ID: 1006166978

View in Genome Browser
Species Human (GRCh38)
Location 6:32070894-32070916
Sequence AATAAGAAAGGGAACGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 0, 2: 4, 3: 80, 4: 704}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006166978_1006166987 6 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166987 6:32070923-32070945 CGGCTGGCCCGGGAGAACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1006166978_1006166993 28 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166993 6:32070945-32070967 GCTCCCACTGGGCCTGGTGAAGG 0: 1
1: 0
2: 0
3: 28
4: 272
1006166978_1006166990 16 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data
1006166978_1006166984 -5 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166984 6:32070912-32070934 TTATTCTGCACCGGCTGGCCCGG No data
1006166978_1006166992 22 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166992 6:32070939-32070961 ACTAAGGCTCCCACTGGGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 170
1006166978_1006166983 -10 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166983 6:32070907-32070929 CTTTCTTATTCTGCACCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1006166978_1006166991 17 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166991 6:32070934-32070956 GGAGAACTAAGGCTCCCACTGGG No data
1006166978_1006166985 -4 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166985 6:32070913-32070935 TATTCTGCACCGGCTGGCCCGGG 0: 1
1: 0
2: 3
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006166978 Original CRISPR AATAAGAAAGGGAACGGAGA AGG (reversed) Intronic
900554882 1:3275443-3275465 AAGATGAAAGGGCAAGGAGAAGG + Intronic
901276437 1:7995034-7995056 AAAAAGAAAAGGAAAGGAAAGGG - Intergenic
901839586 1:11945450-11945472 AACAAGAAAGGGGACACAGAGGG + Intronic
903033966 1:20482477-20482499 AAGAAAAGAGGGAACGGGGAAGG + Exonic
903639729 1:24849970-24849992 ACGAAGGAAGGGAATGGAGAGGG - Intergenic
904375381 1:30078267-30078289 AGTCAGAAAGGGAACAGAGCTGG + Intergenic
905044015 1:34982445-34982467 AAAAAAAAAAGGAAAGGAGAAGG - Intronic
905891007 1:41518365-41518387 AAGGGGAAAGGGGACGGAGAAGG + Intronic
906698644 1:47841763-47841785 AAAAAGAAAAGAAAAGGAGAAGG - Intronic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
907083762 1:51649547-51649569 AAAAAGAAAGGGAAGGTAGTGGG - Intronic
907770500 1:57457787-57457809 AGTAAGAAAGAGAAAGAAGATGG + Intronic
907977020 1:59441466-59441488 AATACTACAGGGAACTGAGATGG - Intronic
908101595 1:60796706-60796728 CATAAGAAAGGGAGTGGAGAAGG - Intergenic
908289990 1:62656013-62656035 AATAAGATAGGTAAGGTAGAAGG - Intronic
908930760 1:69313949-69313971 CAGAAGAAAGAGAAAGGAGAAGG + Intergenic
909377773 1:74959895-74959917 AAAAAGAAATGGAAAGGAGGTGG + Intergenic
909555060 1:76944455-76944477 ATTAAAAAAGGGAATAGAGAGGG - Intronic
909742181 1:79043812-79043834 AAAAAGAAAGGGAAATGAGGAGG - Intergenic
909887116 1:80956214-80956236 AACAAGAAAAAGAACAGAGACGG + Intergenic
909967121 1:81928033-81928055 AATAATCAAGTGAATGGAGAGGG - Intronic
910008093 1:82424906-82424928 AATAAAAAATGGAACTGAAAAGG - Intergenic
910670868 1:89771487-89771509 AACAAGAAAGGGGTTGGAGAGGG + Intronic
911386347 1:97179917-97179939 AAGAAGAAAAGGAAAGGAGATGG + Intronic
911554197 1:99323218-99323240 AATAGGAAAGGAACTGGAGATGG + Intergenic
911720293 1:101183212-101183234 AAGAAGGGAGGGAAGGGAGAGGG + Intergenic
912548708 1:110470134-110470156 AAGAAGGAAGGGAAGGGAGGAGG - Intergenic
912710805 1:111948508-111948530 AAGAAGAAAGAGAAAGTAGAAGG - Intronic
912757863 1:112339619-112339641 AAGGGGAAAGGGAACGCAGAGGG + Intergenic
913598631 1:120402562-120402584 AAAAAGAAAGAGAAAGGAAAAGG - Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914088750 1:144477056-144477078 AAAAAGAAAGAGAAAGGAAAAGG + Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914309862 1:146457147-146457169 AAAAAGAAAGAGAAAGGAAAAGG - Intergenic
914592247 1:149115986-149116008 AAAAAGAAAGAGAAAGGAAAAGG + Intergenic
914936833 1:151989060-151989082 ATTAAGAAAGGGAATGCAGCAGG + Intronic
915442643 1:155955118-155955140 AAAAAGAAAGAAAAGGGAGAAGG - Intronic
915570821 1:156744260-156744282 GATAAGAAGGGGAATGCAGAGGG - Exonic
915816827 1:158976414-158976436 AATAAGATAGAGAAAGGAGCTGG - Intronic
916028806 1:160858828-160858850 AGAAAGAATGGGAACAGAGAGGG + Intronic
916323416 1:163531368-163531390 ATTAAGAAAGGGAAGAGAGATGG - Intergenic
916790831 1:168123683-168123705 CAGGAGAAAGGGAAAGGAGAAGG - Intronic
916950105 1:169771156-169771178 AATAAGAAACGTAAGGGAAAAGG + Intronic
917074421 1:171189152-171189174 AACAATAAAGGAAACAGAGAAGG - Intronic
917542428 1:175927182-175927204 AAAAAGAAAAGGAAGGGAGCTGG + Intergenic
917790090 1:178493843-178493865 AAAAAGAAAGGGAGCCAAGAGGG - Intergenic
918049929 1:180964998-180965020 ATTTAGAATGGGAAAGGAGATGG - Intergenic
918101673 1:181381806-181381828 AATAAGAAAGGAATAGGAGCTGG + Intergenic
919277271 1:195437141-195437163 GATAAGAATGGGAAGCGAGATGG + Intergenic
919434189 1:197536062-197536084 AAGAAGAAAAGGGACAGAGAGGG + Intronic
920330396 1:205203476-205203498 AATAAGAAAAGGAGAGGGGAGGG + Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920600161 1:207316995-207317017 ACAGAGAAAGGGAAAGGAGAAGG - Intergenic
920769076 1:208863501-208863523 GATAAGAAGGGAAACTGAGAAGG + Intergenic
920965133 1:210694983-210695005 AATGAGAAAGGGAAGGGGGATGG + Intronic
921475440 1:215601501-215601523 TATGAGAAAGGGAAAAGAGAGGG + Intronic
921714707 1:218406139-218406161 AATTAGAAAGGAAAAGGAAACGG - Intronic
921756667 1:218864683-218864705 AGGAAGAAAGGGAAGGGGGAAGG - Intergenic
923235758 1:232031350-232031372 AAAAGGAAAGGGAAGGGAGAGGG + Intronic
923272321 1:232368907-232368929 AAGAGGAAGGGGAAAGGAGAGGG - Intergenic
924148688 1:241104488-241104510 ATTTAGAAAGGGAAATGAGATGG + Intronic
924157399 1:241193145-241193167 TGTAAGAAAGGGAAGGAAGAAGG - Intronic
924263590 1:242256884-242256906 AAAAAGAAAGAGAAAGAAGAGGG - Intronic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1063089401 10:2848821-2848843 AATCAGAGATGGAAGGGAGAGGG + Intergenic
1063877641 10:10496839-10496861 AATAATGAAGGGAAGGAAGATGG + Intergenic
1063936509 10:11083845-11083867 GATCAGAAAGTGTACGGAGAGGG + Intronic
1064843456 10:19623715-19623737 AATAAAAAGGTGAAGGGAGAGGG - Intronic
1065857060 10:29839247-29839269 AACGAGAAAGGTAACTGAGAAGG + Intergenic
1066046263 10:31598150-31598172 AAAAGGAAAGGCAAAGGAGATGG + Intergenic
1066512953 10:36122354-36122376 AAAAAAAAAGGGTAGGGAGAAGG - Intergenic
1066721205 10:38341614-38341636 AAAAAGAAAGAGAAAGAAGAGGG + Intergenic
1067280381 10:44866397-44866419 AAGAAGAAAGGAAAGGGAAAGGG + Intergenic
1067280388 10:44866484-44866506 AAGAAGAAAGGAAAGGGAAAGGG + Intergenic
1067721703 10:48732260-48732282 TATCAGAAAGTCAACGGAGATGG - Intronic
1068225944 10:54107512-54107534 AATGAGAAAGGCATCTGAGAGGG + Intronic
1068594080 10:58883608-58883630 AAGAAGAAAGAGAAGGGAGAAGG + Intergenic
1068716081 10:60190185-60190207 GAGAAGAAAGGGTAAGGAGAAGG + Intronic
1068836820 10:61564460-61564482 AAAAAGAAGGGGGACGGAGGGGG + Intergenic
1069316986 10:67117370-67117392 AACAGGAAAGGGAAAGGAGATGG - Intronic
1069888888 10:71640770-71640792 AAAAAGAAAGGAAACGGTGCTGG + Intronic
