ID: 1006174870

View in Genome Browser
Species Human (GRCh38)
Location 6:32115759-32115781
Sequence GGGGCTGGTGGGAGGCCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1519
Summary {0: 1, 1: 0, 2: 13, 3: 157, 4: 1348}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006174853_1006174870 29 Left 1006174853 6:32115707-32115729 CCCCCGTTCTAAGTCAGTGTGAA 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG 0: 1
1: 0
2: 13
3: 157
4: 1348
1006174854_1006174870 28 Left 1006174854 6:32115708-32115730 CCCCGTTCTAAGTCAGTGTGAAT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG 0: 1
1: 0
2: 13
3: 157
4: 1348
1006174855_1006174870 27 Left 1006174855 6:32115709-32115731 CCCGTTCTAAGTCAGTGTGAATG 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG 0: 1
1: 0
2: 13
3: 157
4: 1348
1006174852_1006174870 30 Left 1006174852 6:32115706-32115728 CCCCCCGTTCTAAGTCAGTGTGA 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG 0: 1
1: 0
2: 13
3: 157
4: 1348
1006174856_1006174870 26 Left 1006174856 6:32115710-32115732 CCGTTCTAAGTCAGTGTGAATGG 0: 1
1: 0
2: 3
3: 7
4: 147
Right 1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG 0: 1
1: 0
2: 13
3: 157
4: 1348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006174870 Original CRISPR GGGGCTGGTGGGAGGCCTGG TGG Exonic
900000982 1:14787-14809 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
900003523 1:29228-29250 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
900020697 1:185308-185330 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
900023243 1:199744-199766 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
900131295 1:1088335-1088357 GGGTCTTGGGGGAGGCGTGGGGG - Intronic
900135677 1:1116029-1116051 GGGGCTGGGGGCAGGCGTGAGGG - Intronic
900156099 1:1203849-1203871 GGGGCGGCTGGGAGACCTGTGGG - Exonic
900177069 1:1295649-1295671 GGGGCTGGTGGCAGGGCTCTGGG - Intronic
900300831 1:1976269-1976291 GGGCCTGGTGGGAGGTGTTGGGG + Intronic
900342279 1:2194795-2194817 GGGGCGGGGGCGGGGCCTGGAGG - Intronic
900394756 1:2448711-2448733 GGGGATGGTGGGGAGCCAGGAGG - Intronic
900486253 1:2924206-2924228 CCAGCTGGTGGGAGGCTTGGGGG - Intergenic
900490343 1:2945861-2945883 TGGGCTGTGGGGAGGCCTGGAGG + Intergenic
900506722 1:3032974-3032996 GAGGCTGGAGGAAGGCCTGGAGG + Intergenic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900613284 1:3553405-3553427 GGGGCTGGTGGGGGGCGGGAGGG - Intronic
900865021 1:5262559-5262581 GGGCCTGGTGGGAGGCGTTTGGG + Intergenic
900937471 1:5775611-5775633 GGGCCTGGTGGGAGGTGTGTTGG - Intergenic
900955896 1:5886343-5886365 GAGGTTGGTGGGGGGCCTGGCGG - Intronic
900970850 1:5991906-5991928 GGGGCTGCAGAGAGGCCAGGGGG + Intronic
901109817 1:6785594-6785616 GGGGCTGGGGGGCGGCGCGGCGG + Intronic
901218181 1:7566471-7566493 GGGGCTGGTGGGAAGTTTGAGGG - Intronic
901233808 1:7656704-7656726 AGGGCTGGGGGAAGGCGTGGGGG - Intronic
