGAAGGGGGAAAGG + Intergenic
1020451673 7:8326661-8326683 ATGAGGAAGGGATGGGAGAAGGG - Intergenic
1021493077 7:21241739-21241761 AAAAGAAAGGGAAGGGAGAAAGG - Intergenic
1022200343 7:28110551-28110573 AAAGGAAAGGGAAAGGAAAAGGG + Intronic
1022262568 7:28720542-28720564 ATAGGCAGGGGAACGGCGAAGGG + Intronic
1023156463 7:37256770-37256792 AGGAGGAAGGGAAGGGAGAAGGG + Intronic
1023611934 7:41980578-41980600 ATATGAAAGGGAAAGAAAAAAGG + Intronic
1023805678 7:43871250-43871272 AGAGGAAAGGGGAAGGAGAAAGG + Intronic
1023811887 7:43918316-43918338 AAAGGAAAGGGAAAGGAGAAGGG - Intronic
1024430027 7:49277545-49277567 ATAAGAAATGTAACTGTGAATGG + Intergenic
1024737667 7:52323313-52323335 AAAAGAAAGGGAAGGGGAAAGGG - Intergenic
1024737688 7:52323372-52323394 GAAGGAAAGGGAAGGGAGAAGGG - Intergenic
1025231673 7:57206985-57207007 AGGAGAAAGAGAAGGGAGAAAGG - Intergenic
1025772902 7:64529361-64529383 ATAAGAAAGGCATCAGAGAAAGG + Intronic
1025996248 7:66529302-66529324 CTTAGAAAGGGAACGGAGCCGGG + Intergenic
1026139085 7:67689601-67689623 ATCAGAGAGGGACCAGAGAAAGG - Intergenic
1026781976 7:73274375-73274397 AAAAAAAAGGGAAAGGAAAAAGG - Intergenic
1026988213 7:74568208-74568230 CTTAGAAAGGGAACGGAGCTGGG + Intronic
1026997607 7:74628621-74628643 AGAGGAAAGGGAAAGGAGAAAGG - Intergenic
1027022829 7:74827816-74827838 AAAAAAAAGGGAAAGGAAAAAGG - Intronic
1027065186 7:75118085-75118107 AAAAAAAAGGGAAAGGAAAAAGG + Intronic
1027537278 7:79419427-79419449 AGAGGAAAGGGAATGGAGAGAGG + Intronic
1027707154 7:81549262-81549284 AGCAGAAAGGAAAAGGAGAAAGG - Intergenic
1027817118 7:82989761-82989783 GAAATAAAGGGAAAGGAGAAGGG - Intronic
1027961376 7:84950282-84950304 ATATGAAAAGGAGGGGAGAAAGG + Intergenic
1028694997 7:93698947-93698969 ATAAGAAATAGAAAGGAGAGGGG - Intronic
1028958657 7:96723446-96723468 AAAAGAAAGGGAAGAGAGCATGG + Intergenic
1029431811 7:100536080-100536102 AAAAGAAAAGGAAAGGAAAAGGG - Intergenic
1029434123 7:100552517-100552539 AGAGGAAAGGTAAGGGAGAATGG - Intronic
1029547217 7:101216877-101216899 TTAAGAATGGGAAGGAAGAAAGG - Intronic
1029869323 7:103673400-103673422 ACAGGAAAGGGAACAGAAAAAGG - Intronic
1030379352 7:108794874-108794896 AGAAGAAAGGGGTTGGAGAATGG - Intergenic
1030625270 7:111838722-111838744 AAAAGAGAGGGAACCGAGAGGGG + Intronic
1030633969 7:111926913-111926935 AAAAGAAAAAGAACGGAGGAAGG + Intronic
1030936114 7:115586101-115586123 ATCAGGAAGGGACCAGAGAAAGG + Intergenic
1031018961 7:116605983-116606005 AGAAGAAAGGGATAGAAGAAAGG + Intergenic
