ID: 1006171666

View in Genome Browser
Species Human (GRCh38)
Location 6:32096759-32096781
Sequence GTGTGCTGGCCCGGGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006171666_1006171674 21 Left 1006171666 6:32096759-32096781 CCTGTGTACCCGGGCCAGCACAC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 1006171674 6:32096803-32096825 CCCGCCCTCGCCACAGTCCCAGG 0: 1
1: 0
2: 0
3: 45
4: 544
1006171666_1006171676 22 Left 1006171666 6:32096759-32096781 CCTGTGTACCCGGGCCAGCACAC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 1006171676 6:32096804-32096826 CCGCCCTCGCCACAGTCCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 192
1006171666_1006171677 23 Left 1006171666 6:32096759-32096781 CCTGTGTACCCGGGCCAGCACAC 0: 1
1: 1
2: 0
3: 6
4: 88
Right 1006171677 6:32096805-32096827 CGCCCTCGCCACAGTCCCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006171666 Original CRISPR GTGTGCTGGCCCGGGTACAC AGG (reversed) Intronic
902132395 1:14274043-14274065 GTGTCCTAGCACGGGTACCCTGG - Intergenic
904158026 1:28501100-28501122 GTGTCCTGGGCCGGGTGCAGTGG - Intergenic
915733676 1:158071372-158071394 GTGTGCGTGCCCTGGCACACAGG + Intronic
918178904 1:182069231-182069253 ATGCGCTGGCCAGGGTACAAGGG + Intergenic
921231615 1:213078687-213078709 ATGTTCTGGCCCGGGCACAGTGG - Intronic
921704047 1:218299859-218299881 GTGTACTTTCCTGGGTACACTGG + Intronic
923098193 1:230792310-230792332 ATGGGCTGGCCTGGGTGCACAGG - Intronic
1064194117 10:13231588-13231610 GTTTGCTGTCCTGAGTACACAGG - Intronic
1070776522 10:79113063-79113085 CTGTCCTTGCCCTGGTACACAGG - Intronic
1075556204 10:123434414-123434436 GTGTGCTGGGCTGGGGACTCAGG + Intergenic
1080845179 11:36020742-36020764 GTGGGCTGGCCAGGATACCCAGG + Intronic
1081914241 11:46720526-46720548 GTGTTCTGGGCCAAGTACACAGG + Exonic
1091795699 12:3296442-3296464 GTGTGCTTGCTCCCGTACACAGG - Intergenic
1100535736 12:95507053-95507075 GTATTCTGGGCCGGGTACAGTGG - Intronic
1104543987 12:129694719-129694741 GTGTTCTGGGCCGGGCACAGTGG + Intronic
1104672310 12:130689159-130689181 GTGTCCTGGGCCGGGCACAGTGG + Intronic
1105249624 13:18686149-18686171 GTGTGATGGGCCAGGTAGACAGG + Intergenic
1113104803 13:106760371-106760393 GTGTGCTGACCTGGACACACAGG + Intergenic
1119772739 14:77231041-77231063 ATATGCTGGCCCAGTTACACTGG - Intronic
1122985582 14:105210159-105210181 GTGTGCTGGCCCTGTGACTCAGG - Exonic
1123062658 14:105601281-105601303 GCGTCCTGGCCCGGGTCCCCAGG + Intergenic
1127286914 15:57540670-57540692 GTGTGCTGGGGTGGGTGCACTGG - Intronic
1132379447 15:101356371-101356393 GTGTGCTGGGCTGGGTGCAGTGG + Intronic
1145743393 17:27294538-27294560 GTGGGCTGGCCCTGGCGCACTGG - Intronic
1146932976 17:36791232-36791254 CTGTGCTGGCACGGGACCACAGG - Intergenic
1152667739 17:81580972-81580994 GTGGGCTGGCCCAGGGCCACTGG - Intronic
1153098773 18:1440188-1440210 GTATGCTGGGCCAGGTACAGTGG + Intergenic
1154131041 18:11737626-11737648 GTGGGGTGGCCCTGGCACACTGG - Intronic
1163114549 19:15181088-15181110 CTGTGCCGTCCCGGCTACACAGG - Exonic
1163168530 19:15514545-15514567 GTGTGGTGGCCCAGCTACTCGGG + Intronic
1164984261 19:32637033-32637055 GTGTGCTGGGCCGGGCACGGTGG - Intronic
1167526701 19:49988771-49988793 GTGAGCTGGGCCTGGCACACGGG - Intronic
1167610956 19:50507529-50507551 ATGTGCTGGGCCGGGCACAGAGG - Intronic
926488060 2:13487961-13487983 GTATGCTGACTCAGGTACACTGG + Intergenic
930187010 2:48420503-48420525 GTGAGCTGGCCCGTGTGGACAGG - Intergenic
935302544 2:101705379-101705401 GTGTGCTGGGCAGGGAACCCAGG - Intronic
937371674 2:121302289-121302311 GTGTGGTGGCCCAGCTACTCAGG + Intergenic
937932606 2:127218813-127218835 GCGTGCTGGGCCGGGCACCCGGG + Intronic
943356747 2:186865771-186865793 CTGTGCTGGGCTGGGTAGACAGG + Intergenic
948917157 2:241040149-241040171 GTGTGCCAGGCCGGATACACCGG + Exonic
1175366540 20:58460077-58460099 GCATGCTGGCCCGGGAAAACTGG + Exonic
