ID: 1006166981

View in Genome Browser
Species Human (GRCh38)
Location 6:32070905-32070927
Sequence AGCCGGTGCAGAATAAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006166981_1006166987 -5 Left 1006166981 6:32070905-32070927 CCCTTTCTTATTCTGCACCGGCT 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1006166987 6:32070923-32070945 CGGCTGGCCCGGGAGAACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1006166981_1006166992 11 Left 1006166981 6:32070905-32070927 CCCTTTCTTATTCTGCACCGGCT 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1006166992 6:32070939-32070961 ACTAAGGCTCCCACTGGGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 170
1006166981_1006166990 5 Left 1006166981 6:32070905-32070927 CCCTTTCTTATTCTGCACCGGCT 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data
1006166981_1006166996 24 Left 1006166981 6:32070905-32070927 CCCTTTCTTATTCTGCACCGGCT 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1006166996 6:32070952-32070974 CTGGGCCTGGTGAAGGAGCGTGG 0: 1
1: 0
2: 1
3: 30
4: 412
1006166981_1006166991 6 Left 1006166981 6:32070905-32070927 CCCTTTCTTATTCTGCACCGGCT 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1006166991 6:32070934-32070956 GGAGAACTAAGGCTCCCACTGGG No data
1006166981_1006166993 17 Left 1006166981 6:32070905-32070927 CCCTTTCTTATTCTGCACCGGCT 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1006166993 6:32070945-32070967 GCTCCCACTGGGCCTGGTGAAGG 0: 1
1: 0
2: 0
3: 28
4: 272
1006166981_1006166997 25 Left 1006166981 6:32070905-32070927 CCCTTTCTTATTCTGCACCGGCT 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1006166997 6:32070953-32070975 TGGGCCTGGTGAAGGAGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006166981 Original CRISPR AGCCGGTGCAGAATAAGAAA GGG (reversed) Intronic
902545500 1:17186973-17186995 AGCCAGAGGAGAATAATAAAAGG - Intergenic
902962386 1:19974180-19974202 ATTTGGTGCAGAATTAGAAAAGG + Intergenic
903645865 1:24896236-24896258 AGCCTGTGCAGAATGACAGAGGG - Intergenic
906552107 1:46673488-46673510 ATCAGGTGCAGAGTAGGAAATGG + Exonic
908387681 1:63658076-63658098 AGCAGCTGCAGAATAAGGAAAGG - Intronic
911039855 1:93582951-93582973 AGCCTGTGGGGGATAAGAAAAGG + Exonic
911222789 1:95267186-95267208 GGGAGGTGAAGAATAAGAAAAGG - Intergenic
911303368 1:96203751-96203773 AGCCGGAGCAGACTAATACAAGG - Intergenic
915459572 1:156061736-156061758 AGCCAGTGCAGCACAAGAGATGG + Intronic
917651526 1:177082550-177082572 AGACTTTGCAGAAGAAGAAAAGG + Intronic
918106432 1:181419279-181419301 AGCCAGTGCAGAATGAGTTAAGG - Intronic
919178461 1:194050450-194050472 AAGCTGTGCAAAATAAGAAATGG + Intergenic
924482310 1:244447908-244447930 AGGTGCTACAGAATAAGAAAAGG + Intronic
1064168556 10:13007897-13007919 AGCTGGGGCAGGATAAGAGATGG + Intronic