1031866027 7:127039740-127039762 ACAAGAGAGGGGAAGGAGAAGGG + Intronic
1032072555 7:128817645-128817667 AAAACAAAGGGAAAAGAGAAAGG - Intronic
1033457565 7:141516528-141516550 AGAAGAAAGGGAGCAGAGAGTGG - Intergenic
1033636677 7:143218401-143218423 ACAAGAAGGAGAAAGGAGAAGGG - Intergenic
1033926907 7:146473395-146473417 AGAAGAAAGGAAAAGAAGAAGGG - Intronic
1034621494 7:152460753-152460775 ATATGATAGGGAGCGGGGAAAGG + Intergenic
1034855101 7:154537738-154537760 AAAAGAAAAGGAAAGGAGAGAGG + Intronic
1034944921 7:155255653-155255675 AGAAGAAGGGGAAAGGGGAAGGG + Intergenic
1035835887 8:2751241-2751263 AAAAGAAAGGGAAGGAAGGAAGG + Intergenic
1035895107 8:3391125-3391147 ATCAGAAAAGGAAAGGAGAGTGG - Intronic
1036756529 8:11474938-11474960 AAAAGGAAGGGAAGAGAGAAAGG + Intergenic
1037009045 8:13818420-13818442 AAAAGGAAGGGAAGGGAGAAGGG + Intergenic
1037678587 8:21073805-21073827 ATAAGAGAAGGAACAGACAACGG - Intergenic
1038316291 8:26487229-26487251 ATTAGAAAGGGAATTGAGTATGG + Intronic
1038492917 8:27982853-27982875 TGAAGAAAGGGAAGGGATAAAGG + Intronic
1039047844 8:33466450-33466472 AAAGGAAAGAGAAAGGAGAAGGG + Intronic
1039121563 8:34153412-34153434 AGAAGAAATGGAAAGAAGAAAGG + Intergenic
1039345158 8:36695419-36695441 AAAAGAAAGAGTAAGGAGAAAGG + Intergenic
1039464688 8:37776165-37776187 AAAAGAAAGGGCATGGGGAATGG - Intronic
1039758315 8:40546713-40546735 CACAGAAAGGGAAGGGAGAAAGG + Intronic
1040053823 8:43040699-43040721 AAAAGAAAGGGAAGGAAGGAAGG - Intronic
1040674331 8:49730876-49730898 ATGAGAAAGGCAAAGGAGAAAGG - Intergenic
1040800363 8:51332526-51332548 ATCAGAGAGGGACCAGAGAAAGG + Intronic
1041699090 8:60767739-60767761 AGAAGAAAGAGAAAGCAGAAAGG - Intronic
1041879623 8:62734549-62734571 ATAAGAAAGGGAATTCTGAATGG - Intronic
1041916105 8:63140591-63140613 AAAAGAAAGAGAAGGGAGAGAGG - Intergenic
1042469773 8:69172813-69172835 ATAAGAAAGAAAAGGGAAAAAGG - Intergenic
1043318737 8:78954515-78954537 ATCAGAAAAGGATGGGAGAAAGG - Intergenic
1043473279 8:80581961-80581983 ATGACAAAGGGAACGGAGAGAGG + Intergenic
1043628729 8:82299034-82299056 CTAAGAAAGGGGATAGAGAAAGG - Intergenic
1043923939 8:86015708-86015730 AGAAGAAAGGGAACAGTGAGAGG - Intronic
1044413695 8:91912486-91912508 AGAAGAAAGGAGACAGAGAAAGG - Intergenic
1045080715 8:98623201-98623223 AAAATAAAGGGAAGGAAGAAAGG + Intronic
1045574848 8:103409529-103409551 ATTAGAAAGGGAACTGATATGGG + Intronic
1045614051 8:103885556-103885578 ATACGAAAGGCAAAGGAGAGAGG + Exonic
1045779944 8:105850520-105850542 ATCAGGGAGGGAACAGAGAAAGG + Intergenic