1070127847 10:73636165-73636187 AGGAAGAAAGGAAATGGAGAAGG + Intronic
1070355948 10:75640408-75640430 AATCACAAAGGGAGGGGAGAAGG - Intronic
1070456761 10:76624765-76624787 GAGAAGAAAGGGGACGGAAAGGG - Intergenic
1070494820 10:77011889-77011911 AATAAGAAAAGGGAAGGAAAAGG + Intronic
1070494831 10:77011927-77011949 AATGAGAAAGGGAGGGGACAGGG + Intronic
1070723511 10:78772746-78772768 ATTACGAGAGGGAAGGGAGAAGG + Intergenic
1070848224 10:79541274-79541296 AATATGGAAGGGAATGGAGAAGG + Intergenic
1070925554 10:80218895-80218917 AATATGGAAGGGAATGGAGAAGG - Intergenic
1071763892 10:88639963-88639985 CATAAGAAAGAGAAAGGAGAAGG + Intergenic
1072536486 10:96368230-96368252 AAGGAGAAAGGGAAACGAGAAGG + Intronic
1072571518 10:96661854-96661876 GAAAGGAAAGGGAAAGGAGAGGG + Intronic
1072572191 10:96668510-96668532 AAAAAGAAAGTGAGCAGAGAAGG + Intronic
1072800633 10:98390224-98390246 AAAAAGAAAGGCTACGGAGCAGG + Intronic
1072990376 10:100186740-100186762 AATAAAAAAGGGAAGGAAAAAGG + Exonic
1073222744 10:101889777-101889799 GATGAGAAAGGGAACCCAGAGGG + Intronic
1073387940 10:103143027-103143049 AAGAGGAAAGGGAACGGAAAGGG + Intronic
1073764314 10:106665357-106665379 AAAAAAAAAGGGAAGGAAGAAGG - Intronic
1074561901 10:114542608-114542630 AAAAAGAAAGAGAAAGAAGAAGG + Intronic
1075087473 10:119423139-119423161 AAGAAGGAAGGGAAGGGAGGTGG - Intronic
1077653304 11:3994446-3994468 AAAAAGAAAGAAAAAGGAGAAGG - Intronic
1078578755 11:12522957-12522979 AATGAGAGAGGGAATGTAGAAGG + Intronic
1079118127 11:17653622-17653644 AATAAGAGAGGGAAGGGTTAAGG + Intergenic
1079811228 11:25001922-25001944 CATCAAAAAGGGAAAGGAGAAGG - Intronic
1079826430 11:25201086-25201108 AAGAAGAAAAGGAAAGGAAAGGG + Intergenic
1079962916 11:26946004-26946026 AATAAGAAAGGACACTGTGAAGG - Intergenic
1080156752 11:29120181-29120203 AATAAATAACGGAACTGAGAAGG - Intergenic
1080998918 11:37643072-37643094 AATATAAAAGGGAACTGATAAGG - Intergenic
1081164416 11:39789844-39789866 AAGAAAAAAGGCAAGGGAGATGG + Intergenic
1081684065 11:45029162-45029184 AATAAGCAAGGCAGCTGAGAGGG - Intergenic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1083178926 11:60971968-60971990 AACCAGAAAGGGGACTGAGAGGG - Intronic
1083529566 11:63407333-63407355 AATAAGTAAGGGAACCCAGGTGG + Intronic
1084501778 11:69539446-69539468 AAGAGGGAAGGGAAGGGAGAGGG + Intergenic
1085009531 11:73128559-73128581 AAAAAGGAAGGAAACAGAGATGG + Intronic
1085069037 11:73525092-73525114 AAAAAGAGAGGGAATGGAGAGGG - Intronic
1086064147 11:82729350-82729372 AATAAGAAAGGCCAAGGGGAGGG - Intergenic
1086126097 11:83350180-83350202 AATATGAAAGGGAGGGGAGAGGG - Intergenic
1086137482 11:83456569-83456591 AAAGAGAAAGGGAATAGAGAAGG + Intronic
1086234835 11:84616966-84616988 AAAAAGAAAGGGAAGAGAGGAGG - Intronic
1086554770 11:88096173-88096195 AATAAGAAAGGTATTGGGGAGGG - Intergenic
1087052009 11:93895929-93895951 ACCAAGAAAGGGAATGGAGGAGG - Intergenic
1087209839 11:95436054-95436076 AAGAAGAAAGGAAACAGTGAGGG + Intergenic
1087665267 11:101038175-101038197 AAGAAGAAAGGGAGAGGAGGAGG - Exonic
1088072104 11:105799804-105799826 ATTAAGAAAGGGAATGGACTAGG + Intronic
1088376954 11:109151737-109151759 AATAAGGAGGGGAGGGGAGAGGG - Intergenic
1088391921 11:109323902-109323924 AGAAAGGAAGGGAAGGGAGAAGG - Intergenic
1088547608 11:110975862-110975884 AAAAAAAAAGGGAATGGGGAAGG + Intergenic
1089274031 11:117321479-117321501 AATAAAATAGAGAAAGGAGATGG + Intronic
1089589807 11:119533091-119533113 AAGGAGGAAGGGACCGGAGAAGG - Intergenic
1089999031 11:122937760-122937782 ACTAAGAAAGAGAACGGGGATGG - Intronic
1090225282 11:125067808-125067830 AATAAGAAAGGGAACAGGGAAGG - Intronic
1090824485 11:130374650-130374672 AAAAAGAAACGGAAGGGAGAGGG + Intergenic
1091162037 11:133432619-133432641 AAGAAGAAAGGGAAAAGACATGG - Intronic
1091636523 12:2201219-2201241 AATAAAGAAGGGCACAGAGAAGG + Intronic
1092061316 12:5553191-5553213 AGAAAGAAAGGGAAAGGAAAGGG + Intronic
1092505089 12:9090494-9090516 CATAAGAAAGGGAGTAGAGAGGG + Intronic
1092844865 12:12574785-12574807 GAAAAGAAAGGGAAAGGGGAAGG - Intergenic
1092967226 12:13656032-13656054 GAGAAGCAAGAGAACGGAGAGGG - Intronic
1093559612 12:20522499-20522521 AATAAAACAGGGAAAGAAGATGG + Intronic
1093698037 12:22184812-22184834 AAAAAGAAATGGAAAGGAAAAGG + Intronic
1093905469 12:24686529-24686551 AATATGAAAGAGAACTGAAAGGG + Intergenic
1094094495 12:26688511-26688533 AAAAAGAAAGGGGAGGAAGAAGG + Intronic
1094343527 12:29440372-29440394 AATAAAGAAGGGGACAGAGAAGG - Intronic
1094524928 12:31225261-31225283 AGGAAGAAAGGGAGCTGAGAAGG + Intergenic
1094582005 12:31741969-31741991 AAAAAGAAGAGGAAGGGAGAAGG + Intergenic
1095448424 12:42304570-42304592 TATAAGAAAAAGAAAGGAGATGG + Intronic
1095487376 12:42699184-42699206 AATAATATAAGGAAGGGAGATGG - Intergenic
1095900597 12:47324330-47324352 ACTAAGAAAAGGAAGGCAGAGGG - Intergenic
1096248917 12:50014397-50014419 AATAATAAAGAGAATTGAGATGG - Intronic
1096813386 12:54185888-54185910 AAGAAGAAAGGGAAGAGAGAAGG + Intronic
1099118751 12:78661481-78661503 AATAAGCTTGGGAACTGAGAGGG + Intergenic
1099533910 12:83822614-83822636 AAAAAAAAAGTGAATGGAGAAGG - Intergenic
1099727318 12:86448443-86448465 ATTAAGATAGGGTAAGGAGAAGG - Intronic
1100167868 12:91938697-91938719 AATTGGAGAGGGAAGGGAGATGG - Intergenic
1100479703 12:94966081-94966103 AAAAAGGAAAGGAAAGGAGAGGG + Intronic
1101546896 12:105722349-105722371 AAAACGAAAGGGAACGGAAAAGG - Intergenic
1101549852 12:105751562-105751584 AACAAGAAAGGGACCAGTGAGGG + Intergenic
1102367536 12:112351941-112351963 AATAGGAAAGTGAAGGGAAATGG - Intronic
1102390697 12:112546561-112546583 AAAAGAAAAGGGAACTGAGAAGG - Intergenic
1102520874 12:113476910-113476932 GAAAAGAAAGGGAAGGGGGAGGG - Intergenic
1102790426 12:115639769-115639791 AATTAGGAAGGAAATGGAGAGGG - Intergenic
1102902164 12:116647183-116647205 AAAAAGGAAGGGAAGGGGGAAGG - Intergenic
1102964009 12:117112397-117112419 AAAAAGGAAGGGAAACGAGAGGG - Intergenic
1103040336 12:117689984-117690006 AAGAAGAAAAGGAAGGAAGATGG + Intronic
1103304224 12:119951703-119951725 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304276 12:119951843-119951865 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304299 12:119951907-119951929 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304322 12:119951971-119951993 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103633491 12:122282868-122282890 AGTAGGAAAGGGAAAAGAGAGGG + Intronic
1105982980 13:25537750-25537772 AATAAAAAAGGAAAGGGAAAGGG - Intronic
1106023755 13:25938835-25938857 AAAAAAAAAAGGAAAGGAGAAGG - Intronic
1106144804 13:27041048-27041070 AGTCACAAAGGGAACAGAGAAGG - Intergenic
1106812005 13:33368030-33368052 AATAAGAAAGAGAAAGAGGAAGG - Intergenic
1107513696 13:41108696-41108718 AAAAAGAAAGAAAAAGGAGATGG - Intergenic
1108231559 13:48349229-48349251 AAAAAGAAAGGGAGGGAAGATGG - Intronic
1108240197 13:48456675-48456697 AGTCAGACATGGAACGGAGAGGG + Intronic
1108252131 13:48577919-48577941 AAGGAGGAAGGGAAGGGAGAAGG - Intergenic
1108267587 13:48728219-48728241 AATAAGAAATGGACCTCAGAAGG + Intergenic
1108480723 13:50867509-50867531 AAAAGGAAAGGGAAGGGAGAAGG - Intergenic