901293123 1:8140129-8140151 GGGGCTGTTCTGAGGCCTGGCGG - Intergenic
901399746 1:9007569-9007591 GAGGCTGGAGGGAGCCCTGTGGG - Intronic
901501264 1:9653809-9653831 TTGGCTGGTGAGAGGCCTGCTGG + Exonic
901672835 1:10866332-10866354 GGGGCTGGTGGGGGGGCAGGTGG - Intergenic
902311492 1:15584847-15584869 GGGGCGCGTCGGAAGCCTGGCGG + Exonic
902379691 1:16046864-16046886 GGACTTGATGGGAGGCCTGGTGG + Intronic
902466497 1:16621805-16621827 GGGACAGCTGGGAGGACTGGAGG - Intergenic
902542741 1:17166219-17166241 GGGGATGGTGGTGGGCATGGTGG - Intergenic
902756052 1:18550018-18550040 GGAGCTGGTGGGAGGCTAGAGGG - Intergenic
902756656 1:18553372-18553394 GGGACTGGAGGGAGAGCTGGAGG - Intergenic
902783994 1:18721332-18721354 GGGGCTGGTCCCAGGCCTTGGGG - Intronic
903063614 1:20686215-20686237 GGGGGTGGTGGGAGGCCTTGGGG - Intronic
903115610 1:21176506-21176528 GGGGCTGGGGGGAGCCTGGGGGG + Intronic
903136587 1:21313362-21313384 GGGGATGGAGGGAGCCCGGGAGG + Intronic
903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG + Intronic
903847864 1:26289241-26289263 AGGGCTGCTGTGAGGCTTGGAGG + Intronic
904200967 1:28818797-28818819 AGGGCTGAGGAGAGGCCTGGAGG + Intronic
904396417 1:30225295-30225317 GGGGCAGGTGGGTGACCTTGGGG - Intergenic
904455966 1:30648220-30648242 GGGCCTGGTGGGAGGGCTTTTGG + Intergenic
904741936 1:32684192-32684214 GGGGATGGTGGGAGGGCTTAGGG - Exonic
904842131 1:33379428-33379450 GGGGATGGTGGGGGGACAGGGGG - Intronic
904842141 1:33379447-33379469 GGGGATGGTGGGGGGCGGGGGGG - Intronic
904887523 1:33752251-33752273 GGGCCTGGTGGGACTCATGGGGG + Intronic
904909487 1:33923222-33923244 GGGCCTGGTGGGAGGTGTGTGGG + Intronic
905139382 1:35829694-35829716 GGGCATGGTGGCAGGCATGGTGG + Intronic
905166957 1:36088539-36088561 GGGCCCGGTGGGAGGGCTTGGGG + Intergenic
905308488 1:37034407-37034429 GGGGCAGGTGGGAGCCCGCGCGG - Intergenic
905321372 1:37119779-37119801 GAGGCTGCTGGGGGGGCTGGAGG - Intergenic
905325591 1:37149503-37149525 GTGGCAGGCAGGAGGCCTGGTGG + Intergenic
905365304 1:37448050-37448072 GGGGCTGGCGGGAGTCCTAGGGG + Intergenic
905485375 1:38292408-38292430 CGGGCCGGTGGGGAGCCTGGGGG - Intergenic
905548790 1:38819461-38819483 GGGGAAGGTGGGAGCCCGGGGGG + Intergenic
905693718 1:39960367-39960389 GGGGTGGGTGGGGGGCCTCGTGG - Intronic
905915192 1:41679542-41679564 GGGACTGGTGGCAGGGATGGAGG + Intronic
906140434 1:43531099-43531121 GGGGCTGGTGGGGGGCCGGGGGG - Intronic
906147024 1:43566209-43566231 GGGGCTGGGAGGAGACCGGGTGG - Intronic
906279473 1:44543318-44543340 GGGGCTGGGGGGAGGGGAGGGGG + Intronic
906343966 1:45003829-45003851 AGTGCTGGAGGGAGGCCTGAAGG - Intronic
906475773 1:46168497-46168519 AGGGCTGGAGGCAGCCCTGGGGG - Intronic
906511063 1:46410703-46410725 GGCCCTGGGGGGAGGCATGGAGG + Intronic
906520908 1:46466498-46466520 GGGGCGGGGCGGGGGCCTGGCGG - Intergenic
906662580 1:47593385-47593407 GGGGCTAGGGGGAGGCCGGGCGG + Intergenic