1046093930 8:109535966-109535988 AAAACAAAGGGAACAAAGAAGGG + Intergenic
1046631660 8:116627868-116627890 AAAAGAAAAGGAAGGGAAAAAGG - Intergenic
1046862905 8:119114670-119114692 ATAAGGAGGGGTAGGGAGAAAGG + Intergenic
1046930418 8:119836410-119836432 ATAAGAAGGAGAAAGGAGAAGGG + Intronic
1047133492 8:122049913-122049935 ATAACAAAGTAAACTGAGAAAGG - Intergenic
1047153976 8:122296353-122296375 TAAAGAAAGGGAAGGGAAAAAGG + Intergenic
1048189023 8:132271553-132271575 ATAATAAAAGGAAGGGTGAAGGG - Intronic
1048344581 8:133567158-133567180 AGCAAAATGGGAACGGAGAAGGG - Intronic
1048376256 8:133825161-133825183 ATTAGAAAGGGAATGTAAAATGG + Intergenic
1048656313 8:136541094-136541116 ACAAGAAAGAGAAGAGAGAAGGG - Intergenic
1049181403 8:141224770-141224792 AGAAGAAAGGAAATAGAGAATGG - Intronic
1049837968 8:144751317-144751339 ATAAAAAAGGAAAAGGAAAAAGG - Intronic
1050147498 9:2584374-2584396 ATCAGGAAGGGACCAGAGAAAGG + Intergenic
1050502811 9:6316023-6316045 ATCAGGGAGGGAACAGAGAAAGG + Intergenic
1051233649 9:14977552-14977574 GAAAGAAAGGGAAGGAAGAAAGG + Intergenic
1051487335 9:17623075-17623097 ATAGGAAAGGGGAAGGGGAAGGG - Intronic
1051520223 9:17979256-17979278 AAAAGAAAGAGAAAGGAGCAGGG - Intergenic
1052196489 9:25722167-25722189 ATAAAAAAGGGAAGAAAGAAAGG + Intergenic
1052251131 9:26398339-26398361 ATCAGCAAGGGAAAGGGGAATGG - Intergenic
1052344503 9:27395715-27395737 CTAAGAAAGGCAACACAGAACGG + Intronic
1052464682 9:28815385-28815407 AAAAGAAAGGCAAAGGAGATGGG + Intergenic
1052726686 9:32236565-32236587 AAAAGAAAAGGAAGGAAGAAAGG + Intergenic
1053408808 9:37901707-37901729 TTAAGAAAGGGAGAGGAGAGAGG - Intronic
1053553230 9:39106205-39106227 ATAAGGAAAGGAAAAGAGAAAGG + Intronic
1055172377 9:73274790-73274812 AGAAGAAAGGAGAGGGAGAACGG + Intergenic
1055442603 9:76351563-76351585 AGAAGGAAGGGAAGGGAGGAAGG + Intronic
1055670921 9:78605488-78605510 AAAATAAAGGGAAAGAAGAAAGG - Intergenic
1055780695 9:79818344-79818366 ATAGGAAAAAGAACAGAGAAGGG + Intergenic
1056072802 9:83006583-83006605 AAAAGAAAGGGGAAGGAGAGGGG + Intronic
1056159664 9:83875922-83875944 GTAAGAAAGGGATGGGAAAAAGG + Intronic
1056350912 9:85748006-85748028 GTAAGAAAGGGATGGGAAAAAGG - Intergenic
1057090292 9:92252002-92252024 ATGAGACAGAGAAAGGAGAAAGG + Intronic
1057091228 9:92259835-92259857 ACAAGACAGGGAACCTAGAAAGG + Intronic
1057485550 9:95480310-95480332 ATAATAAAGTGAACGATGAATGG + Intronic
1058004822 9:99903597-99903619 ATAAGAAAGGAAAGGAAAAAAGG + Intergenic