1108756933 13:53514416-53514438 AAAAACAAAAGGAAAGGAGAAGG - Intergenic
1109210228 13:59526829-59526851 AATAAAAATGGGAAAGAAGAGGG - Intergenic
1109322250 13:60825630-60825652 AAAAAAAAAGGCAACGGAGGAGG - Intergenic
1110241502 13:73272152-73272174 CATAAGAAAGGGAACAAAGGAGG - Intergenic
1110529033 13:76575096-76575118 AAGAAGAAAGGGAACAGAAAGGG - Intergenic
1111018600 13:82415351-82415373 AATAAGAAAGTAAAAGGAAAGGG + Intergenic
1111057214 13:82967151-82967173 AAGAAGAAAGGGGAAGGAGAGGG + Intergenic
1111209912 13:85064258-85064280 AAAAAGAAAGGTAACTGAAAAGG + Intergenic
1111680820 13:91439116-91439138 AATATGAATTGGAACAGAGAAGG - Intronic
1112994936 13:105562338-105562360 AATCAGAAAAGGAAAGGTGATGG - Intergenic
1113292055 13:108918167-108918189 AATATGAAAAAGAAAGGAGAAGG - Intronic
1114142608 14:19932312-19932334 AAGAAAAAAGGAAAAGGAGAAGG - Intergenic
1114563485 14:23610394-23610416 AGTAAGACAGGGAAGGGAGGAGG - Intergenic
1114780904 14:25537063-25537085 AATAAGAAAGGGGAAGGTGGGGG - Intergenic
1114835232 14:26196218-26196240 AATAAGAATGGGAATTTAGAGGG - Intergenic
1116512416 14:45762913-45762935 AAAAAGAAAAGGAAGGAAGAAGG - Intergenic
1116553476 14:46272435-46272457 ATGAAGAAAGGGAAGGGAGACGG + Intergenic
1117522808 14:56567530-56567552 AATAAGAATGGGAATGCAAATGG - Intronic
1119585871 14:75834485-75834507 AATAAGAATGGGAAAGGGAAGGG - Intronic
1119872302 14:78028153-78028175 TCTAAGAAAAGGAAAGGAGAGGG - Intergenic
1119925645 14:78490959-78490981 AGAAAGCAAGGGAAAGGAGATGG - Intronic
1120490954 14:85177861-85177883 AATAATAAAGGGAAGGGAGTAGG + Intergenic
1120723539 14:87913478-87913500 AATAAGGAAGAAAAGGGAGAAGG - Intronic
1120804067 14:88726404-88726426 AATAAGAAGGGGAAGAGAAAAGG + Intronic
1120925134 14:89790089-89790111 AAGAAGAAAGGGAACAAGGAAGG + Intergenic
1121425830 14:93851296-93851318 AAAAACAAAGAGAACGTAGAAGG - Intergenic
1121593309 14:95137321-95137343 AAGAGGAAAGGGAAAGGGGAAGG + Intronic
1121916003 14:97837413-97837435 AGGAAGAAAGGGAGTGGAGAGGG + Intergenic
1122216968 14:100211228-100211250 AAAAAGAAAGGAAAGGGAGAAGG + Intergenic
1122439234 14:101718850-101718872 AAAAAGGAAAGGAAAGGAGAGGG + Intergenic
1122442067 14:101738873-101738895 AGAAAGAAAGGGAGAGGAGAGGG + Intergenic
1123165529 14:106322241-106322263 AATTATGAAGGGAAGGGAGAAGG - Intergenic
1123683060 15:22776206-22776228 AAGATGAAAGGGAAAGGAGGCGG + Intronic
1123763088 15:23447329-23447351 AAGATGAAAGGGAAAGGAGGCGG + Intergenic
1124334812 15:28848730-28848752 AAGATGAAAGGGAAAGGAGGCGG + Intergenic
1124386484 15:29212323-29212345 AATAAGAAATGAAACGGGGGAGG - Intronic
1124716153 15:32064249-32064271 AAGAAGAAGGGGAAGGGAAAGGG - Intronic
1125171384 15:36770011-36770033 AATAATCAAGGGAAAAGAGATGG - Intronic
1125255063 15:37753803-37753825 AATGGGAAAGGGAAAGAAGAAGG - Intergenic
1125644556 15:41261148-41261170 AAAAAGAAAAGGAAAGGAAAGGG - Intronic
1126861645 15:52890044-52890066 AATAAGAAAGAGTAAAGAGATGG - Intergenic
1127496718 15:59519610-59519632 AAAAAGAAAAGGAAGGAAGAAGG - Intronic
1127542583 15:59956020-59956042 AATAATAAAGAGATAGGAGATGG - Intergenic
1127966257 15:63924917-63924939 AAAAAGAGTGAGAACGGAGATGG - Intronic
1128393913 15:67203844-67203866 AAAAAGAAAGAGAACGAAGATGG + Intronic
1128660249 15:69495123-69495145 AATATGAAAGGGAACAAAAATGG - Intergenic
1129061467 15:72863789-72863811 AAGAGGAAAGGGCACGCAGAGGG + Intergenic
1129925352 15:79358933-79358955 ACTAAGAAAGGGAGTGGGGATGG + Intronic
1129966166 15:79737737-79737759 GAGAAGAGAGGGAAAGGAGAAGG - Intergenic
1130171781 15:81522702-81522724 AGGAAGAAGGGGAAAGGAGAAGG + Intergenic
1131111014 15:89765572-89765594 AAGAGGAAAGGGAAGGGAGGAGG + Intronic
1131433865 15:92407643-92407665 AAAAAGCAGGGGAATGGAGAGGG + Intronic
1131779301 15:95839171-95839193 GATAAAAAAGGGAACTCAGAAGG + Intergenic
1131955403 15:97729938-97729960 AATAAGGAAGGAAAAAGAGAAGG - Intergenic
1132039264 15:98511498-98511520 AAAAAGAAAGGAAAGGGAAAGGG - Intronic
1133783572 16:8958099-8958121 AACAAAAAAGGAAACTGAGATGG + Intronic
1133880770 16:9779554-9779576 AAGAAAAAGGGGAATGGAGAAGG + Intronic
1133886174 16:9829880-9829902 AAAAAGAAAGGAAACGAAAATGG + Intronic
1133900907 16:9973479-9973501 TACAAGAAAGAGAATGGAGAAGG + Intronic
1134105869 16:11485682-11485704 CATAAGAAAGGAAAAGCAGATGG - Intronic
1134318367 16:13140173-13140195 AAAAAGAAAGGGAAGGGAAGGGG - Intronic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134634671 16:15783313-15783335 AATAAGGAAGGGAAAGCAGGAGG - Intronic
1135232086 16:20718117-20718139 AAGAAGAAAAGAAAAGGAGAAGG + Intronic
1135624402 16:23982077-23982099 AAAAGGAAAGGGAAGGGAAAGGG - Intronic
1136357835 16:29757877-29757899 AATAAGAAATGGAATGGGGATGG - Intergenic
1136849764 16:33603321-33603343 AAAAAGAAAAGGAGAGGAGAGGG - Intergenic
1137953258 16:52803641-52803663 AAGAAGAAAGGGGAAGGGGAGGG + Intergenic
1138130960 16:54479539-54479561 AATAAGGAAGGGAGGGAAGATGG - Intergenic
1138908889 16:61372366-61372388 AATAAGAGAGGGTAAGGAGCAGG + Intergenic
1138963495 16:62055360-62055382 AAAAAGAAAGGGAAAGAAGCAGG - Intergenic
1139550850 16:67672264-67672286 AAAAAGAAAAGAAAAGGAGAGGG + Intergenic
1140039924 16:71399822-71399844 AATATGAAAGGGCACTGTGAAGG - Intergenic
1140040040 16:71401290-71401312 AATATGAAAGGGCACTGTGAAGG - Intergenic
1141029916 16:80578780-80578802 AAAAAGAAAAGGAAGGAAGAAGG - Intergenic
1141181283 16:81754497-81754519 AAAAGGAAATGGAAAGGAGATGG - Intronic
1141764329 16:86048579-86048601 GGAAAGAAAGGGAAGGGAGAGGG - Intergenic
1142362590 16:89634551-89634573 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362599 16:89634584-89634606 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362648 16:89634743-89634765 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362652 16:89634759-89634781 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362656 16:89634775-89634797 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362671 16:89634824-89634846 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362675 16:89634840-89634862 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362703 16:89634934-89634956 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362707 16:89634950-89634972 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362711 16:89634966-89634988 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362715 16:89634982-89635004 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362719 16:89634998-89635020 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362733 16:89635046-89635068 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362737 16:89635062-89635084 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362741 16:89635078-89635100 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362745 16:89635094-89635116 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362749 16:89635110-89635132 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142362753 16:89635126-89635148 GAGAAGGAAGGGAAAGGAGAAGG - Intronic
1142421737 16:89974872-89974894 ATGAAGAAAGGGAATGGAGGAGG + Intergenic
1203111354 16_KI270728v1_random:1451635-1451657 AAAAAGAAAAGGAGAGGAGAGGG - Intergenic
1142542502 17:671242-671264 AAGAAGAAAGGAAAAGGAAAAGG + Intronic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143556066 17:7661384-7661406 AATAAGCAACAGAATGGAGAGGG - Intergenic
1143991443 17:10966748-10966770 AGTCAGATAGGGAATGGAGATGG + Intergenic
1144168031 17:12631787-12631809 AAAAAGGAAGGAAAGGGAGAAGG + Intergenic
1145123810 17:20283877-20283899 AATAAGAAAGAGGACAGACATGG - Intronic
1145991092 17:29079928-29079950 GAGAAGAAAGAGAACGGAGACGG - Intronic
1147776490 17:42905529-42905551 AAGAAGAAAAGGAAAGGAGAAGG + Intronic
1148158110 17:45434979-45435001 AAAAAAAAAGGGAGGGGAGAAGG + Intergenic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148285759 17:46390166-46390188 TATAAGAAAAGGAAGAGAGATGG - Intergenic
1148290432 17:46443434-46443456 AAAAAGAAAGGTAACTGGGAAGG - Intergenic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148307922 17:46607787-46607809 TATAAGAAAAGGAAGAGAGATGG - Intronic
1148312600 17:46661007-46661029 AAAAAGAAAGGTAACTGGGAAGG - Intronic
1148728637 17:49816097-49816119 AATAAAAAAAGGAAGGGAGGAGG - Intronic
1149030063 17:52072526-52072548 AAAAAAAAAGGGAAGGGAGAAGG - Intronic
1149725057 17:58884886-58884908 AATAAGACAGAGAAAAGAGAGGG - Intronic
1150024530 17:61658938-61658960 CAGAAGATAGGGAAGGGAGAAGG - Intergenic
1150059282 17:62050366-62050388 AAAAAAAAAGGAAAAGGAGAGGG + Intronic
1150361073 17:64534563-64534585 GCTAAGAAAGGGAAAGGGGAGGG - Exonic
1151237084 17:72728440-72728462 AAAAAGAAAGGGAAAGGGAAAGG + Intronic
1152249225 17:79202977-79202999 AGTAAAATAGGGAAAGGAGAAGG - Intronic
1152258250 17:79252767-79252789 AAAAAGGAAGGGAAAGGAGAGGG - Intronic
1152359475 17:79824660-79824682 AATAAGAAAGGGATGAGACAGGG - Intergenic
1153100638 18:1465154-1465176 AAGAAGAAAGGAGAAGGAGAAGG - Intergenic
1153135028 18:1907063-1907085 AAGAAGAAAGGGAAAGAAGAAGG - Intergenic
1153849241 18:9077852-9077874 AAAAAAAAAGGCAAAGGAGAAGG + Intergenic
1153914919 18:9736481-9736503 AAAAAAAAAGGGAGGGGAGAGGG - Intronic
1154040785 18:10853568-10853590 AAAAAGAAAGGGGACAGAAATGG - Intronic
1154970371 18:21402488-21402510 AAAAGGAAAGGGAAAGGAAAGGG - Intronic
1155033011 18:22000913-22000935 AAAAAAAAAGGGAAAGGAAAGGG - Intergenic
1155048962 18:22130001-22130023 AGAAAGAAAGGGAAGGGAAAGGG - Intergenic
1155382850 18:25243558-25243580 AGTGAGAAAGGAAACGAAGAAGG - Intronic
1155389019 18:25313438-25313460 CATATGAAAGGGAAAGGGGAGGG + Intronic
1156883620 18:42109162-42109184 AAAAAGAAAAAGAATGGAGAAGG - Intergenic
1156920026 18:42510722-42510744 AAGAAGAAAGGGAAATGAAAGGG - Intergenic
1156991584 18:43415105-43415127 AATAAGAAAGCAAACTGAGGAGG - Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1158235895 18:55313558-55313580 AAAAAGAAAAGGAAAGGACAGGG + Intronic
1158749472 18:60242333-60242355 GATAAGAAATAGAACAGAGATGG + Intergenic
1159076043 18:63683083-63683105 AAGAAAAAAGGGAAGAGAGAAGG - Intronic
1159258683 18:65981400-65981422 GATGAGCAAGGGAACGGAAAAGG - Intergenic
1159571520 18:70119467-70119489 AAGGAGAAAGGGAAGGGAGAAGG + Intronic
1159631787 18:70757339-70757361 AAGAAGGAAGAGAAAGGAGAGGG + Intergenic
1159652875 18:70998660-70998682 AATAAGCAAGGGATCCCAGAAGG + Intergenic
1159964127 18:74579351-74579373 AAAAGGAAAGGGAAGGGAGGGGG - Intronic
1160614530 18:80114732-80114754 ATTCAGACAGGGAAGGGAGATGG + Intronic
1161427756 19:4213377-4213399 AAGAAGGAAGGGAAGGAAGAAGG - Intronic
1162254907 19:9482427-9482449 AATAAGGAAGGGAGGGGGGAAGG + Intronic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162535498 19:11261351-11261373 AAGAAGACAGGGAAGGGGGATGG - Intronic
1162594027 19:11613163-11613185 AAAAAGGAAAGGAAAGGAGAGGG - Intronic
1163071312 19:14844468-14844490 AAGAAGAGAGGGATGGGAGATGG + Intergenic
1163101376 19:15099133-15099155 GAAAAGAAAGGGAAGGGAAAGGG + Intergenic
1163336216 19:16673752-16673774 ATTAATAAATGGAACAGAGAAGG + Intronic
1163732529 19:18957927-18957949 AAAAAAAAAGGAAAAGGAGAAGG - Intergenic
1163969577 19:20779115-20779137 AAGATGAAAGGAAACTGAGAGGG + Intronic
1163999680 19:21085782-21085804 AAGATGAAAGGGGACTGAGAGGG + Intronic
1164292322 19:23879639-23879661 AAGAAGAAAAGGAAAGGAGAAGG + Intergenic
1164815971 19:31203774-31203796 AAGAAGAAAGGGAAGAGAAAAGG - Intergenic
1164853176 19:31501294-31501316 AATGAGAAGGGGACAGGAGAGGG - Intergenic
1166402693 19:42495408-42495430 GAGAGGAAAGGGAAGGGAGAGGG + Intergenic
1166647783 19:44544981-44545003 AATAAGAAAAGGATCTCAGAAGG + Intergenic
1167240842 19:48342212-48342234 AAGAAGGAAGGGAAGGGAAAGGG + Intronic
1167390898 19:49194246-49194268 AAGAAGAAAGGAGAAGGAGAAGG - Intronic
1168362226 19:55751412-55751434 AATAAGAAAAGGATCAGTGATGG - Intergenic
925721536 2:6833175-6833197 AAACAGAAAGGGAAGGGAAAGGG + Intergenic
926069916 2:9878864-9878886 AATAAGAAAAGGATCAGACAGGG + Intronic
927077017 2:19588912-19588934 TATAAGATAGGGAATGGGGAGGG - Intergenic
927302415 2:21530749-21530771 GAGAAGAAAGGGAAAAGAGAAGG - Intergenic
927732909 2:25491100-25491122 ATTAAGAAAGCAAACTGAGAAGG + Intronic
927866385 2:26590548-26590570 AGACAGAAAGGGAAAGGAGAAGG - Intronic
928062333 2:28127220-28127242 AAAAAGAAAGAAAACGGAAAGGG + Intronic
928182040 2:29075001-29075023 AATAAGATAGTGAATGAAGAAGG + Intergenic
929197669 2:39202817-39202839 AATGAGAAAGGCAAAGGAGGGGG - Intronic
930799098 2:55423915-55423937 GATAAGACAGGGAAGAGAGAAGG + Intergenic
930873197 2:56187064-56187086 AATAAAAAAGAGAAGGGAGAAGG - Intronic
931092831 2:58904655-58904677 AATAAAACAGGAAAGGGAGAAGG - Intergenic
931794778 2:65698933-65698955 AGCAAGCAAGGGAACAGAGAAGG + Intergenic
931799402 2:65743891-65743913 AATAACAGAGGGAAGGGAGGAGG - Intergenic
931947337 2:67324797-67324819 AAGAAGAAAAGGAAGGGGGAAGG + Intergenic
932262942 2:70342265-70342287 CATAGGCAAGGGAAAGGAGATGG + Intergenic
932601891 2:73133383-73133405 AAAAAAAAAGGGAAGGGAGAGGG + Intronic
932603278 2:73145070-73145092 AATAAGAAAGGGAGTTGGGAAGG - Intronic
932606362 2:73168435-73168457 AAGAAGAAAGGAAAAGGAAAAGG + Intergenic
932800609 2:74739407-74739429 AATAAGCAGGGGAAGGGTGAGGG + Intergenic
933060003 2:77725254-77725276 AAGATGGAAGGGAAGGGAGAAGG + Intergenic
933342854 2:81044621-81044643 AAGAAGAAAAGGAAAGGAGAAGG + Intergenic
933611408 2:84439860-84439882 GATCAGAAAGGGAACTCAGATGG - Intronic
933619348 2:84519587-84519609 AAGAAGAAGGGGAAGGGAAAGGG - Intronic
933847223 2:86336364-86336386 AGTAAAGAAGGGAAGGGAGATGG + Intronic
933926068 2:87092007-87092029 AAGAAGAAAGGAAAAGGAAAAGG - Intergenic
934165438 2:89290046-89290068 CATAAGAAAGGGAGGGAAGAAGG - Intergenic
934201835 2:89892416-89892438 CATAAGAAAGGGAGGGAAGAAGG + Intergenic
935412967 2:102785234-102785256 AAGAAGAAAGGGGACTGAGGAGG - Intronic
937818214 2:126276433-126276455 AAGGAGAAAAGGAAGGGAGAAGG + Intergenic
938660747 2:133484454-133484476 AATTAGAAAGGGATGGGAAATGG - Intronic
938776762 2:134548106-134548128 AATAAGAAAGAAAAAGCAGAGGG + Intronic
939730714 2:145781507-145781529 ACGAAGAGAGGGAACTGAGATGG - Intergenic
939997188 2:148930917-148930939 AGTAAGAGAGGGAAAGGCGAGGG - Intronic
940072183 2:149701254-149701276 AATGAGAAAGGGAAGAGAGAGGG - Intergenic
940130304 2:150373777-150373799 AATCAGAAAGTGAAGGGAAATGG - Intergenic
940359462 2:152781908-152781930 AAAAAGAAAGGGAAGAAAGAAGG - Intergenic
