ID: 1006166982

View in Genome Browser
Species Human (GRCh38)
Location 6:32070906-32070928
Sequence CAGCCGGTGCAGAATAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006166982_1006166997 24 Left 1006166982 6:32070906-32070928 CCTTTCTTATTCTGCACCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1006166997 6:32070953-32070975 TGGGCCTGGTGAAGGAGCGTGGG No data
1006166982_1006166992 10 Left 1006166982 6:32070906-32070928 CCTTTCTTATTCTGCACCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1006166992 6:32070939-32070961 ACTAAGGCTCCCACTGGGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 170
1006166982_1006166991 5 Left 1006166982 6:32070906-32070928 CCTTTCTTATTCTGCACCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1006166991 6:32070934-32070956 GGAGAACTAAGGCTCCCACTGGG No data
1006166982_1006166990 4 Left 1006166982 6:32070906-32070928 CCTTTCTTATTCTGCACCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data
1006166982_1006166996 23 Left 1006166982 6:32070906-32070928 CCTTTCTTATTCTGCACCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1006166996 6:32070952-32070974 CTGGGCCTGGTGAAGGAGCGTGG 0: 1
1: 0
2: 1
3: 30
4: 412
1006166982_1006166987 -6 Left 1006166982 6:32070906-32070928 CCTTTCTTATTCTGCACCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1006166987 6:32070923-32070945 CGGCTGGCCCGGGAGAACTAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1006166982_1006166993 16 Left 1006166982 6:32070906-32070928 CCTTTCTTATTCTGCACCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1006166993 6:32070945-32070967 GCTCCCACTGGGCCTGGTGAAGG 0: 1
1: 0
2: 0
3: 28
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006166982 Original CRISPR CAGCCGGTGCAGAATAAGAA AGG (reversed) Intronic
902082118 1:13828359-13828381 CAGCAGGTGTTGAATCAGAATGG + Intergenic
902392967 1:16116769-16116791 CAGCCTGTGGAGAGTCAGAAAGG - Intergenic
908699623 1:66884451-66884473 CATCAGATGCAGAAAAAGAAGGG - Intronic
909872793 1:80764359-80764381 CAGCAGGAGCAGAATAGAAAAGG - Intergenic
919845108 1:201637240-201637262 CAGCTGGTTCAGACTAAGATGGG + Intronic
920873676 1:209815108-209815130 CAGCTGCTGCAGAATAGAAATGG + Intergenic
1066587560 10:36953209-36953231 CAGACAATGAAGAATAAGAATGG + Intergenic
1071524808 10:86352349-86352371 CAGCCAGAGCAGACTAAGACAGG - Intronic
1074897768 10:117791900-117791922 CAGCTGACCCAGAATAAGAAAGG + Intergenic
1076191755 10:128488069-128488091 CAGCCCGAGCAGACTAAGACAGG - Intergenic
1076637086 10:131888842-131888864 CAGCCTGGGCAGCATAAGAAAGG - Intergenic
1083893345 11:65607833-65607855 CAGCGGGGACAGAATAAGAAGGG + Intronic
1085900547 11:80694750-80694772 CAGACAATGAAGAATAAGAATGG - Intergenic
1089019005 11:115192306-115192328 CAGCAGGTGCTGATTAAAAATGG + Intronic
1089112511 11:116068029-116068051 CAGCCTGAGCAGACTAAGACAGG - Intergenic
1089793583 11:120962339-120962361 CAGCGGGTGGAGAAGCAGAAGGG + Intronic
1089904535 11:122024840-122024862 CAGCCAGTGGAGAATATGAGAGG + Intergenic
1089984015 11:122796139-122796161 CAGCGGCTGCAGAGAAAGAAAGG - Exonic
1091611083 12:2010326-2010348 GAGCCAGAGCAGAATGAGAAGGG + Intronic
1095174303 12:39073339-39073361 CAGTTGGTGCAGAATAAGGAAGG - Intergenic
1098023591 12:66180039-66180061 CAGCCTGAGCAGACTAAGATAGG + Intergenic
1098245203 12:68509922-68509944 CTGCAGGTGCAGGAGAAGAAGGG + Intergenic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1104462039 12:128963912-128963934 CAGCCGGAACAGACTAAGACAGG - Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1111724242 13:91984213-91984235 CTGCCAGTGCAGAATAATAATGG - Intronic
1112505363 13:99971512-99971534 CAGCCGCTTCAGAATATGACAGG - Exonic
1119602294 14:75984371-75984393 CATCTGGTGCCGAAGAAGAAGGG + Intronic
1123401848 15:19995125-19995147 CATCCAGTGCAAAAGAAGAAAGG - Intergenic
1123511188 15:21001788-21001810 CATCCAGTGCAAAAGAAGAAAGG - Intergenic
1128285079 15:66429928-66429950 GAGGAGGTACAGAATAAGAACGG - Intronic
1132177962 15:99730583-99730605 CAGCAGTTGCTGAATAATAATGG - Intronic
1137268995 16:46890413-46890435 AGGCTGGTGAAGAATAAGAAGGG - Intronic
1139601484 16:67990121-67990143 CCGCCCCTGCAGAAGAAGAACGG - Exonic
1139686587 16:68608756-68608778 CATGAGCTGCAGAATAAGAATGG + Intergenic
1140188757 16:72796767-72796789 CAGAAGGTGCAGAAAAAGAATGG - Exonic
1140233422 16:73137251-73137273 AATCTGGTGCAGAAAAAGAAAGG - Intronic
1141940162 16:87270613-87270635 AAGCCTGTGCACAAGAAGAATGG + Intronic
1142050737 16:87956589-87956611 CAGCCCCTGCAGGAGAAGAATGG + Intronic
1151321417 17:73354791-73354813 CAGAGGGTGCAGAAGCAGAACGG - Intronic
1151536881 17:74744238-74744260 CAAACGGAGCAGAAGAAGAAAGG + Intronic
1157888792 18:51394684-51394706 CAGCCTGAGCAGACTAAGACAGG + Intergenic
1158110969 18:53941178-53941200 CAGCTGGTGCTGGAGAAGAATGG + Intergenic
1159381782 18:67669155-67669177 CAGCCTGAGCAGAATAATACAGG + Intergenic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1161778932 19:6279048-6279070 CAGCCGGGGCAGGATCAGACGGG + Intronic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1168148155 19:54430796-54430818 CAGCCTCTGCAGAAAGAGAAAGG - Exonic
1168567903 19:57440089-57440111 CAGCCTGTGGAGTATAAGGAAGG + Intronic
926312842 2:11686849-11686871 CAGCTGGGGCAGAAGAGGAAAGG - Intronic
932758253 2:74423464-74423486 CAGCCTGTACTGAATATGAAAGG - Exonic
935717582 2:105952700-105952722 CGGGAGGTGCAGATTAAGAATGG + Intergenic
944403748 2:199358851-199358873 CAGAGGGTGGAGACTAAGAAAGG - Intronic
944426205 2:199585890-199585912 CAGCAGGTTCTGAATAATAATGG - Intergenic
945058061 2:205885460-205885482 TAGCCAGTGCAGGATAAGAGAGG + Intergenic
947035378 2:225847864-225847886 CAAGAGGAGCAGAATAAGAATGG - Intergenic
948648486 2:239424318-239424340 CAGCCTGTGCAGACTGAGACAGG + Intergenic
949003655 2:241633045-241633067 GAGCAGGTGGAGAAGAAGAACGG - Exonic
1169748175 20:8964165-8964187 CAGCCTGTGTGGAATAAGGAAGG + Intronic
1178369878 21:32018485-32018507 CAGCCCAAGCAGAATAAGACAGG - Intronic
1178793818 21:35724474-35724496 CAGCCAGAGCAGACTAAGACAGG - Intronic
1179400380 21:41077316-41077338 CAGCCGAAGCAGAATAATACAGG - Intergenic
1181421566 22:22802920-22802942 CAACCTGTGGAGAATATGAAGGG - Intronic
1182056259 22:27357650-27357672 CAGCCTGAGCAGAATAAGACAGG + Intergenic
1182238028 22:28892107-28892129 GAGCCTGTGCAAAGTAAGAAAGG - Intronic
952312811 3:32205692-32205714 CAGCCTGTGCAAAAGAAAAAAGG - Intergenic
954047397 3:47944350-47944372 CAGACTGTGGAGAATGAGAAAGG - Intronic
962298377 3:134214583-134214605 CAGCAGGAGTAGAGTAAGAAGGG - Intronic