1175962137 20:62642572-62642594 GGGAGCTGGCGCGGGTGCACAGG + Intronic
1179035141 21:37753028-37753050 GTGGGCTGGGCAGGGAACACAGG + Intronic
1180715117 22:17866295-17866317 GTTTGCTGGCCCTGCCACACAGG - Intronic
1180840983 22:18958749-18958771 GTGTGCTGGCCAGGGTCATCAGG + Intergenic
1181314419 22:21962322-21962344 GGGTGCTGGGCTGGGCACACAGG + Intronic
1181468422 22:23123228-23123250 GTGTTCTGGCCCTTGTACTCGGG - Exonic
1182126736 22:27821352-27821374 GTCTGCTGGCCCGGGCAGGCTGG - Intergenic
1183349083 22:37324782-37324804 CTGTTCTGGCCCGGGTGCCCGGG - Intergenic
1184372142 22:44089441-44089463 GTGTGCTGGCCCGGGTGTGCTGG - Intronic
1184647540 22:45904247-45904269 GGGAGCTGGCCTGGGAACACTGG - Intergenic
1185250517 22:49799356-49799378 GGGGGCTGGCCCCGGTGCACAGG + Intronic
1185345979 22:50310979-50311001 GGGTGCTGGCCAGGGGACACAGG - Exonic
953730272 3:45441310-45441332 GTGTGATGGGCCGGGTGCAATGG - Intronic
959814379 3:110658232-110658254 GTGTGATGGCCAGGGTATGCTGG + Intergenic
960974201 3:123159407-123159429 GTCTGCTGGCCTGGGTGAACTGG + Intronic
966609408 3:181853305-181853327 GTGTGCTGGGCCAGGTACGGTGG - Intergenic
968602008 4:1513864-1513886 GTGTGCTGGCCCATGTTCCCTGG - Intergenic
968910618 4:3475476-3475498 GTGTGCTGACCTGGGAAGACAGG + Intronic
969245076 4:5926660-5926682 GTCTGTGGGCCCGGGGACACAGG - Intronic
972718766 4:41675301-41675323 GTGGGCTGGCCCAGGTACCCTGG + Intronic
974149338 4:57985999-57986021 GTGTGCTGGCCCTGAAACAGTGG - Intergenic
975743882 4:77456827-77456849 GAGTTCTGGCCCTGCTACACAGG + Intergenic
984884989 4:184442098-184442120 CTGAGCTGGCCCGGGTGCACAGG + Intronic
991492208 5:67194528-67194550 GTTTGGTGGGCAGGGTACACGGG - Intronic
997988856 5:138527122-138527144 GTTTTCTGGGCCGGGTACAGTGG - Intronic
999107608 5:149087350-149087372 GTGTGGTGGGCCGGGCACAGTGG + Intergenic
1002549267 5:179974885-179974907 GCGTGCTGACCCGGGTGCGCAGG - Intronic
1003840377 6:10113376-10113398 GTGGGCTGGCTCGGGTGCGCAGG + Intronic
1003905344 6:10694374-10694396 GGGTTCTGGCCCGGGCAGACGGG + Intronic
1004679679 6:17880891-17880913 GTCTGCTGGGCCAGGTACAGTGG - Intronic
1006171596 6:32096387-32096409 ATGTGTTGGCCGGGGTACACAGG - Intronic
1006171628 6:32096573-32096595 GTGTGCTGGCCGGGGTACACTGG - Intronic
1006171666 6:32096759-32096781 GTGTGCTGGCCCGGGTACACAGG - Intronic
1006171770 6:32097224-32097246 GTGTGCTTTCCCGGCTACACTGG - Intronic
1008424203 6:51337817-51337839 GTGTGCTGTCCCAGATACAAAGG + Intergenic
1012457964 6:99428049-99428071 GTGTGGTGGCCCAGCTACTCAGG + Intergenic
1017972452 6:159325123-159325145 CTGTGCTGGCCCGGGCTCAGAGG - Intergenic
1020134482 7:5579386-5579408 GTGTGTGGGCACGGGGACACTGG - Intergenic
1024123347 7:46267197-46267219 GTGTACATGCCCGAGTACACAGG - Intergenic
1024631895 7:51255957-51255979 AGGTGCTGGCCCGGGTCCCCAGG - Intronic
1026600993 7:71777057-71777079 GTGTTCTGGGCCGGGTACGGCGG + Intergenic
1031123433 7:117747032-117747054 GTGTGCTGGGCAGGGTGCAGGGG - Intronic
1036788082 8:11701346-11701368 CTGGGCTGGCCTGGGTAGACAGG - Intronic
1037606662 8:20443668-20443690 GTGTGATGGCCAGTGCACACAGG + Intergenic
1043360890 8:79470726-79470748 GCGTGCTGGCTTGGGTAAACTGG - Intergenic
1047434796 8:124827296-124827318 GTGGGCTGGGCCGGGCACAGTGG + Intergenic
1048196797 8:132338116-132338138 GTGTGCTGGGCAGAGTATACTGG + Intronic
1049104448 8:140603195-140603217 GTCTGCTGAGCCGGGTCCACAGG - Intronic
1054988450 9:71291272-71291294 TTATGCTGGCTCAGGTACACTGG - Intronic
1056655079 9:88502590-88502612 GTGTGCTGGCACGGCTATCCAGG - Intergenic
1062675232 9:137739229-137739251 GCGTGGTGGCCCAGGTACTCAGG + Intronic
1185485312 X:477562-477584 GTTTGCTGGCTCGGGCAGACGGG - Intergenic
1196502844 X:116405567-116405589 GTGTACTTGCCCAGGGACACAGG + Intergenic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1200129141 X:153831455-153831477 GTGTGCAGGCCCGGGTCCCAAGG - Intergenic