940735076 2:157441760-157441782 AATATGAAAGGGACTGAAGACGG - Intronic
941187611 2:162336536-162336558 GAAAAGAAAGGGAGAGGAGATGG - Intronic
941294620 2:163720992-163721014 AAAAAGAAAGGGAAGGAAGGAGG + Intronic
941380129 2:164782520-164782542 AGGAAGAAAGGGAATGGGGAGGG + Intronic
941410814 2:165155393-165155415 AAAAAGAAAGGGAAAGGGAAAGG - Intronic
941784416 2:169481945-169481967 AATAAGAAATGGTAAGGACATGG - Intronic
941794099 2:169581301-169581323 AGGAAGAGAGGGAATGGAGAAGG + Intergenic
942677404 2:178442436-178442458 AATAAGAAAGGCACAGGGGATGG + Intronic
943232222 2:185268833-185268855 AAAAAGAAAAGGAAGGAAGAAGG - Intergenic
943252121 2:185538327-185538349 AGTGAGAAAGAGAACAGAGAAGG - Intergenic
943398444 2:187372436-187372458 AAAAAGAAAGGGAACAGAGAGGG - Intronic
943662265 2:190571737-190571759 ATTATGAAAGGGAAAGGAGTTGG + Intergenic
944628893 2:201601389-201601411 AAAAGGAATGGGAAAGGAGATGG + Intronic
944827514 2:203500279-203500301 AATATGTAAGAGAAAGGAGAAGG + Intronic
945473363 2:210253033-210253055 AATAAGAAAAGGAGAGGAGGGGG - Intergenic
945849216 2:214985210-214985232 ATGAAGAAAAGGAACAGAGAAGG - Intronic
945885996 2:215376238-215376260 AATAAGAAAGGGCACAATGATGG + Intronic
946426930 2:219603941-219603963 AATAGGAAGGGGAACTGTGAGGG + Intronic
946492242 2:220160012-220160034 AAAAAGAAAGGGAAAAAAGAAGG - Intergenic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946802191 2:223430191-223430213 AATAAGAAATGTAAGAGAGATGG - Intergenic
946832114 2:223737525-223737547 AAGGAGAAAGAGAAAGGAGAGGG - Intergenic
947185367 2:227450448-227450470 AAGAAGAAAGGAAACGGGGGGGG - Intergenic
947865207 2:233393007-233393029 AATAAAAAAGGAAACAGAAAAGG - Intronic
947924999 2:233913723-233913745 AATATTAAAGAGAACAGAGATGG + Intergenic
948218342 2:236249133-236249155 AATGAGAAAGGGAACTTAAATGG - Intronic
1168918478 20:1511226-1511248 AATGTGAAAGGCAATGGAGAGGG - Intergenic
1168948067 20:1777987-1778009 AAAAGGAAAGGGAAAGGAGGAGG + Intergenic
1169518844 20:6349695-6349717 AAGAAGAAAGGAAAGGAAGAAGG - Intergenic
1169709736 20:8548106-8548128 AAAAAGAAAAGGAAGGAAGAAGG - Intronic
1169719367 20:8657040-8657062 AAAAAGAAAGGAAAGAGAGAGGG + Intronic
1170361639 20:15552887-15552909 GATAGGAAAGGCAACTGAGAAGG - Intronic
1170440983 20:16378414-16378436 AAGAAGAAAGGGGAAAGAGAGGG + Intronic
1170509025 20:17058004-17058026 AAGAAGGAAGGGAAGGGAGGAGG + Intergenic
1170532651 20:17309904-17309926 AAGAAGAAAGGGAAGGGGAAGGG + Intronic
1170876961 20:20258993-20259015 AACAAGAAAGGGAAAGGAGAGGG - Intronic
1171103295 20:22407204-22407226 AAAAAGAAAGAGAAGAGAGAAGG + Intergenic
1171210812 20:23315573-23315595 GATGGGAAAGGGCACGGAGATGG - Intergenic
1172316625 20:33960427-33960449 AATAATAAAGGAAAGGGTGAAGG - Intergenic
1172347656 20:34216373-34216395 AATAAGAAATAGACAGGAGACGG - Intronic
1172806963 20:37619018-37619040 AAGGAGAAAGGGAGAGGAGAGGG - Intergenic
1172850462 20:37958968-37958990 AACAAGAAAGAGAAAGGAGCTGG - Intergenic
1172996428 20:39073373-39073395 AAAAAGAAAGGGAAGGGAAAGGG - Intergenic
1173344065 20:42182401-42182423 AATAAGAAGGGTTACAGAGAGGG + Intronic
1173358306 20:42316255-42316277 ACTAAGAAAGGAAATGTAGAAGG - Intronic
1173834930 20:46118751-46118773 AATAAGAAGGGGACAGGAAACGG - Intronic
1174202077 20:48813665-48813687 AAGAAGAAAGGAAAGGGAGAGGG + Intronic
1174417890 20:50379599-50379621 AATAAAAACTAGAACGGAGAAGG + Intergenic
1174558873 20:51415816-51415838 AGAAAGAAAGGGAAAGGAGGAGG - Intronic
1174993203 20:55536108-55536130 ATGAAGAAAGGAAACAGAGAAGG - Intergenic
1175049054 20:56136279-56136301 AAAAAAAAAGGGAAAGAAGAGGG + Intergenic
1175140448 20:56857018-56857040 AAAAAGGAAGGGAAAGGAGAAGG + Intergenic
1175464668 20:59182503-59182525 AAGAAGACAGGGGACGGGGATGG + Intergenic
1175820358 20:61905794-61905816 AATAAGGAAGGGAATTCAGAAGG + Intronic
1175841632 20:62031660-62031682 AATGAGAAAGTGAGGGGAGAGGG - Intronic
1177299257 21:19219574-19219596 AAGCAGAAGGGGAAGGGAGAAGG + Intergenic
1177955100 21:27588455-27588477 AGTGAGAAAGGGAAGAGAGAAGG + Intergenic
1178057044 21:28811288-28811310 AAGAAGAAAGGGAAGGGAAGGGG + Intergenic
1178238351 21:30870093-30870115 AATAAAAAAAGGAAAGGAGAAGG + Intergenic
1178327341 21:31656652-31656674 AAAAAGAAAGAGAAAGAAGAAGG - Intergenic
1179101949 21:38361808-38361830 AACCAGAAAGGGAATGGAGTTGG + Intergenic
1179167950 21:38949257-38949279 AAGAAAAAAGGGAAGGCAGAAGG - Intergenic
1179649155 21:42795504-42795526 AATAAGGAAAGGAATGGAGCTGG - Intergenic
1180725032 22:17940513-17940535 AAGATGAAAGGGAACAGTGAAGG + Intronic
1181860893 22:25817426-25817448 AAAGAGAAAGGGAAAGGAAAGGG - Intronic
1182547377 22:31084099-31084121 AACAAGAAAGGGGATGGAGTGGG - Intronic
1183414499 22:37674834-37674856 AATAAAAAAGAGAAAGGACAGGG + Intergenic
1183560175 22:38566281-38566303 AAAAAAAAAAGGAAAGGAGAAGG + Intronic
1183791755 22:40077034-40077056 AAAAAGAAAAGGAAAGGAAAAGG + Intronic
1184100757 22:42340825-42340847 AATAAAGAAGGGAAGGGGGAGGG + Intronic
1185135102 22:49065820-49065842 AGAAAGAAAGAGAAAGGAGAAGG - Intergenic
949710881 3:6870001-6870023 AAAAAGAAGAGGAAAGGAGAAGG - Intronic
951337971 3:21447212-21447234 ATTACGAAAGGGAAAGGAAAAGG + Intronic
951535374 3:23735884-23735906 AATAAGAATGGGTAGGGATATGG + Intergenic
951842038 3:27044672-27044694 AATAAGTTAGAGAACCGAGAAGG + Intergenic
951870234 3:27353903-27353925 AGAAAGAAAGAGAAGGGAGAAGG + Intronic
952248094 3:31619560-31619582 AATAAGAAGGGGTAGGGAGTAGG + Intronic
952521596 3:34164473-34164495 GAAAAGAAAGGGAAGGAAGAAGG - Intergenic
953186550 3:40643149-40643171 AGGAAGAAAGGGAACGGGGAGGG - Intergenic
954036059 3:47851873-47851895 AACAAGAAAGGGCCAGGAGATGG - Exonic
955150679 3:56363856-56363878 AAAAAGAAAGGGAAAGGGAAAGG + Intronic
955729773 3:61972626-61972648 AAAAAGAAAAAGAACGAAGAGGG - Intronic
955800641 3:62682694-62682716 GAGAAAAAAGGGAAAGGAGAAGG - Intronic
956293023 3:67681568-67681590 AAAAAGAAAGTTAACTGAGATGG + Intergenic
956864590 3:73356689-73356711 AGAAAGAAAGGGAAAGAAGAAGG - Intergenic
956915629 3:73868086-73868108 GATCAGAAAGGAAACAGAGAGGG + Intergenic
957531433 3:81445258-81445280 AATAAGAAAAGGAATTTAGAGGG - Intergenic
957635824 3:82783113-82783135 AATAAGAAAGGGAGAAGGGATGG + Intergenic
957828736 3:85487471-85487493 AAGAAGAAAGGAAAAGGAGGAGG + Intronic
957899935 3:86476212-86476234 GAGAAGAGAGGGAAGGGAGAGGG + Intergenic
958424318 3:93963880-93963902 AAAAGGAAAGGGAACGGAAGGGG - Intronic
958734578 3:97993799-97993821 AAAAGGAAAGGGAAGGGGGAAGG - Intronic
958908445 3:99967035-99967057 GATAAGAGAGGGAAAGGATATGG + Intronic
960094002 3:113670605-113670627 AAAAAAAAAGGGAAGGGGGAAGG + Intronic
960132648 3:114073713-114073735 AATAATAAAGGGTATGGAGAGGG - Intronic
960273583 3:115701091-115701113 AATATGAACGGGAGAGGAGATGG - Intronic
960307589 3:116080958-116080980 ATTAAGAAAGGGAAGGAAGAAGG + Intronic
960356631 3:116661908-116661930 AAAAGGAAAGGAAACGGAGTTGG - Intronic
960554242 3:119010031-119010053 AACAAAAAAGGGAAAAGAGATGG + Intronic
961660278 3:128464949-128464971 AAGAAGGGAGGGAAGGGAGAAGG - Intronic
961929093 3:130514964-130514986 AAAAAGACAGGGAAAGAAGAGGG - Intergenic
961945630 3:130684007-130684029 AAGAAAAAAGGGATAGGAGATGG + Intronic
962143977 3:132820758-132820780 AAAAAGAAAAGGAAAGGAAAAGG + Intergenic