906694410 1:47814470-47814492 GGGGCTTTGGGGAGGCATGGAGG + Intronic
906945106 1:50288665-50288687 GGGACTGGTGGCAGTCCCGGAGG - Intergenic
907296906 1:53461229-53461251 GGGGCAGCGGGGAGGTCTGGAGG + Intronic
907319277 1:53592641-53592663 GATGCTGGAAGGAGGCCTGGTGG - Intronic
907319561 1:53594070-53594092 GGGGCTGGGGTGAGGCCTGGCGG + Intronic
907439922 1:54472841-54472863 GGGGCTGGAGGAAGGCATAGGGG - Intergenic
907502069 1:54887867-54887889 GAGGCAGATGGGAGGCCCGGAGG + Intergenic
907916544 1:58875035-58875057 GAGCCTGGTGGCAGGCCAGGAGG - Intergenic
908470253 1:64437162-64437184 GGGGCAGGCGGGGGGCATGGGGG + Intergenic
908690334 1:66772458-66772480 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
908757000 1:67478098-67478120 GGGGATGGTTGGAGCCCAGGAGG + Intergenic
909218111 1:72918040-72918062 GGGGCTGGAGGGAGGGGAGGGGG + Intergenic
910786094 1:90999506-90999528 GGAGCTGTTGACAGGCCTGGTGG - Intronic
911219848 1:95234589-95234611 GAGGCTGGGGGAGGGCCTGGGGG - Intronic
911284087 1:95969128-95969150 GGGCCTGGTGGGAGGGTTGGGGG - Intergenic
911579851 1:99622037-99622059 GGGGCTGGTGGGCAGTTTGGTGG - Intergenic
911725601 1:101238276-101238298 GGGGCTGGGGGTGGGCATGGGGG + Intronic
912437082 1:109669232-109669254 GGGGATGCTGGGGAGCCTGGTGG + Intronic
912437827 1:109674262-109674284 GGGCCTGGTGTGAGGGGTGGTGG + Intronic
912439777 1:109688990-109689012 GGGGATGCTGGGGAGCCTGGTGG + Intronic
912440337 1:109692721-109692743 GGGCCTGGTGTGAGGGGTGGTGG + Intronic
912443092 1:109713426-109713448 GGGGATGCTGGGGAGCCTGGTGG + Intronic
912459673 1:109822330-109822352 GAGGGTGGTGGGAGGTCTGAGGG + Intergenic
912512536 1:110198836-110198858 GGTGGTGGTGAGAGGCCTTGGGG + Exonic
912746386 1:112248934-112248956 GGGGATGGAGGACGGCCTGGTGG - Intergenic
913141041 1:115941675-115941697 CAGGCTGGTGGGACGCCTGTTGG - Intergenic
913144420 1:115976136-115976158 GCAGCTGGCGGGCGGCCTGGCGG - Intergenic
913960315 1:143334041-143334063 GGGGCCGGTGTGAGGGCTGCGGG - Intergenic
914054671 1:144159614-144159636 GGGGCCGGTGTGAGGGCTGCGGG - Intergenic
914124475 1:144806747-144806769 GGGGCCGGTGTGAGGGCTGCGGG + Intergenic
914376397 1:147077344-147077366 GGGGCAGGTGGGAGGCGCGCGGG - Intergenic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
914687207 1:149991213-149991235 GGGGTTGGTGGGAGGTGGGGAGG - Intronic
914827524 1:151146389-151146411 GGGGCTGCGGGGAGGCGGGGAGG - Intronic
914847232 1:151289906-151289928 GGTGGGGGTGGGGGGCCTGGAGG + Exonic
914918505 1:151832450-151832472 GGGGCAAGGGGCAGGCCTGGAGG + Intergenic
914934977 1:151970787-151970809 GGGGCAGGTGGGGGGCATTGGGG + Intergenic
915358133 1:155268841-155268863 GGGGCCGGAGGGAGGCGGGGTGG + Intronic
915458073 1:156053712-156053734 CGGGCTGGCGGGCGGCCGGGTGG - Exonic
915460135 1:156065548-156065570 AGGGATGGTGGGAGGTCAGGGGG - Intronic
915475780 1:156152018-156152040 GGGGCAGGAGGGAGGACTGAGGG + Intronic
915592544 1:156878914-156878936 GTCTCTGGTGGGAGCCCTGGAGG + Intronic
