ID: 1006172934

View in Genome Browser
Species Human (GRCh38)
Location 6:32105662-32105684
Sequence TTGGTTAGACACAGCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006172930_1006172934 3 Left 1006172930 6:32105636-32105658 CCACGGACAGTGTCTGGGACTGG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006172934 6:32105662-32105684 TTGGTTAGACACAGCCACCAGGG 0: 1
1: 0
2: 1
3: 6
4: 112
1006172926_1006172934 21 Left 1006172926 6:32105618-32105640 CCAAGGTCAGGGCTAGGACCACG 0: 1
1: 0
2: 0
3: 17
4: 132
Right 1006172934 6:32105662-32105684 TTGGTTAGACACAGCCACCAGGG 0: 1
1: 0
2: 1
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006172934 Original CRISPR TTGGTTAGACACAGCCACCA GGG Intronic
900374213 1:2346051-2346073 TTCCTCAGACAAAGCCACCAGGG + Intronic
900374224 1:2346104-2346126 TTCCTCAGACAAAGCCACCAGGG + Intronic
900374235 1:2346157-2346179 TTCCTCAGACAAAGCCACCAGGG + Intronic
900374241 1:2346184-2346206 TTCCTCAGACAAAGCCACCAGGG + Intronic
901176388 1:7302479-7302501 TTGGTTAATGACAGCCACCGTGG - Intronic
901949049 1:12726774-12726796 CTGGTTAGACTCAGCCTTCATGG - Exonic
903340176 1:22648958-22648980 GTGGTTGGATCCAGCCACCATGG + Intergenic
905119056 1:35667711-35667733 TTGGTTGGAAACAGCCAGCCAGG + Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906541874 1:46592984-46593006 AGGGTGACACACAGCCACCAGGG + Intronic
917294328 1:173503312-173503334 TTGGTTAGCCTCAGTCAACACGG - Exonic
920863663 1:209733053-209733075 GTGGTGAGACTCAGCCACCTTGG - Intronic
921611549 1:217217980-217218002 TTGGTTATAGACATCCAACATGG - Intergenic
922350080 1:224728143-224728165 ATGTTTAGAGACAGCCACCGTGG - Intronic
1063123607 10:3122185-3122207 TTGGCCAGGCACAGCCACCTTGG + Intronic
1075655592 10:124158991-124159013 GTGGTTAAACCCAGCTACCAGGG - Intergenic
1076526396 10:131115111-131115133 TTGGTAAGACACTGCCGCCAGGG + Intronic
1079033123 11:17000415-17000437 CTGGTTGGACACAGCCACACAGG + Intronic
1081734847 11:45395430-45395452 TGTGTTAGACACAGCCACCAGGG - Intergenic
1083189930 11:61042515-61042537 TCGGTTAGACACACCCACAGCGG + Intergenic
1084486202 11:69449750-69449772 TTGGGCAGACACAGCCTCCCAGG - Intergenic
1085829778 11:79887067-79887089 TAGCTTAGAGACAGCCAGCAAGG + Intergenic
1088162589 11:106890674-106890696 TTGATTACACACAACCACCTCGG + Intronic
1088445558 11:109923525-109923547 TGGGTTAGATACGGCCAGCATGG - Intergenic
1089282509 11:117384406-117384428 CTGGCTAACCACAGCCACCAAGG - Intronic
1091030825 11:132186303-132186325 GTTGGGAGACACAGCCACCAAGG + Intronic
1091435916 12:472868-472890 TTGGCTAGACACAGTCACAGTGG - Intronic
1091858055 12:3754912-3754934 GTGGTTAGACTCAGACACAAGGG - Intronic
1092247112 12:6869823-6869845 TTGGACAGACACAGCCCACATGG + Intronic
1093374206 12:18404381-18404403 TTGTTTAGAGACAGTCACTATGG - Intronic
1094366545 12:29688912-29688934 TTGGTCACACAGGGCCACCAGGG - Intronic
1096801994 12:54116562-54116584 GTGGTTAGACACAGACACTGGGG + Intergenic
1097278657 12:57830600-57830622 TTGGTAAAACACAGATACCATGG + Intronic
1106240597 13:27909585-27909607 TTTGTTAGACTCTGCCAACATGG - Intergenic
1113025186 13:105933025-105933047 TTGGTGAGACACAAACTCCAAGG - Intergenic
1121245460 14:92458483-92458505 TTGGGTCAACTCAGCCACCAGGG + Intronic
1121511146 14:94514436-94514458 TAGGTGAGTCACAGCCACCAGGG - Intronic
1123170989 14:106372706-106372728 TTTGTTACACACACACACCAGGG + Intergenic
1127631471 15:60831752-60831774 TTGGCCAGACACAGACACTAAGG - Intronic
1137462904 16:48681730-48681752 TTGTTTACATACTGCCACCATGG + Intergenic
1139872633 16:70119669-70119691 ATGGTCAGAAACAGCCTCCAAGG - Intronic
1140363143 16:74361646-74361668 ATGGTCAGAAACAGCCTCCAAGG + Intergenic
1141704866 16:85659203-85659225 CTGTTTAAACACAGCCACCAAGG - Intronic
1142121445 16:88388488-88388510 CTGTTTACACACAGCCACCTTGG - Intergenic
1143266269 17:5640283-5640305 TTGGTCAGACAGAAGCACCAGGG - Intergenic
1150299883 17:64038955-64038977 TTTCTGACACACAGCCACCATGG + Intergenic
1151578515 17:74964572-74964594 CTGGGCAGACACAGCCACCTCGG - Exonic
1153864702 18:9253770-9253792 TTGGTGAGAAACAGCCACTTTGG + Intronic
1158254654 18:55532387-55532409 TTGGTTTGGAAGAGCCACCAAGG - Intronic
1158760243 18:60376415-60376437 CTGCTTACACACAGCCACAAAGG + Intergenic
1159609121 18:70507142-70507164 TTGGCTACCTACAGCCACCATGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1168644457 19:58051179-58051201 TTGATTAGTCACAGACGCCAAGG + Intronic
927382159 2:22491446-22491468 TTAGTTTGCCACAGTCACCATGG - Intergenic
927673448 2:25088447-25088469 TTGCTTGGCCACAGCGACCAAGG - Intronic
930120643 2:47757883-47757905 TTGGTAAGACAGAGTCACCCAGG + Intronic
932413222 2:71559358-71559380 TGGGTGAGGCAGAGCCACCAGGG - Intronic
932864507 2:75327518-75327540 TGGGGTGGACACAGCCATCAGGG - Intergenic
933657687 2:84903195-84903217 CTGGTAACACACAGCCCCCAAGG - Intronic
937154978 2:119712494-119712516 TTGGATACACAGAGACACCAGGG + Intergenic
937888286 2:126915414-126915436 TTGGGTATACAGAGGCACCAGGG - Intergenic
938127151 2:128682784-128682806 CTGGGTCTACACAGCCACCATGG - Intergenic
939437303 2:142194982-142195004 TTGGTTGTACACATACACCATGG + Intergenic
942827991 2:180203849-180203871 TTGCTGAGACACAGCCAGCCAGG - Intergenic
947577126 2:231284696-231284718 TTGGTTACACAGACCCACCCTGG + Intronic
948160206 2:235817137-235817159 TTGTTTAGAAACAGCAACCGTGG + Intronic
1173170125 20:40716911-40716933 TGGTTGAGGCACAGCCACCAAGG - Intergenic
1175031610 20:55960416-55960438 TTGACTAAACACAGCCACTAGGG + Intergenic
1175535511 20:59708270-59708292 TTAGAGAGACACAGGCACCATGG - Intronic
1183936042 22:41262968-41262990 TTGGTTAGACACCCAGACCATGG + Intronic
1185067745 22:48640517-48640539 TGGCTTAGACACAGCCAGCTGGG + Intronic
949232717 3:1770779-1770801 TAGGTCAGAAACTGCCACCAAGG + Intergenic
949876742 3:8631074-8631096 TTGCTTAGTCACTGCCTCCAAGG - Intronic
956787567 3:72655265-72655287 TTGTTTAGACAGAGCAATCAAGG + Intergenic
958776176 3:98485581-98485603 TTGGTTAGGCAGAGCCAACATGG - Intergenic
969862664 4:10049887-10049909 TTGGTCAGCCGCAGCCCCCAAGG + Intronic
973920660 4:55681675-55681697 TTGGTCAGACACACCAACCCTGG - Intergenic