962297185 3:134201336-134201358 AATATGAAGGGGAAGGGAGCTGG - Intronic
963509630 3:146230677-146230699 AATGAGAGAGGGAAAGGAGAGGG + Intronic
963819117 3:149868608-149868630 GAACAGAAAGGGAAAGGAGAGGG - Intronic
964242517 3:154613483-154613505 AAAAAGAAAGGGAAAGGGCAAGG - Intergenic
964252638 3:154736428-154736450 AAGAAGAAAGGGAGGAGAGAGGG + Intergenic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
965682558 3:171266419-171266441 AAGATGAAAGGAAACTGAGAGGG - Intronic
966799320 3:183748209-183748231 AAGGGGAAAGGGAAGGGAGAAGG - Intronic
967523366 3:190462385-190462407 AACAAGGAAAGGAACTGAGATGG - Intergenic
967667228 3:192187840-192187862 AAAAAGGAAGGGAAGGGAAAAGG + Intronic
967998521 3:195185158-195185180 AAAAAGAAAAGGAAAGGAAAGGG + Intronic
969255277 4:5997033-5997055 AATGACAAAGGAAAAGGAGAGGG + Intergenic
969675681 4:8613121-8613143 AAAAAAAAAAGGAACAGAGAGGG - Intronic
970091445 4:12412583-12412605 AAAAAGAAAGGAGACAGAGAGGG + Intergenic
970867220 4:20772928-20772950 AATAAGAAAGGGAAAGGGGCCGG - Intronic
970916101 4:21337068-21337090 AAGAAGACAGTGAAGGGAGAGGG + Intronic
971251415 4:24975986-24976008 AAAAAGAAGGAGAAGGGAGAGGG + Intronic
971577994 4:28301393-28301415 AATAAAAAAAGGAAGGAAGAAGG + Intergenic
971949247 4:33322575-33322597 AATAAGGAAGAGAAAGAAGAGGG + Intergenic
972132086 4:35850409-35850431 ACTAAGAAAGGAGACTGAGAAGG - Intergenic
972699339 4:41479014-41479036 AAAAAGAAAGGGAAGGGAAGGGG + Intronic
972870760 4:43294567-43294589 ACGATGAAAGGGAAGGGAGAAGG - Intergenic
973337697 4:48972958-48972980 AATAAGAAAAAGGAAGGAGAAGG - Intergenic
974018590 4:56673040-56673062 AAACAGAAAGGGAAAGGAGTGGG - Intronic
974838439 4:67276921-67276943 CATCAGAAAGGGGAAGGAGAGGG - Intergenic
976259064 4:83128499-83128521 AAAGAGAAAGGGAACGGGAAAGG - Intronic
976322904 4:83736001-83736023 AAAAAGAAAGGGAGGAGAGAAGG - Intergenic
976479283 4:85520925-85520947 AATAAGAAAGAGATCAGAGGGGG + Intronic
976633843 4:87267529-87267551 AATAAGAAGGAGAAGGGAGATGG - Intergenic
977598960 4:98915279-98915301 AAAAAGAAAAGGTACGAAGAAGG + Intronic
977727205 4:100310333-100310355 AAAAAGAAAGAAAACAGAGAAGG - Intergenic
977879406 4:102187009-102187031 AAAAAGAAAGGGGACGGGCACGG + Intergenic
977879415 4:102187089-102187111 AAAAAGAAAGGGGACGGGCACGG + Intergenic
977879424 4:102187169-102187191 AAAAAGAAAGGGGACGGGCACGG + Intergenic
978227823 4:106359720-106359742 AATAAGAAAGAAAACAGAAAAGG + Intergenic
978240580 4:106511087-106511109 AGAAAGAAAGGAAATGGAGAGGG - Intergenic
978628762 4:110718742-110718764 AACAAGAAAGGAAATGAAGACGG - Intergenic
979231223 4:118351595-118351617 AAAAAGAAAGGGAAAAGAGATGG - Intronic
979580923 4:122359087-122359109 AACAAAAAAGGGAGCGGGGAGGG + Intronic
981416798 4:144503311-144503333 AATAAGAAGGGGAAGAGAAAGGG + Intergenic
981444643 4:144821600-144821622 AATAAGAAAGAAAAAGGAAAAGG + Intergenic
982018415 4:151178906-151178928 AAAAAGGAAGGGAAAAGAGAAGG - Intronic
982560310 4:156921526-156921548 AATTAGAAAGAGAAGAGAGAGGG + Intronic
982804677 4:159748991-159749013 AAAAGGAAAGGGAAAGGGGAAGG - Intergenic
982804697 4:159749055-159749077 AAGGAGAAAGGGAAGGGAAAAGG - Intergenic
982906157 4:161075723-161075745 AAGAAGAAAGGAAAGAGAGAAGG + Intergenic
983012538 4:162564875-162564897 AAGAAGGAAGGGAAGGGAGAAGG + Intergenic
983195856 4:164806005-164806027 AATTAGAAGGAGAACAGAGAAGG + Intergenic
983477887 4:168238378-168238400 AATAAGGAAGGGAAGGGAAAGGG + Intronic
983678736 4:170327529-170327551 AAAAAGAAAGGGAAAGGGAAAGG + Intergenic
984703985 4:182834580-182834602 AAGAAGGAGGGGAAAGGAGAAGG - Intergenic
985169151 4:187129805-187129827 AATCAGGAAGGAAAGGGAGATGG - Intergenic
985189383 4:187355282-187355304 AATAAGAATGAGAACGGAAAAGG - Intergenic
985333511 4:188867786-188867808 AAAAAGAAAGAAAAGGGAGAAGG - Intergenic
985902923 5:2810937-2810959 AATAAGCAAGGGAAGTGTGAGGG - Intergenic
986328886 5:6703001-6703023 AAAAAGAGAGGGGACGGGGAGGG - Intergenic
986393662 5:7306740-7306762 AAGATGAAAGGGAAAGGAGGCGG + Intergenic
986510505 5:8501740-8501762 AAAAAGAAATGGATCTGAGATGG - Intergenic
987695346 5:21321656-21321678 GAAAAGAAAGGGAAAGGACAGGG + Intergenic
988205588 5:28129555-28129577 AAACAGAAAGGGAACAGAAAAGG + Intergenic
989088393 5:37700936-37700958 AAGAAGAAAGGGAAGGGGAAGGG - Intronic
989339785 5:40360662-40360684 ACTGGGAAAGGGAAAGGAGAAGG - Intergenic
989359323 5:40582337-40582359 AATAATAAAGTTAAAGGAGATGG - Intergenic
989664711 5:43840778-43840800 AATAAATAAGTGAATGGAGATGG + Intergenic
990044591 5:51413827-51413849 AAGAAGGAATGGAACTGAGAGGG - Intergenic
990421711 5:55642032-55642054 AACAAGGAAGGGAAAGGGGAAGG - Intronic
990509447 5:56477148-56477170 AATAAGAAGGGGATGGCAGAGGG - Intronic
990631785 5:57678390-57678412 AATAAGAAAAGGAATGGAACTGG + Intergenic
991156181 5:63439120-63439142 AAAAAGAGAGGAAAGGGAGATGG - Intergenic
991288108 5:65003383-65003405 AAGAAGAAAGGGAAGGGAAATGG - Intronic
991447269 5:66713578-66713600 AAGAAGAAATGCAACGGAAATGG - Intronic
991616844 5:68505753-68505775 AAAAAAAAAGGGAGGGGAGAAGG - Intergenic
992579105 5:78152123-78152145 AGAAAGGAAGGGAAGGGAGAGGG - Intronic
993359267 5:86953745-86953767 AAGAAGAAAGGAAAAGCAGATGG - Intergenic
993439355 5:87936768-87936790 AGGAAGAAAAGGAAGGGAGAGGG - Intergenic
994710252 5:103257641-103257663 AATAAGTAAAGGAAGGTAGAGGG - Intergenic
994821089 5:104652253-104652275 AATAACAAAAGGAAAGGATAGGG + Intergenic
994860638 5:105188147-105188169 AAGAACAAAGGGAATGGAGAAGG - Intergenic
995005194 5:107184179-107184201 AATATGAAAGGGAGGGAAGAGGG + Intergenic
996022239 5:118604089-118604111 CATAAGGAAGGGGAAGGAGAAGG - Intergenic
996057914 5:119000919-119000941 GATAAGAAAGGGAAAGGAAAGGG + Intergenic
996200061 5:120661612-120661634 AATTAGAAAGGAAACTGAAAAGG - Intronic
997221226 5:132166975-132166997 AATAATAAAAGGAGAGGAGAAGG - Intergenic
998174775 5:139895003-139895025 AAGAAGAAGGGGAAGGGAGGAGG + Intronic
998228484 5:140344751-140344773 AATCAGAAAGGGGAGGGAGAAGG + Intronic
1000143858 5:158433749-158433771 GAGAAGAAAGAGAAAGGAGAGGG - Intergenic
1000428806 5:161125514-161125536 AAAAAGAAAGTGAACAGTGAAGG - Intergenic
1000814297 5:165900932-165900954 AAAAAGAAAGGGAATGAAGATGG - Intergenic
1000885748 5:166745732-166745754 AGAAAGAAAGGGAAAGGAAAGGG - Intergenic
1001002168 5:168017889-168017911 AAGAAGAAAGTGACGGGAGAAGG - Intronic
1001467474 5:171981035-171981057 AAAAGGAAAGGGACTGGAGACGG + Intronic
1001596870 5:172904133-172904155 AATAAGAAAGGAAAGGAAGGAGG - Intronic
1001609993 5:172992644-172992666 AATAAGACAGGAAAGGGAGACGG - Intronic
1001640368 5:173239469-173239491 AATAGGAGAGGGAAGGGAGAAGG - Intergenic
1001981018 5:176037094-176037116 AAAAAGAAAGGGAAAGAAGAGGG + Intergenic
1002096883 5:176836652-176836674 AATCAGAAAGGGCTCGGAGAAGG + Intronic
1002236443 5:177806972-177806994 AAAAAGAAAGGGAAAGAAGAGGG - Intergenic
1002585595 5:180245023-180245045 AATAGGGAAGGAAATGGAGAAGG - Intronic
1002906228 6:1451384-1451406 AGGAAGAAAGAGAACAGAGAAGG + Intergenic
1002958663 6:1893485-1893507 AAGCAGTAAGGGAACAGAGATGG - Intronic
1003406725 6:5832430-5832452 AAAAAGGAAGAGAAAGGAGAAGG + Intergenic
1003513464 6:6800406-6800428 AAAGAGAAAGAGAAAGGAGAGGG - Intergenic
1003686001 6:8302865-8302887 GATAAGGAAGGGAAGGGAGCAGG - Intergenic
1004357874 6:14945718-14945740 AAGAAGAAAGAGATCAGAGATGG + Intergenic
1004471625 6:15934454-15934476 AATAAGAAGGGGATTTGAGAGGG + Intergenic
1004733596 6:18383275-18383297 TCTAAGAAAGGGAAAGGGGAAGG - Intergenic
1004821825 6:19375548-19375570 AAGAAGAGAGGGAAGGAAGAAGG - Intergenic
1005092501 6:22072357-22072379 AAAAAGAAGGGGTAGGGAGAGGG - Intergenic
1005410725 6:25543079-25543101 AATAAGAAAAGGAACCTAGCAGG + Intronic
1005413571 6:25576892-25576914 ACTAGGAAAGGGGAGGGAGAGGG - Intronic
1005471127 6:26163689-26163711 AAAAAGAAAGAGAAAGGGGAAGG + Intronic
1005555448 6:26976566-26976588 AAAAAGAAAGGGAAAGGACAAGG - Intergenic
1005611725 6:27532281-27532303 AACAAGAAAGGGACCGTAGTCGG - Intergenic
1006166978 6:32070894-32070916 AATAAGAAAGGGAACGGAGAAGG - Intronic
1006388045 6:33742949-33742971 AATAGGGAAGGGCAAGGAGATGG + Intronic
1006609274 6:35283840-35283862 AATAGGAAAGGCAGCTGAGATGG - Intronic
1006803238 6:36772458-36772480 AATAAGACTGGGAACAAAGACGG - Intronic
1006915338 6:37590289-37590311 ACAAAGACTGGGAACGGAGAAGG + Intergenic
1006995841 6:38259382-38259404 AACAAAAAAGGTAACGGTGAAGG - Intronic
1007104226 6:39272538-39272560 AATCAGAGAGGGAAGGAAGATGG + Intergenic
1007237465 6:40401133-40401155 AATAGGAATGGGAATGGAGTGGG + Intronic
1007476560 6:42123417-42123439 AAGAAGAAAGGAGAAGGAGAAGG + Intronic
1007874415 6:45079460-45079482 AAGAAGAAGGGGAAAGGAGGAGG + Intronic
1008862977 6:56173369-56173391 CAAAGGAAAGGGAAAGGAGAAGG + Intronic
1008995721 6:57656068-57656090 AAAAAGAAAGGGAAGGAAGTTGG - Intergenic
1009042764 6:58200038-58200060 AATAAGACTGGTAAAGGAGAGGG - Intergenic
1009218601 6:60954274-60954296 AATAAGACTGGTAAAGGAGAGGG - Intergenic
1009713300 6:67353357-67353379 AATAGGAGAGGGAATGGAGCAGG - Intergenic
1009714923 6:67378981-67379003 AGGAAGAAAGGGAACAGGGAAGG - Intergenic
1010186892 6:73155401-73155423 AATAAGAAAAGCAACGAGGATGG + Intronic
1010581370 6:77600817-77600839 AAGAAGAAAGGAGAAGGAGAAGG - Intergenic
1011889747 6:92143071-92143093 AATAAGGAAAGAAAAGGAGAAGG + Intergenic
1011916920 6:92517927-92517949 AATAAGAAAGTGAATAGAGAGGG - Intergenic
1012007302 6:93729638-93729660 ACTGAGAAAGGGAAGGTAGAAGG + Intergenic
1012193890 6:96315698-96315720 AATTAGAAAAGGCAAGGAGATGG + Intergenic
1012387481 6:98698868-98698890 AATAATAAAGGGAAAAGAGAAGG - Intergenic
1012603326 6:101126165-101126187 AAGAAGGAAGGGAACTGGGATGG - Intergenic
1013544135 6:111139040-111139062 AGAAGGAAAGGGAATGGAGAGGG - Intronic
1013702349 6:112788497-112788519 AATAAAGAAGGGAATAGAGATGG - Intergenic
1013936147 6:115596835-115596857 AATAAGTAGGGAAAAGGAGATGG - Intergenic
1014091206 6:117405430-117405452 AACAAGAAAGGGAAGGAAAATGG - Intronic
1014911440 6:127098639-127098661 AAAAAGAAAGGGAAGGAAGAAGG + Intergenic
1015190307 6:130465008-130465030 AACAAGAGAGAGAAAGGAGAAGG + Intergenic
1015512562 6:134052767-134052789 TAAAAGAAAGGGAACTCAGACGG + Intergenic
1015788337 6:136941239-136941261 TATCAGAAAGGGAACTGATATGG + Intergenic
1016324561 6:142885324-142885346 GAGAAGAAAGGGGAGGGAGAAGG - Intronic
1016473978 6:144406328-144406350 AAAAAAAAAGGAAAGGGAGATGG - Intronic
1016703996 6:147085537-147085559 AAAAAGAATGGGAACGAGGAGGG - Intergenic
1017453400 6:154575635-154575657 AATAAGAAAGGCAAAGGATGAGG + Intergenic
1018331623 6:162733885-162733907 TATAAAACAGGGAAGGGAGATGG - Intronic
1018416914 6:163609806-163609828 AATATGAAAGGGAAAGAAGATGG - Intergenic
1019151731 6:170010946-170010968 ACTTTGAAAGGGAAAGGAGAGGG + Intergenic
1019410778 7:905726-905748 AAGGAGAAAGGGAAAGGAGAAGG + Intronic
1019800509 7:3084819-3084841 AAAAAGAAGGGGAATGGAGTGGG - Intergenic
1019919970 7:4157287-4157309 AGGAAGAAAGGGAAGGGAAAAGG + Intronic
1019978716 7:4605355-4605377 GGTAAGAAAGGGAAGGTAGATGG - Intergenic
1020451674 7:8326662-8326684 AATGAGGAAGGGATGGGAGAAGG - Intergenic
1020731130 7:11882390-11882412 AAGAAGAAAGGAAACAAAGAAGG - Intergenic
1020954522 7:14724411-14724433 AATAAGAAATGTAATAGAGATGG + Intronic
1021250420 7:18318395-18318417 AATAACAAATGGAATGCAGATGG + Intronic
1021995285 7:26173975-26173997 ATTAAGAAAGAAAACTGAGATGG + Intronic
1022200342 7:28110550-28110572 AAAAGGAAAGGGAAAGGAAAAGG + Intronic
1022773213 7:33496828-33496850 AAAAAGAAACGGCATGGAGATGG - Intronic
1023550906 7:41369161-41369183 AAAAAGAAAGAGAAAGAAGAAGG - Intergenic
1023801171 7:43836142-43836164 AATAAGAAATGGAATGAAGCCGG + Intergenic
1023811888 7:43918317-43918339 GAAAGGAAAGGGAAAGGAGAAGG - Intronic
1023815791 7:43949054-43949076 AATAAATGAGGGAACAGAGAAGG - Intronic
1025247252 7:57326680-57326702 AAAAAGAAAGGAAAAGGAAAAGG - Intergenic
1025996247 7:66529301-66529323 GCTTAGAAAGGGAACGGAGCCGG + Intergenic
1026363650 7:69625874-69625896 AAAAAGACAGGGAAGGGAAAGGG + Intronic
1026524031 7:71139235-71139257 AATAAGTAAGGGGAAAGAGATGG + Intronic
1026595729 7:71732938-71732960 AAAAAGAAAGAAAAGGGAGAAGG + Intergenic
1026988212 7:74568207-74568229 GCTTAGAAAGGGAACGGAGCTGG + Intronic
1027472071 7:78585788-78585810 TACATGAAAGGGAACTGAGAGGG + Intronic
1027543654 7:79499941-79499963 AAAAAGAAAGGGAAGGGAGCTGG - Intergenic
1027633302 7:80636157-80636179 AATAAAGCAGAGAACGGAGAGGG + Intronic
1027722798 7:81766686-81766708 AATAAGAACTGGAAAGGAGAAGG - Intronic
1027817119 7:82989762-82989784 AGAAATAAAGGGAAAGGAGAAGG - Intronic
1027988235 7:85323005-85323027 AATAAGAAAGGAAAGTGAAATGG - Intergenic
1028654221 7:93184550-93184572 AATAAGAGAGGGAATGGTCAAGG - Intergenic
1028694998 7:93698948-93698970 GATAAGAAATAGAAAGGAGAGGG - Intronic
1029431812 7:100536081-100536103 AAAAAGAAAAGGAAAGGAAAAGG - Intergenic
1029495064 7:100892153-100892175 AAAAAGAAAGGAGACAGAGAAGG - Intronic
1030020393 7:105269696-105269718 AATAAGAGAGGGAAAAGATAAGG + Intronic
1030625269 7:111838721-111838743 CAAAAGAGAGGGAACCGAGAGGG + Intronic
1031424431 7:121588113-121588135 AGTAAGAAAGAGAAAGGAAAAGG - Intergenic
1031832637 7:126646233-126646255 AAGAAGAAAAGGAAGAGAGAAGG + Intronic
1032394846 7:131581894-131581916 ACTCAGAGAGGGAAAGGAGAGGG + Intergenic
1032682970 7:134204198-134204220 AATAAGAAAAGATACAGAGACGG - Intronic
1032824420 7:135555133-135555155 AATAAGAAAGACAAATGAGAAGG + Intergenic
1033327546 7:140392100-140392122 AAAGAGAAAGGGAGGGGAGAGGG - Intronic
1033349719 7:140552369-140552391 AAGAAGGAAGGGAAAGGAGAGGG - Intronic
1033770717 7:144548625-144548647 ATTAAGAAGGGGAAGAGAGAAGG + Intronic
1033926908 7:146473396-146473418 AAGAAGAAAGGAAAAGAAGAAGG - Intronic
1034108440 7:148512708-148512730 CATAAGAAATGGAAAAGAGAAGG + Intergenic
1034760297 7:153666133-153666155 AAAATGAAAGGGAAAGGAGTGGG + Intergenic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1035074615 7:156169467-156169489 GAAAAGAAAAGGAACTGAGATGG + Intergenic
1035104011 7:156427041-156427063 AAAAATAAGGGGAACGGAGGTGG - Intergenic
1035441734 7:158907575-158907597 GAAAGGAAAGGGAACGGAAAGGG - Intronic
1035992813 8:4510923-4510945 GAAAGGAACGGGAACGGAGAAGG - Intronic
1036056953 8:5265945-5265967 AATAAGAAAGGTAAAGAGGAGGG + Intergenic
1036723823 8:11201396-11201418 AAGAAGGCAGGGAACGGGGAGGG + Intergenic
1037009044 8:13818419-13818441 GAAAAGGAAGGGAAGGGAGAAGG + Intergenic
1038326862 8:26578366-26578388 AAAAAGGAGGGGAAAGGAGAGGG + Intronic
1038421515 8:27436943-27436965 AAGAAGAAGGGGAGTGGAGAAGG + Intronic
1039225076 8:35379333-35379355 AACAAGGAAGGGAAAGGTGATGG - Intronic
1039280306 8:35977175-35977197 AATAACAAAGTGAAGGGAAATGG + Intergenic
1040377035 8:46836015-46836037 AATAAGAAAAAGAAAGGACAGGG + Intergenic
1040675588 8:49745609-49745631 AAAAAGAAAGGAAATGTAGAAGG + Intergenic
1041899912 8:62970660-62970682 AGAAAGAAAGGGAATGGACAAGG + Intronic
1042128384 8:65561789-65561811 AACAAGAAAGTGAAAAGAGATGG - Intergenic
1042253738 8:66782252-66782274 AATAAGAAAAGGAATTGGGATGG - Intronic
1042444038 8:68862647-68862669 AATAAGAAAGATAACTGAGGGGG + Intergenic
1043495567 8:80796915-80796937 AAAGAGAAAGGGAAGGGAAAAGG + Intronic
1044002532 8:86901788-86901810 AATATGAAAGAGAAGGCAGAAGG - Intronic
1044367807 8:91370075-91370097 AGAAAGAAAGAGAAGGGAGAAGG - Intronic
1044838999 8:96322228-96322250 ACTAAGACAGGGACCAGAGAGGG - Intronic
1044855253 8:96468690-96468712 GATAAGGAAGGGAAAGGACATGG - Intergenic
1045524751 8:102932170-102932192 GATAAGTAAGGGAATGAAGAAGG - Intronic
1045574847 8:103409528-103409550 TATTAGAAAGGGAACTGATATGG + Intronic
1045766766 8:105681693-105681715 AAAAAGGAAGGGACCAGAGAGGG - Intronic
1045817395 8:106292766-106292788 ACCAGGAAAGGGAACTGAGAAGG + Intronic
1045912204 8:107423810-107423832 AAAAAGAAAGGAAAAGGAAAAGG - Intronic
1046390261 8:113563084-113563106 CAAAAGAAAAGGCACGGAGAAGG + Intergenic
1046708134 8:117478463-117478485 AAAAGGAAAAGGAAAGGAGAAGG + Intergenic
1046930417 8:119836409-119836431 TATAAGAAGGAGAAAGGAGAAGG + Intronic
1047132367 8:122035837-122035859 AATCAGACAGGGAAAGGAAAGGG - Intergenic
1047402589 8:124558901-124558923 AATAAAAAAAGGAATGGGGATGG + Intronic
1048189024 8:132271554-132271576 AATAATAAAAGGAAGGGTGAAGG - Intronic
1048214604 8:132482436-132482458 AAGAAGGAAGGGAAGGGAGTAGG + Intergenic
1048308911 8:133303270-133303292 AGGAAGAAGGGGAACGGAAATGG - Intergenic
1048344582 8:133567159-133567181 AAGCAAAATGGGAACGGAGAAGG - Intronic
1048884925 8:138902249-138902271 AAGGATAAAGGGAAAGGAGAGGG - Intronic
1049234378 8:141505062-141505084 AATAAGCAAGGGAGAGCAGAAGG - Intergenic
1050741310 9:8823672-8823694 AAAAGGAAAGGGAAAGGAAAGGG + Intronic
1051106877 9:13590419-13590441 GATAAGAAAGGGAAGGAAGAGGG + Intergenic
1052234210 9:26189926-26189948 AATAAAAAAAGGAATTGAGAAGG + Intergenic
1052391629 9:27885771-27885793 AAAAAGAATGGGAAGGGAGAAGG + Intergenic
1052464681 9:28815384-28815406 CAAAAGAAAGGCAAAGGAGATGG + Intergenic
1052594025 9:30536163-30536185 AAAAAGAAAGGGAAGGGAAGGGG - Intergenic
1053095998 9:35328765-35328787 AAAAAGAAAGGAAAGGGAAAGGG - Intronic
1053121739 9:35552386-35552408 AATAAAAAAGGCAGCTGAGACGG + Intronic
1053362204 9:37496434-37496456 AATGGGAAAGGGGAGGGAGAAGG - Intronic
1054799649 9:69334758-69334780 AAAAAGAAAAGGAAAGGAAAGGG - Intronic
1055076183 9:72217645-72217667 TATAATAAAGGGTAGGGAGAGGG - Intronic
1055276982 9:74629088-74629110 ATTAAAAAAGGGAACCGACATGG - Intronic
1055869959 9:80864659-80864681 AAAAAGTAATGGAATGGAGATGG - Intergenic
1056049214 9:82750595-82750617 AATAATAAAGGGAACAAACATGG - Intergenic
1056072801 9:83006582-83006604 GAAAAGAAAGGGGAAGGAGAGGG + Intronic
1056145741 9:83727544-83727566 AATTAGGAAGAGAAAGGAGAAGG - Intergenic
1056382671 9:86069450-86069472 AAAAAGAAAGGAAACGGAAATGG + Intronic
1056463051 9:86826621-86826643 AACAAGACAGGGAGTGGAGAGGG - Intergenic
1057276546 9:93678853-93678875 AATAATAAAAGGAAAGGAGAAGG - Exonic
1057374730 9:94510305-94510327 AAAAAGAAAAGAAACGGAGAGGG - Intergenic
1057767409 9:97934384-97934406 AAAAAGAAAAGGAGAGGAGAGGG + Intronic
1058457167 9:105148245-105148267 AATTAAAAAGGGAAGAGAGAAGG - Intergenic
1058553193 9:106137701-106137723 AATAAGAAATGGAAAAGAGAGGG - Intergenic
1058561487 9:106233388-106233410 AAGAAGAAAGGGGAAGAAGAAGG - Intergenic
1058719626 9:107751840-107751862 AAAAAGAAAAGGAAAGGAAAAGG + Intergenic
1059165619 9:112073903-112073925 AAAAAGAAAGGGAAAGGGAAAGG + Intronic
1059303402 9:113334000-113334022 AAAAAGAAAGGAGAAGGAGAAGG - Intronic
1059542510 9:115144337-115144359 AAAAGGGAAGGGAAAGGAGAAGG - Intronic
1059599961 9:115766457-115766479 AATAGGGAAGGGAACGGGGCAGG - Intergenic
1059883229 9:118715518-118715540 AAAAAGAAAAGGAAAGGAAAGGG - Intergenic
1059927309 9:119223013-119223035 AACAAGAAAAAGAAGGGAGATGG - Intronic
1060385943 9:123228415-123228437 AATAACAAAGGAAACTGACAAGG + Intronic
1061400126 9:130363912-130363934 AAAAAGAAAGGAAAAAGAGAAGG + Intronic
1061777950 9:132978233-132978255 AATAAGGAAGGGAAGGAAGGAGG + Intronic
1062193723 9:135261014-135261036 AATAAGAAAGGGAACAGGGACGG + Intergenic
1062229364 9:135472873-135472895 TGTTAGAAAGGGAAGGGAGATGG - Intergenic
1186588102 X:10898150-10898172 AAGGGGAAAGGGAAGGGAGAAGG + Intergenic
1186591452 X:10934237-10934259 AACAAGAAAGGAAGAGGAGAAGG - Intergenic
1186901522 X:14062281-14062303 TAAAGGAAAGGGAAAGGAGAGGG - Intergenic
1187576305 X:20559465-20559487 ATTAAGAAAGGGGAGGAAGAAGG - Intergenic
1188001036 X:24982056-24982078 AAAAAAAAAGGGACCTGAGAAGG - Intronic
1188037907 X:25338943-25338965 AATAAGCCAAGGAACAGAGAAGG + Intergenic
1188306144 X:28561773-28561795 AATAAGAAAGGAAAAGGGGGAGG + Intergenic
1188389457 X:29601755-29601777 AATAAGAAAGAGGATGGTGAAGG + Intronic
1188453442 X:30334743-30334765 AGTGAGAAAGTGAAGGGAGAAGG + Intergenic
1188472263 X:30553949-30553971 AAAAAGAAGAGGAAGGGAGAAGG + Intergenic
1189617168 X:42795691-42795713 AGTAAGACAGGGAAGGGAAAAGG + Intergenic
1190149503 X:47932249-47932271 AATAAGCAAGGGCAGGGAGAAGG - Intronic
1190203208 X:48381527-48381549 GAAAAGGAAGGGAAGGGAGAAGG - Intergenic
1190207328 X:48413877-48413899 GAAAAGGAAGGGAAGGGAGAAGG + Intergenic
1190373470 X:49765328-49765350 GATAAAAAAGGGAAGGGAGAAGG + Intergenic
1190439561 X:50463551-50463573 AAGAAGGAAGAGAAGGGAGAAGG - Intronic
1190439577 X:50463629-50463651 AAGAAGGAAGAGAAGGGAGAAGG - Intronic
1190655326 X:52607127-52607149 ATTAATACAGGGAAGGGAGAGGG + Intergenic
1190962614 X:55267405-55267427 AATAAGAAAGGGAAAGGGAAAGG - Intronic
1191162445 X:57345201-57345223 AAAAAGAAAGGGAAGGGAAGGGG - Intronic
1191836650 X:65470379-65470401 AACCAGAAAGGGAGAGGAGATGG + Intronic
1192025219 X:67443036-67443058 AGTAAGAAAGGAAATGGAAAGGG - Intergenic
1192121856 X:68464086-68464108 AAAAAGAAAGGGAAAGGAAAGGG - Intergenic
1193688929 X:84615268-84615290 AATGAGAAAGGGGAGAGAGAAGG - Intergenic
1193703986 X:84798065-84798087 AGTAACAAAGGGAAAGGAGAGGG - Intergenic
1195965186 X:110423349-110423371 AAAAAGAAAGAGGAAGGAGAAGG + Intronic
1195966374 X:110433468-110433490 AATGAGGAAGGGCAGGGAGATGG + Intronic
1196619347 X:117804879-117804901 AATAAAACAGGGCAGGGAGAGGG + Intergenic
1198069580 X:133134826-133134848 GATAAGAAAGGGAAAGGGAAAGG + Intergenic
1198370111 X:135981970-135981992 AATAAGTAAAGGAATGGACATGG + Intergenic
1198509044 X:137330738-137330760 AATAATGAAGGGAACAGATATGG - Intergenic
1199855441 X:151755609-151755631 AATAAGAAAGGAAGGAGAGAGGG + Intergenic
1199946099 X:152669452-152669474 AGAAAGGAAGGGAAAGGAGAAGG - Intergenic
1201458627 Y:14198392-14198414 ATGAAGAAAGCTAACGGAGAAGG - Intergenic