1065721381 10:28631359-28631381 AGCCTGTACAGACTAGGAAAGGG + Intergenic
1066607942 10:37202187-37202209 AGCCAGCGGAGAAGAAGAAAGGG + Intronic
1067878375 10:50024000-50024022 AGACGGTGCAGAAAGAAAAACGG - Intergenic
1067893347 10:50153928-50153950 AGACGGTGCAGAAAGAAAAACGG + Intergenic
1068265091 10:54637428-54637450 AGCCGGAGCAGACAAATAAATGG - Intronic
1076191754 10:128488068-128488090 AGCCCGAGCAGACTAAGACAGGG - Intergenic
1078941460 11:16011134-16011156 TGCCTAAGCAGAATAAGAAAAGG + Intronic
1080017413 11:27522009-27522031 AACAGGTACAGAGTAAGAAAAGG - Intergenic
1083709422 11:64539030-64539052 AACAGGTGCAGAATAAATAATGG - Intergenic
1083752798 11:64770426-64770448 AGTCGGTGCAGAATAGTAAACGG - Intronic
1083893346 11:65607834-65607856 AGCGGGGACAGAATAAGAAGGGG + Intronic
1086160224 11:83713769-83713791 AGCAGGTGCAGAATTACAGATGG - Intronic
1086931897 11:92702618-92702640 AGCCAGTCCAGGAAAAGAAAGGG - Intronic
1089112510 11:116068028-116068050 AGCCTGAGCAGACTAAGACAGGG - Intergenic
1091611084 12:2010327-2010349 AGCCAGAGCAGAATGAGAAGGGG + Intronic
1093130913 12:15390797-15390819 AGCCTGAGCAGACTAAGACAGGG - Intronic
1093697767 12:22181605-22181627 AGACAGTGCACAATAATAAATGG + Intronic
1097694570 12:62764024-62764046 AACCAGTGCAGACAAAGAAAAGG - Intronic
1097899659 12:64859840-64859862 ACCTGTTGCAGAATAAGCAATGG - Intronic
1098023592 12:66180040-66180062 AGCCTGAGCAGACTAAGATAGGG + Intergenic
1104328460 12:127822232-127822254 AGCAGGTGGAGAGTGAGAAATGG + Intergenic
1104414960 12:128590405-128590427 TGCAGGTGGAGAAAAAGAAAAGG + Intronic
1105282845 13:18979022-18979044 GGCCCTTGCAGAATAGGAAAGGG - Intergenic
1106850032 13:33780462-33780484 AGCAGGTCCAGTCTAAGAAAAGG - Intergenic
1109556760 13:63986504-63986526 AGAAGGAGCAGAATAAGGAATGG - Intergenic
1111736667 13:92149637-92149659 AGCCGCTGAAGAATAAGGGAAGG + Intronic
1113369712 13:109712530-109712552 AGCCGGCAGAGAAAAAGAAATGG + Intergenic
1115208410 14:30939468-30939490 AGCCAGTGAAGAAAAAGAAAAGG + Intronic
1115427530 14:33277745-33277767 TGCTGGAGCAGAATGAGAAAGGG + Intronic
1120285005 14:82488791-82488813 ATACAGTGCTGAATAAGAAATGG - Intergenic
1122967557 14:105138402-105138424 TGACGGTGCAGAATGAGAAGAGG + Intergenic
1123426339 15:20173556-20173578 AACCGCTGTAAAATAAGAAAAGG - Intergenic
1123535572 15:21180083-21180105 AACCGCTGTAAAATAAGAAAAGG - Intergenic
1128134287 15:65251187-65251209 AACCTGTGCAAAATAAGAGATGG - Intronic
1128285078 15:66429927-66429949 AGGAGGTACAGAATAAGAACGGG - Intronic
1129173229 15:73820807-73820829 AGGCAGTGCAGGATAACAAAGGG + Intergenic
1131801750 15:96076437-96076459 AGCCGCTACAGCTTAAGAAATGG + Intergenic
1132390002 15:101431646-101431668 TGCAGGTGCAGAAAAAGCAAGGG - Intronic
1136483817 16:30558354-30558376 AGCGGGTGTATAATCAGAAATGG + Intronic
1137268994 16:46890412-46890434 GGCTGGTGAAGAATAAGAAGGGG - Intronic
1137282760 16:46992396-46992418 AGCAGGTGCCGAAAAGGAAAGGG + Intergenic
1140188756 16:72796766-72796788 AGAAGGTGCAGAAAAAGAATGGG - Exonic
1140233421 16:73137250-73137272 ATCTGGTGCAGAAAAAGAAAGGG - Intronic
1140671253 16:77281405-77281427 AACCAGTGGAGAATAAGAACTGG - Intronic
1141009136 16:80380957-80380979 AGCCTGAGCAGACTAAGACAAGG + Intergenic
1141063743 16:80897771-80897793 TGCCTGTGCAGAATCAGAACAGG + Intergenic
1142305452 16:89281915-89281937 GGACGGTGCAGAGAAAGAAAAGG - Exonic
1144256846 17:13476772-13476794 AGCTGGGGCAGAATGAGGAATGG + Intergenic
1144341419 17:14313332-14313354 AGCAGCTGCAGAGTAAGTAAGGG - Intronic
1144349688 17:14383095-14383117 AGAAGGTGCAGAATATAAAAAGG - Intergenic
1147635766 17:41962938-41962960 AGCAGGTGCTGGATAATAAAGGG - Intronic
1150243824 17:63658609-63658631 AGCCTGTCAAGCATAAGAAAAGG - Intronic
1150999274 17:70354644-70354666 AGCTACTGCAGAGTAAGAAATGG + Intergenic
1151536882 17:74744239-74744261 AAACGGAGCAGAAGAAGAAAGGG + Intronic
1152200871 17:78945183-78945205 CGACTGTGCAGAATGAGAAATGG + Intergenic
1152603268 17:81276150-81276172 ACCTGTTGGAGAATAAGAAATGG + Exonic
1153110261 18:1578321-1578343 AGCAGATGCAGAAAAGGAAATGG - Intergenic
1155117751 18:22786276-22786298 AGCCTGGGAAGAATAAAAAAAGG + Intergenic
1157888793 18:51394685-51394707 AGCCTGAGCAGACTAAGACAGGG + Intergenic
1159022438 18:63154699-63154721 TGAGGGGGCAGAATAAGAAAAGG - Intronic
1159258593 18:65980710-65980732 AGCCTGAACAGAATAAGACAGGG + Intergenic
1161509767 19:4663827-4663849 AGCCTGTGCAGAATGAGGATGGG - Intronic
1161921302 19:7268202-7268224 GGCAGGTGCAGAAGGAGAAAGGG + Intronic
1164907345 19:31978111-31978133 ACCCTGTGGAGGATAAGAAATGG - Intergenic
1167589874 19:50398735-50398757 AGCCAGTCCAGAGTAGGAAAAGG + Intronic
1168148154 19:54430795-54430817 AGCCTCTGCAGAAAGAGAAAGGG - Exonic
1168567904 19:57440090-57440112 AGCCTGTGGAGTATAAGGAAGGG + Intronic
926875802 2:17477345-17477367 AGTCTGTCCAGAAGAAGAAAGGG + Intergenic
930820486 2:55641661-55641683 TGCAGGTGAAAAATAAGAAATGG - Intronic
931622022 2:64220142-64220164 AGCTGATGCAGAATTTGAAAAGG - Intergenic
932758252 2:74423463-74423485 AGCCTGTACTGAATATGAAAGGG - Exonic
933354845 2:81197634-81197656 GGACAGTGCAGAAAAAGAAAAGG - Intergenic
934464720 2:94250570-94250592 AACCTGTGCAGAACCAGAAACGG + Intergenic
934655457 2:96114904-96114926 AGCCGATCCAGAAGAAGAACTGG + Exonic
945058062 2:205885461-205885483 AGCCAGTGCAGGATAAGAGAGGG + Intergenic
946196386 2:218034944-218034966 AGCAGGTGCTGAAAACGAAAAGG + Intronic
946200644 2:218068998-218069020 AGCAGGTGCTGAAAACGAAAAGG + Intronic
1169748176 20:8964166-8964188 AGCCTGTGTGGAATAAGGAAGGG + Intronic
1171110809 20:22480578-22480600 GTCGAGTGCAGAATAAGAAAGGG + Intergenic
1173194476 20:40903061-40903083 AGTCTGTGGAGAATAATAAAAGG + Intergenic
1175694165 20:61088822-61088844 AGGAGCTGCAGAAGAAGAAATGG + Intergenic
1177030148 21:15972721-15972743 AGCCTCTGCAGAATCAGATAAGG - Intergenic
1177264043 21:18761140-18761162 AGCAGTCTCAGAATAAGAAAAGG - Intergenic
1177309645 21:19373306-19373328 AGCCAGTGCAGAATAAATATTGG + Intergenic
1178369877 21:32018484-32018506 AGCCCAAGCAGAATAAGACAGGG - Intronic
1178793817 21:35724473-35724495 AGCCAGAGCAGACTAAGACAGGG - Intronic
1179400379 21:41077315-41077337 AGCCGAAGCAGAATAATACAGGG - Intergenic
1181260019 22:21591018-21591040 AGCCTGGGCAGACTCAGAAAGGG - Intronic
1183427770 22:37748683-37748705 AGCCTGTGAAGGATAAGTAAAGG + Intronic
1184326488 22:43791449-43791471 AGTAGGTGCAAAAAAAGAAAAGG + Intronic
951051953 3:18103787-18103809 AGCAGCTGAAGAATAAGAAATGG - Intronic
952310297 3:32182585-32182607 AGACGGGGCAGAGAAAGAAAAGG - Intergenic
957224188 3:77422216-77422238 AGTTGGTGTAGAATAAGACAGGG + Intronic
961206100 3:125083105-125083127 AGCAGGTGGAGAATAAGGATTGG + Exonic
962724223 3:138206423-138206445 AGCTGGAGCAGAATGAGCAAAGG - Intronic
962975617 3:140443268-140443290 AAACGATGCAGAATAATAAAAGG - Intronic
966505245 3:180693230-180693252 AGCTAGTGCAGCATAAGACACGG - Intronic
968698986 4:2045947-2045969 AGCAGGTCCAGGAAAAGAAAAGG - Intergenic
969093705 4:4716727-4716749 AGCCAGTCCAGAGAAAGAAAAGG - Intergenic
973700345 4:53531309-53531331 AGCTGGTGCAGGAAAAGAACAGG - Intronic
975701217 4:77068546-77068568 AACCTCTGCAGAGTAAGAAAAGG + Intronic
980630205 4:135421551-135421573 AAAGGGTGTAGAATAAGAAAAGG + Intergenic
981837885 4:149076646-149076668 AGCTGAAGCAGAATAAGAGATGG - Intergenic
983045211 4:162978933-162978955 AGCAGGTGCAAATTATGAAAGGG - Intergenic
985932865 5:3072847-3072869 AGGGGGTGTAGAATAAGCAAAGG - Intergenic
986162431 5:5242035-5242057 AGCAGCTACAAAATAAGAAAGGG - Exonic
986760379 5:10874947-10874969 AGCTGGTGCATGATAAGAAGAGG - Intergenic
986951366 5:13089200-13089222 AGCCAGGAAAGAATAAGAAATGG - Intergenic
989641580 5:43588276-43588298 AGCCGCAGCAGCAGAAGAAAAGG - Intergenic
990349545 5:54901851-54901873 ATCAGGTGCAGAACAACAAAAGG + Intergenic
991290087 5:65025230-65025252 GGCTGGTGCAGAATAAGTGATGG - Intergenic
991964162 5:72074390-72074412 AGAAGGTGCTGAATAAGCAAGGG - Intergenic
992216499 5:74529469-74529491 AGTCGGTGCAATATAAGGAAGGG + Intergenic
996292611 5:121870873-121870895 AGCAGATGCACAATGAGAAAAGG - Intergenic
1000316941 5:160101502-160101524 AGCAGGTGGAGAAGCAGAAATGG + Intronic
1001324514 5:170712250-170712272 ACCAGATGCAGAAAAAGAAAAGG - Intronic
1001742325 5:174064260-174064282 AGCCGGAACAGAAGAACAAAGGG + Exonic
1002773172 6:306811-306833 AGCAGGTGCAGAACAGGAAGGGG + Intronic
1006166981 6:32070905-32070927 AGCCGGTGCAGAATAAGAAAGGG - Intronic
1007407243 6:41642162-41642184 ACCCGGTGCAGATTAGAAAAAGG + Intronic
1010139484 6:72597867-72597889 AGCAGCTGCACAAAAAGAAATGG + Intergenic
1010314861 6:74436235-74436257 AGCCTGAGCTGAATAAGACATGG - Intergenic
1012328935 6:97960085-97960107 AGCTGGGGCAGAGTAAGCAATGG + Intergenic
1015316387 6:131821603-131821625 AGCCAGTGCAGAGTAAAAGAAGG - Intronic
1018380152 6:163251778-163251800 AGCCTTTGGAAAATAAGAAATGG + Intronic
1018541197 6:164881748-164881770 AGCAGGTACAGAAGAAAAAAAGG - Intergenic
1018649321 6:165978923-165978945 TGCCAGAGAAGAATAAGAAAAGG + Intronic
1021325076 7:19256718-19256740 AGCAGCTGGAGAATAAAAAAAGG - Intergenic
1021656533 7:22879629-22879651 AGTCGGAGAGGAATAAGAAAGGG + Intergenic
1023250099 7:38249832-38249854 AGCATGTGCAGAATAAACAAAGG - Intergenic
1023251404 7:38265938-38265960 AGCATGTGCAGAATAAACAAAGG - Intergenic
1029878803 7:103783424-103783446 AGCCATTGCAAAATAAGCAAAGG + Intronic
1029880539 7:103804593-103804615 AGCCAGTGCAGAATCAGATTTGG - Intronic
1030484905 7:110153024-110153046 AACCAATGCAGAAGAAGAAAAGG + Intergenic
1030824017 7:114132796-114132818 AGCTGGTATAGAATAAGCAAGGG + Intronic
1030847327 7:114435960-114435982 AGGCTGTGAAGAAAAAGAAAAGG + Intronic
1034728222 7:153360369-153360391 TACTGGTGCAGAAAAAGAAACGG + Intergenic
1036692115 8:10950563-10950585 AGCAGGTGCAAATGAAGAAAGGG + Intronic
1037285675 8:17296458-17296480 GGCCAGTGCAGTATAAGGAAAGG - Exonic
1038357528 8:26843275-26843297 AGCAAGTGCAGGATAAGAACTGG + Intronic
1041278663 8:56189812-56189834 AGTCGGGGGAGAAGAAGAAAAGG + Intronic
1042218837 8:66453461-66453483 AGGCTGTGCACAATCAGAAAGGG + Intronic
1046108008 8:109690479-109690501 AGCCTGTGCAGCAGAAGCAAAGG - Intronic
1047561223 8:125989701-125989723 AGCCTCTGCAGAAACAGAAAGGG - Intergenic
1048881105 8:138873208-138873230 GGCTGGTGCAGATTTAGAAAAGG - Intronic
1052768563 9:32666742-32666764 AGCATGTGCAGAATAAAAACAGG + Intergenic
1056303381 9:85265420-85265442 AGCCAGAGCAGACTAAGACAGGG + Intergenic
1057269320 9:93639771-93639793 AGCTGGGGCAGAATGAGAAGTGG + Intronic
1188979705 X:36716042-36716064 AGCAGTTGCAGTATAGGAAAGGG + Intergenic
1192449356 X:71233833-71233855 AGCTGGAGCAGAAACAGAAAGGG - Intergenic
1192978261 X:76309948-76309970 AGCGGGTGCAGGATAGGAAGAGG - Intergenic
1194315951 X:92378536-92378558 AGCCTGAGCAGATTAAGACATGG - Intronic
1194607031 X:95993302-95993324 AGCCAGTGATGAATCAGAAAAGG + Intergenic
1195260181 X:103124212-103124234 AGAGAGTGCAGATTAAGAAAAGG - Intergenic
1195706806 X:107743160-107743182 AGCCAGTTCCGAAGAAGAAAAGG + Intronic
1198762724 X:140050291-140050313 AGCCAGAGTAGCATAAGAAAGGG + Intergenic
1200624002 Y:5490110-5490132 AGCCTGAGCAGATTAAGACATGG - Intronic