1058711544 9:107683539-107683561 AAAACAAAGGGTAAGGAGAAAGG + Intergenic
1058717043 9:107731855-107731877 ATGAGACAGAGAACGAAGAAGGG - Intergenic
1058719627 9:107751841-107751863 AAAAGAAAAGGAAAGGAAAAGGG + Intergenic
1059064687 9:111070582-111070604 AAGAAAAAGGGAAGGGAGAAAGG + Intergenic
1059210470 9:112510119-112510141 ATAAGTAAGGTAAGGGAGAAAGG + Intronic
1059542509 9:115144336-115144358 AAAGGGAAGGGAAAGGAGAAGGG - Intronic
1059803483 9:117773969-117773991 AAAGGAAAGGGAAAGGAGAGAGG - Intergenic
1061246052 9:129401754-129401776 ATAAGGAGGGGGAGGGAGAAGGG - Intergenic
1062304176 9:135893381-135893403 AGAAGGAAAGGAAAGGAGAAAGG + Intronic
1203431383 Un_GL000195v1:93888-93910 TTAAGATAGGGAAGTGAGAAAGG - Intergenic
1185780430 X:2839606-2839628 ACAAGCTAGGGAAGGGAGAAAGG + Intronic
1186033381 X:5393737-5393759 ATAAGAAAAGGAATGGACCATGG + Intergenic
1186039935 X:5464519-5464541 AGAAGAAAGGGAATGGAGAGAGG + Intergenic
1186588103 X:10898151-10898173 AGGGGAAAGGGAAGGGAGAAGGG + Intergenic
1186591451 X:10934236-10934258 ACAAGAAAGGAAGAGGAGAAGGG - Intergenic
1187278286 X:17835704-17835726 ATAAGAAAGGGAACAGAGGAAGG - Intronic
1187323012 X:18257953-18257975 AGAGGAAAGGGAAGGGGGAAGGG + Intronic
1187355292 X:18564262-18564284 TCAAGGAAGGGAAAGGAGAAAGG - Intronic
1187675688 X:21714127-21714149 AAAAGAAAGGGAGAGGAAAAGGG + Intronic
1187748493 X:22434305-22434327 ATCAGGGAGGGAACAGAGAAAGG + Intergenic
1188001035 X:24982055-24982077 AAAAAAAAGGGACCTGAGAAGGG - Intronic
1188037908 X:25338944-25338966 ATAAGCCAAGGAACAGAGAAGGG + Intergenic
1188389458 X:29601756-29601778 ATAAGAAAGAGGATGGTGAAGGG + Intronic
1188453443 X:30334744-30334766 GTGAGAAAGTGAAGGGAGAAGGG + Intergenic
1188775058 X:34206644-34206666 AAAAGAAGGGGAACACAGAATGG - Intergenic
1189463631 X:41262134-41262156 GTAAGGAAAGGAAAGGAGAAAGG - Intergenic
1189678801 X:43492231-43492253 ACAAGAAAAGCAATGGAGAAAGG + Intergenic
1190155001 X:47983199-47983221 AGAAAAGAGGGAACTGAGAAAGG + Intronic
1190203146 X:48381337-48381359 AAAAGGAAGGGAAGGGAGAACGG - Intergenic
1190203207 X:48381526-48381548 AAAAGGAAGGGAAGGGAGAAGGG - Intergenic
1190207329 X:48413878-48413900 AAAAGGAAGGGAAGGGAGAAGGG + Intergenic
1190207392 X:48414072-48414094 AAAAGGAAGGGAAGGGAGAACGG + Intergenic
1190373471 X:49765329-49765351 ATAAAAAAGGGAAGGGAGAAGGG + Intergenic
1190682666 X:52841554-52841576 ATTAAAAAGGGAAGGGAGGAAGG + Intergenic
1191103409 X:56757712-56757734 AGGAGAAAGGGAGCGGGGAAGGG + Intergenic