915593111 1:156881701-156881723 GGGGCTGCTGGGAGCTATGGGGG - Intronic
915646318 1:157275229-157275251 GGGGTTGGTGAGAGGCTCGGAGG + Intergenic
915942034 1:160124346-160124368 AGTGGTGGTGGGAGACCTGGTGG + Exonic
915946853 1:160159052-160159074 GGTGGTGTTGGGAGACCTGGTGG + Exonic
916019023 1:160776745-160776767 GGAGCTGGTGGGGAGGCTGGAGG - Intergenic
916457206 1:164983152-164983174 GGGGCTGGTGTGTGGCTTTGTGG - Intergenic
916713996 1:167434912-167434934 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714018 1:167434974-167434996 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714031 1:167435011-167435033 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714044 1:167435048-167435070 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714057 1:167435085-167435107 AGGGCTGGAGGTAGGGCTGGAGG - Intronic
916714070 1:167435122-167435144 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714083 1:167435159-167435181 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714096 1:167435196-167435218 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714109 1:167435233-167435255 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714122 1:167435270-167435292 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
916714134 1:167435307-167435329 AGGGCTGGAGGAAGGGCTGGAGG - Intronic
917205587 1:172567892-172567914 GGTGCTGGTCTGTGGCCTGGGGG - Intronic
917980419 1:180265764-180265786 GGGGATGGAGGTAGGCTTGGAGG + Intronic
919693072 1:200544743-200544765 GGGGAGGGAGGGAGGCCTCGTGG + Intergenic
919745829 1:201008727-201008749 TGGGCAGGTGGGAGGCTTGGTGG - Intronic
919781751 1:201225761-201225783 GGGGCTGGTAGCAGCCCTGCTGG + Intronic
919812331 1:201416993-201417015 AGGCCTGGTGGGAGTCCAGGGGG - Intronic
920002160 1:202807723-202807745 CGGGCTGGAGGGAGGACTGTGGG - Intronic
920049651 1:203155710-203155732 GTGGCTGGCTGGTGGCCTGGTGG + Intronic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920305672 1:205016688-205016710 GGGGCTTGTGGGTGGCTTGGTGG - Exonic
920441648 1:205984884-205984906 GGGGCTGGGAGGAGGCAGGGAGG - Intronic
920441831 1:205985829-205985851 GGGAGTGGTGGTGGGCCTGGTGG - Intronic
920827565 1:209435863-209435885 GGGACCGGTGGGACACCTGGTGG + Intergenic
920917910 1:210272911-210272933 GGAGCTGGCAGGAGGCCGGGAGG - Intergenic
920938123 1:210455049-210455071 GAGGCTGATGGGAGGCCAGGAGG + Intronic
921016536 1:211197323-211197345 GGGCCGGGAGGGAGGCCGGGGGG + Intergenic
921077674 1:211712751-211712773 GGGGCGAGGGGGAGGCCTGAGGG - Intergenic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
921805291 1:219447021-219447043 GGGGCGGGTGGGGGGCACGGTGG - Intergenic
922366106 1:224865217-224865239 GGGGCTGGGGCTGGGCCTGGCGG - Intergenic
922500785 1:226095518-226095540 GGAGCTGGAGGGAGTCCTAGAGG + Intergenic
922560843 1:226568583-226568605 GAGGCTGGTGGGTGGCCAGGAGG + Intronic
922706894 1:227794925-227794947 GAGGCTGCTGGGTGGCCTGGAGG - Intergenic
922718369 1:227888246-227888268 GGCTGTGGAGGGAGGCCTGGGGG - Intergenic
922809061 1:228406073-228406095 TGGGCGGGTGGGAGGTTTGGGGG - Intronic
922903550 1:229156895-229156917 GGAGCTGGTGGGAGGCCGGAAGG - Intergenic
922968712 1:229715989-229716011 GAGGCCGCAGGGAGGCCTGGGGG + Intergenic
923249025 1:232162259-232162281 GGGCCTGGTGGGAGGTTTGTGGG - Intergenic
923795290 1:237148344-237148366 GGGCCTGTCGGGAGGGCTGGGGG + Intronic
924501840 1:244645492-244645514 GAGGCGGGTGGGAGGGGTGGAGG - Intergenic
924707873 1:246513155-246513177 TGGGAGGGTGGGAGGCCTCGGGG - Intergenic
924775501 1:247112425-247112447 GGGGCTGGCGGGAGGACGGGAGG + Intergenic
924832296 1:247609890-247609912 GGGGCCTGTCGGAGGCATGGAGG + Intergenic
1062830773 10:604022-604044 GGGGCTGAGGGCAGGGCTGGGGG - Intronic
1062860300 10:805182-805204 AGGGCGCGTGGGGGGCCTGGAGG + Intergenic
1062908934 10:1199634-1199656 TGGGCAGGTGGGCGGCCAGGTGG + Intronic
1063184080 10:3634662-3634684 GGGCCTGTTGGGAGGCTGGGAGG - Intergenic
1063438184 10:6051243-6051265 CTGGCTGGGGGCAGGCCTGGTGG - Intronic
1063507379 10:6613024-6613046 AGGGCTGGAAGGAGGGCTGGGGG + Intergenic
1063874692 10:10461827-10461849 GGGGATGGTGGGAGGGCTACAGG - Intergenic
1063964450 10:11335722-11335744 GGGGATGTTGGGAGGCATGGGGG + Exonic
1064048835 10:12042887-12042909 GTGGCGGGCGGGAGGGCTGGCGG - Intronic
1064321487 10:14309659-14309681 GAGGCAGGAGGGGGGCCTGGAGG - Intronic
1064392460 10:14953840-14953862 GGGGCTGGAGAGAGGACAGGAGG - Intronic
1064574461 10:16730243-16730265 GGGCCTGGTGGGAGGTCTTTGGG - Intronic
1065354288 10:24824287-24824309 GGGGCTGGTTGGAGGGGAGGAGG - Intergenic
1066279871 10:33906279-33906301 GGGACTAGTGGGAGCCCCGGTGG - Intergenic
1066315441 10:34241402-34241424 GAGGGTGGTGGGAGACCCGGTGG + Intronic
1066324997 10:34350298-34350320 GGGGGTGATAGCAGGCCTGGGGG - Intronic
1067295180 10:44971567-44971589 GGCCCTGGTGGGGGGCATGGGGG - Intronic
1067789483 10:49277041-49277063 GGGTCTGGTGGGAGGAAAGGTGG - Intergenic
1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG + Intergenic
1069371337 10:67750735-67750757 GGGGCTGGTGAAAGCCCTTGGGG + Intergenic
1069722763 10:70560211-70560233 GGGGCTTGTCATAGGCCTGGAGG + Intronic
1069735186 10:70649332-70649354 GGTGCAGGTGGGGTGCCTGGAGG + Intergenic
1069748641 10:70731949-70731971 GGGACTGGAGGGAGGCATTGTGG + Intronic
1069789080 10:71007853-71007875 GCGGTTGGTGGCTGGCCTGGCGG - Intergenic
1069869953 10:71527078-71527100 GGGGCTGGAGAGAGGGGTGGTGG - Intronic
1069905238 10:71728409-71728431 GGGGAGGGTGGCAGGGCTGGGGG - Intronic
1069959599 10:72072111-72072133 TGGGGAGGTGGGAGCCCTGGAGG - Intronic
1070048381 10:72862360-72862382 GGGGCTGGTGGAAGGAGTGGTGG - Intronic
1070505136 10:77106486-77106508 TGAGCTGGTGGGTGGGCTGGAGG - Intronic
1070650558 10:78232413-78232435 GGGTCTGGTGGGATTCCTGGAGG + Intergenic
1070657834 10:78283377-78283399 GCTGCAGGTGGGAGGCCTGCAGG + Intergenic