969636355 4:8371634-8371656 CAGTCAGTACAGAGTAAGAAAGG + Intronic
973760063 4:54107552-54107574 CAGCAGGTGCAGAGAAAAAAAGG + Intronic
977067403 4:92335197-92335219 CACCCTTTGCAGAATAAGAGTGG + Intronic
977143408 4:93404649-93404671 CAGTCTGTGCATAAGAAGAATGG - Intronic
979129961 4:117031309-117031331 CAGCACATGCAGTATAAGAATGG - Intergenic
980420083 4:132547491-132547513 CAGAAGGTGGAGAAAAAGAAGGG - Intergenic
983045212 4:162978934-162978956 CAGCAGGTGCAAATTATGAAAGG - Intergenic
986162432 5:5242036-5242058 CAGCAGCTACAAAATAAGAAAGG - Exonic
988133721 5:27140618-27140640 CAGAAGGTGAAGAATAAGCAAGG + Intergenic
988655634 5:33208599-33208621 CATGGGCTGCAGAATAAGAATGG - Intergenic
992379545 5:76223753-76223775 CAGCCTGAGCAGATTAAGACAGG - Intronic
998957609 5:147453621-147453643 GAGCCGGAGCAGAAGAAGGAGGG - Intronic
1000463212 5:161547331-161547353 AGGCGGGTACAGAATAAGAAAGG + Intronic
1000664953 5:163983614-163983636 CAGTACGTGCAGAATGAGAAGGG + Intergenic
1001742324 5:174064259-174064281 CAGCCGGAACAGAAGAACAAAGG + Exonic
1002199836 5:177521509-177521531 CAGCTGAAGCAGTATAAGAAGGG - Intronic
1002773171 6:306810-306832 CAGCAGGTGCAGAACAGGAAGGG + Intronic
1004341236 6:14809339-14809361 CAACCGGTGAATAATGAGAATGG + Intergenic
1006166982 6:32070906-32070928 CAGCCGGTGCAGAATAAGAAAGG - Intronic
1007863636 6:44942508-44942530 CAGTAGGTGCGGAATGAGAAAGG + Intronic
1009899974 6:69798286-69798308 CTGCCTGGACAGAATAAGAAGGG + Intergenic
1010015851 6:71104446-71104468 CAGCCTGAGCAGACTAAGACAGG + Intergenic
1013275029 6:108576459-108576481 CAACCTGTGCTGAATAAGCAAGG + Intronic
1014466231 6:121760326-121760348 CAGCCGGTGCAGCCTACGGAGGG + Intergenic
1018256368 6:161923794-161923816 CAGCTGGTGCAGATTCTGAATGG + Intronic
1019923750 7:4179287-4179309 CCGCTGGTGCAGATTTAGAAGGG + Intronic
1020193398 7:6017872-6017894 CAGCCTGTGCAGCACAAGCAGGG - Exonic
1021918759 7:25462374-25462396 CAGCGGGTGCTGAAAAATAAAGG - Intergenic
1021947241 7:25740205-25740227 CAGAGGGTGAAGAATAATAATGG - Intergenic
1030824016 7:114132795-114132817 CAGCTGGTATAGAATAAGCAAGG + Intronic
1034562383 7:151889459-151889481 CAGCCTCTGCAGAAGAAGTAGGG + Intergenic
1035644352 8:1206783-1206805 CTGCAGGTGCAGACAAAGAATGG - Intergenic
1035762640 8:2080889-2080911 CAGCCCGTGCAGAATGAGGTTGG + Intronic
1036692114 8:10950562-10950584 CAGCAGGTGCAAATGAAGAAAGG + Intronic
1038348616 8:26755752-26755774 CAGGGGGTGGAGAATAACAAGGG - Intronic
1039956847 8:42214399-42214421 CACCAGGTCCAGAAGAAGAAGGG - Intergenic
1043331905 8:79127425-79127447 CAGCCAGTGCAAAATTAGAAAGG - Intergenic
1048653253 8:136504875-136504897 CAGCAGGTGAACAAAAAGAAAGG + Intergenic
1050213044 9:3286358-3286380 TAGCCAGTGAAAAATAAGAAGGG - Intronic
1051306330 9:15714106-15714128 CAGCCGCTGCAGAATACAGATGG - Intronic
1051557574 9:18402212-18402234 CAGCTGGTGTAGAAGAGGAATGG - Intergenic
1056303380 9:85265419-85265441 CAGCCAGAGCAGACTAAGACAGG + Intergenic
1062164027 9:135096665-135096687 CAGCAGCTGCAGAATGACAAGGG - Intronic
1185700367 X:2226953-2226975 GAGCTGCTGCAGAATAAGAAGGG + Intronic
1188979704 X:36716041-36716063 CAGCAGTTGCAGTATAGGAAAGG + Intergenic
1196721107 X:118854650-118854672 CAGCAGGTCCAGCATAAGATAGG - Intergenic