1191680333 X:63833827-63833849 AAAAGGAAGGGAAGGGAGAGAGG - Intergenic
1192672384 X:73159220-73159242 AGCAGAAAGGGAAAGAAGAAAGG + Intergenic
1193077125 X:77365717-77365739 ATCAGGGAGGGAACAGAGAAAGG + Intergenic
1193420928 X:81280869-81280891 ATCAGGGAGGGAACAGAGAAAGG + Intronic
1193643767 X:84043282-84043304 ATAAGGGAGGGACCAGAGAAAGG - Intergenic
1193703985 X:84798064-84798086 GTAACAAAGGGAAAGGAGAGGGG - Intergenic
1193799022 X:85913388-85913410 AAAGGAAAAGGAAAGGAGAAAGG + Intronic
1194117904 X:89925575-89925597 ATAAGTAAGGCAAAGCAGAAAGG - Intergenic
1194844135 X:98782544-98782566 AATAGAAAGGGAGAGGAGAAAGG + Intergenic
1194921473 X:99771435-99771457 GAAAGGAAGGGAAGGGAGAAGGG + Intergenic
1194956270 X:100184531-100184553 ATAAGCAAGGCAAAGGTGAATGG - Intergenic
1196301344 X:114052538-114052560 AAAAAAAAGGGAAAGGAAAAAGG + Intergenic
1196514654 X:116555643-116555665 AGAAGAAAGTCAAAGGAGAAGGG - Intergenic
1196558099 X:117115221-117115243 AGAAGAAAGGGAAGGAAGGAAGG + Intergenic
1197066119 X:122236542-122236564 ATAAGAGAGGCACCAGAGAAAGG - Intergenic
1197243544 X:124145475-124145497 AGCAGAAAGGAAAAGGAGAAAGG + Intronic
1197894998 X:131303158-131303180 AAAAGAGAGGGAGGGGAGAAGGG + Intronic
1198110949 X:133502241-133502263 ATAAAAAAGGAAAAGGGGAAAGG - Intergenic
1198613496 X:138428371-138428393 ATAGGAAAGGGGATGGAGTAAGG - Intergenic
1198733003 X:139753811-139753833 AAAAGAAAGGGAAAGGGAAAGGG + Intronic
1199208093 X:145173278-145173300 AAAAGAAAGGGAAGGAAGGAAGG + Intergenic
1199795245 X:151189414-151189436 ATTAGAAAGAAAAGGGAGAAAGG + Intergenic
1200470680 Y:3582707-3582729 ATAAGTAAGGCAAAGCAGAAAGG - Intergenic
1200692079 Y:6316457-6316479 ATAAGAAAGAGGAAGGAAAATGG + Intergenic
1200713635 Y:6512482-6512504 ATAAGAAAGAGGAAGGAAAATGG - Intergenic
1200735200 Y:6786681-6786703 AGCAGAAAGGAAAAGGAGAAAGG + Intergenic
1201020292 Y:9649559-9649581 ATAAGAAAGAGGAAGGAAAATGG + Intergenic
1201043193 Y:9858270-9858292 ATAAGAAAGAGGAAGGAAAATGG - Intergenic
1201062924 Y:10064297-10064319 GTAAGAAAGGGAAGGAATAAAGG + Intergenic
1201253875 Y:12088262-12088284 AAAAGGAAAGGAAAGGAGAAAGG - Intergenic
1201254741 Y:12096258-12096280 ATAAGAAAAGGAAATGACAAAGG - Intergenic
1201289626 Y:12410371-12410393 ACAAGCTAGGGAAGGGAGAAAGG - Intergenic
1201296125 Y:12464661-12464683 ATAAGAAAGAGAACATGGAAAGG + Intergenic
1201517735 Y:14835810-14835832 ATAAAAGAGGGAAGGGAGTAGGG + Intronic
1201568233 Y:15388457-15388479 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic