ID: 1006166990

View in Genome Browser
Species Human (GRCh38)
Location 6:32070933-32070955
Sequence GGGAGAACTAAGGCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006166982_1006166990 4 Left 1006166982 6:32070906-32070928 CCTTTCTTATTCTGCACCGGCTG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data
1006166978_1006166990 16 Left 1006166978 6:32070894-32070916 CCTTCTCCGTTCCCTTTCTTATT 0: 1
1: 0
2: 4
3: 80
4: 704
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data
1006166977_1006166990 17 Left 1006166977 6:32070893-32070915 CCCTTCTCCGTTCCCTTTCTTAT 0: 1
1: 0
2: 4
3: 95
4: 799
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data
1006166979_1006166990 10 Left 1006166979 6:32070900-32070922 CCGTTCCCTTTCTTATTCTGCAC 0: 1
1: 0
2: 5
3: 48
4: 554
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data
1006166981_1006166990 5 Left 1006166981 6:32070905-32070927 CCCTTTCTTATTCTGCACCGGCT 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1006166990 6:32070933-32070955 GGGAGAACTAAGGCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006166990 Original CRISPR GGGAGAACTAAGGCTCCCAC TGG Intronic
No off target data available for this crispr