976474068 4:85462374-85462396 TTGTTTAGTCACAGTCAACATGG - Intergenic
979718018 4:123865024-123865046 TTGTGTAGACACAGCCACTGAGG - Intergenic
980666002 4:135936349-135936371 TTGGGTACACACAGACACAAAGG + Intergenic
980670792 4:136004151-136004173 ATGTTTACACACAGACACCAAGG - Intergenic
981585083 4:146291900-146291922 TTGGTTAGAGAAAGTTACCATGG - Intronic
983458728 4:167999760-167999782 TTGATTATACACAGGGACCAGGG - Intergenic
983893540 4:173056987-173057009 TTGCTTTAACACAGCCACCCAGG - Intergenic
990934500 5:61133124-61133146 TTGGTCAGTCACAGGCACTATGG + Intronic
991099736 5:62779538-62779560 TTGGTCAGAAACAGCCACATAGG + Intergenic
996934362 5:128931323-128931345 CTGGTCAGCCACAGCCACCCAGG - Intronic
1003568418 6:7239899-7239921 TGGGAGGGACACAGCCACCAAGG + Intronic
1006172934 6:32105662-32105684 TTGGTTAGACACAGCCACCAGGG + Intronic
1008009665 6:46452601-46452623 TTGGGTAGAAACAGCCAGTAGGG + Intronic
1014777141 6:125524116-125524138 TTGGTCAGAAACAGCTATCATGG + Intergenic
1026910605 7:74089709-74089731 TGGGCAGGACACAGCCACCATGG - Intronic
1029648107 7:101870970-101870992 TTGGATGGACCTAGCCACCAGGG + Intronic
1029657550 7:101936968-101936990 TTAGTGAGACACAGTCACCGGGG + Intronic
1032113875 7:129100684-129100706 TTGGTTGTTCACAGGCACCATGG - Intergenic
1034501372 7:151453016-151453038 TTGGCTAGTCCCAGCAACCAGGG + Intergenic
1034564980 7:151906100-151906122 TTGGTTTAAAATAGCCACCATGG + Intergenic
1034701387 7:153099270-153099292 TTGGGTGGACATAGCCACCATGG + Intergenic
1036799161 8:11776954-11776976 CTGGTCAGACACAGCAGCCAGGG - Intronic
1037548954 8:19951162-19951184 TTGCTTAGACACAGCTATCTTGG + Intronic
1037764390 8:21763387-21763409 TTGGTGAGTGACAGCCTCCAGGG - Intronic
1040868480 8:52075397-52075419 TTAGTTAAAAACAACCACCATGG + Intergenic
1041566526 8:59284982-59285004 TGGGTTGGCCACAGCCCCCATGG + Intergenic
1046016683 8:108613755-108613777 TTGGCTAGACACATTCCCCAGGG + Intronic
1046660735 8:116946071-116946093 TCGTTTAGACTCAGCCATCATGG - Intergenic
1047853604 8:128885613-128885635 TTTGTTAGACAGAGGCAGCAGGG - Intergenic
1048638162 8:136322708-136322730 TAGGTTAGCCAAAGCCAGCATGG + Intergenic
1052280139 9:26723663-26723685 TTTGTTAGACTCAGCCAACAGGG + Intergenic
1058685089 9:107473099-107473121 TTTGTTAGACAAAGCCACTCTGG - Intergenic
1058945555 9:109852300-109852322 TTGGGTACACACAGACACAAAGG - Intronic
1060432588 9:123563129-123563151 TTGCTAAGACACAACCACAATGG + Intronic
1186151598 X:6680393-6680415 TTTGTTAGAAATAGCCAGCAAGG - Intergenic
1187836593 X:23437597-23437619 TTTGCTAGATACAGCCCCCATGG - Intergenic
1189352443 X:40286184-40286206 TTGGTTAGACACATGAGCCATGG + Intergenic
1191926620 X:66318249-66318271 TTACTTATACACAGCTACCATGG - Intergenic
1195084794 X:101403727-101403749 TTGTTTAGAAACAGCCCTCATGG - Intronic
1195563385 X:106311700-106311722 ATGGTTACACACATCCACCCAGG + Intergenic
1198431004 X:136566022-136566044 TTGGCTACACACAGACACAAAGG - Intergenic
1198869586 X:141161696-141161718 TTGGCTAGATAAGGCCACCATGG + Intergenic
1201270862 Y:12252441-12252463 TTGGTAGGGCACAGGCACCATGG + Intergenic