1070760733 10:79022852-79022874 GGGCCTGTAAGGAGGCCTGGAGG + Intergenic
1071157986 10:82713166-82713188 AGGGCTAATGGGAGGCCAGGAGG + Intronic
1072199551 10:93145891-93145913 GGAGCTGGTGAGAGAGCTGGCGG - Intergenic
1072302311 10:94073152-94073174 GGGGTTGGTGGGTGGGGTGGTGG - Intronic
1072407473 10:95168598-95168620 GGGGACTGTGGGGGGCCTGGAGG + Intergenic
1072721210 10:97782071-97782093 AGGGCTGGTGGGGGGCCCAGTGG + Intergenic
1073245978 10:102090520-102090542 GGGACAGGTGGGAGGACTGGAGG - Intergenic
1073323527 10:102629694-102629716 GGGGCTGGGGGAGGGTCTGGAGG - Intronic
1073412070 10:103350727-103350749 GAGGCTGGAGGGAGGCCGGCAGG - Exonic
1073417231 10:103394747-103394769 GGAGCTGGTGGGGGGGCGGGGGG - Intronic
1073512373 10:104050824-104050846 TAAGCTGGAGGGAGGCCTGGGGG - Intronic
1073947888 10:108773268-108773290 GGGGCTGGTGGGCAGTCTTGGGG - Intergenic
1074082824 10:110181308-110181330 GGAGTGGGTGGGAGGGCTGGGGG + Intergenic
1074165571 10:110871667-110871689 GGGTATGTTGGGAGGCGTGGCGG - Intergenic
1074369325 10:112886876-112886898 GGGGCTGGTGAGATGCAAGGCGG - Intergenic
1074415832 10:113265872-113265894 GGGGTGGGTGGAAGGCCTGTGGG - Intergenic
1074734003 10:116409019-116409041 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
1075095700 10:119469202-119469224 AGGGCTGGTGGTGGCCCTGGTGG + Intergenic
1075378170 10:121996455-121996477 GGGCCTGGTGGGAGGTCATGGGG - Intronic
1075447967 10:122526879-122526901 GGTGGTAGGGGGAGGCCTGGGGG - Intergenic
1075646665 10:124101341-124101363 AGGGTGGGTGGGAGTCCTGGAGG - Intergenic
1075684240 10:124353071-124353093 GGGTTTGGGGGGAGGCCTTGAGG - Intergenic
1075793654 10:125103698-125103720 CGCGGTGGTGGGACGCCTGGGGG - Intronic
1075839510 10:125487762-125487784 GGGTCAGCAGGGAGGCCTGGGGG + Intergenic
1075949267 10:126463040-126463062 GGGGCTAGTGTTAGGCCTGAAGG - Intronic
1076439025 10:130466802-130466824 AGGGCTGGGGGCAGGCCTGCAGG - Intergenic
1076568029 10:131412135-131412157 GGGGGTGGTTAGAGGGCTGGGGG + Intergenic
1076568053 10:131412209-131412231 GGGGGTGGTTAGAGGGCTGGGGG + Intergenic
1076733805 10:132450237-132450259 GGGGCTGGGGTGAGGGTTGGGGG - Intergenic
1076784762 10:132744323-132744345 GGGCCTCCTGGGAGGCCTGTGGG - Intronic
1076851595 10:133095962-133095984 GGGGCTGGGGAGGGGCCAGGCGG + Intronic
1076859497 10:133133927-133133949 GGGCCTGGAGGGAGGGCTGCTGG + Intergenic
1076874170 10:133207890-133207912 GGGGCTGGTGGGGCGGCCGGGGG - Intronic
1076880036 10:133235640-133235662 GGGGGTGGACGGAGGCTTGGAGG + Intergenic
1076909649 10:133380507-133380529 GAGCCTGGTGGGAGGACTGGCGG - Intronic
1076999071 11:313570-313592 GGTGCAGGTCAGAGGCCTGGTGG - Intronic
1077014861 11:394967-394989 GGGGGTGCTGGAAGTCCTGGAGG + Intronic
1077035037 11:490374-490396 GGGGCTGGTGTGGGGGCAGGTGG + Intronic
1077094370 11:793072-793094 GAGGATGGTGGGAGCCGTGGAGG + Intronic
1077153637 11:1082093-1082115 GGGGCAGGAAGGTGGCCTGGAGG + Intergenic
1077156509 11:1094505-1094527 GGTGGTGGTTGGAGGGCTGGGGG - Intergenic
1077158826 11:1103489-1103511 GGGGACGGTGGGAGCCGTGGGGG - Intergenic
1077228845 11:1449811-1449833 GGGGCTGCTGAGTGGGCTGGTGG - Exonic
1077239180 11:1501774-1501796 GGGGCGGGAGGCAAGCCTGGAGG - Intergenic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077287182 11:1772891-1772913 GGGGCTGGTGGGGGGAAAGGTGG + Intergenic
1077308795 11:1879499-1879521 GGGGCTGGTGGTGGGACAGGAGG + Intronic
1077311613 11:1891322-1891344 GGGGAAGGAGGGAGTCCTGGGGG + Intronic
1077378048 11:2214839-2214861 GGGGCAGGTGGCAGGGCAGGTGG - Intergenic
1077410737 11:2402838-2402860 GTGGCTGGGAGGAGGCCTGACGG - Exonic
1077464174 11:2725769-2725791 GGGGCGGGGGTGGGGCCTGGGGG - Intronic
1077472611 11:2771060-2771082 GGGGCTGGTGTCTGGCCTGAGGG + Intronic
1077555331 11:3223299-3223321 GGGGCGCGTGGGAGGCTGGGTGG - Intergenic
1077674957 11:4187407-4187429 CGGGCTGGTGCGGGGCCTGGGGG + Intergenic
1077877573 11:6320681-6320703 GGGCCTGCTGGGAAGCCTGTTGG + Intergenic
1077901096 11:6489390-6489412 GGTGGTGGTGGCAGGCTTGGCGG + Intronic
1078266412 11:9758788-9758810 GGGACTGGCGGGAGGCCGTGTGG - Intergenic
1078439682 11:11353870-11353892 GGGGTTGGTGGGAGGCAATGTGG + Intronic
1078659698 11:13277386-13277408 GCGGCTAGTGGGAGACCTGAGGG + Intronic
1078852780 11:15179555-15179577 GGGGCCTGTGGGAGGAGTGGGGG - Intronic
1079238509 11:18706314-18706336 GGGGGTCGGGGGAGGCCTGGGGG - Intronic
1080173181 11:29330719-29330741 GGGGTTGGTGGGAAGCATGACGG - Intergenic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1080503624 11:32892718-32892740 GGGGCTGGCGGGCGGCCGCGAGG - Intergenic
1080527867 11:33145190-33145212 GGGGTTGGTGGGTGGGCAGGAGG + Intronic
1081411226 11:42760632-42760654 GGGGCGGGGGGCAGGCGTGGGGG - Intergenic
1081582428 11:44361333-44361355 GGGGCCGCTGGGAGGACTGGAGG - Intergenic
1081891369 11:46545170-46545192 GGGGGTGGTGGTGGGCATGGTGG + Intronic
1081915980 11:46730492-46730514 GGAGCAGTAGGGAGGCCTGGGGG + Intronic
1082009644 11:47441565-47441587 GGGAGTGCTGGGAGGGCTGGAGG + Intronic
1082941125 11:58706615-58706637 GGTGCTGTTGGGGGGCATGGTGG + Intronic
1083272912 11:61580986-61581008 CGGGCGGGCGGGAGGGCTGGCGG - Intronic
1083300567 11:61737805-61737827 GGGGGTGGGGAGAGGCCTGGAGG - Intronic
1083540058 11:63506257-63506279 GGGGCTGGTGTGGAGCCTGGAGG + Intronic
1083594384 11:63911981-63912003 GGGGCTGGTTGGGGGCCAGCCGG + Exonic
1083655610 11:64227740-64227762 TGGGCTGGCAGGAGGCCTGCAGG + Intronic
1083657414 11:64236130-64236152 AGGGTTGGGGGGAGGGCTGGTGG + Intronic
1083683017 11:64359899-64359921 GGGCCTGCTGCGAGGCATGGGGG - Intronic
1083709765 11:64540890-64540912 GGTCCTGGAGGGAAGCCTGGTGG - Intergenic
1083728042 11:64638455-64638477 GCGGCTGGGGAGGGGCCTGGCGG - Intronic
1083780376 11:64914440-64914462 GGAGCTGGTGGAAGGCTTCGTGG - Exonic
1083780461 11:64914886-64914908 GGGGGTGGTGAGGGGGCTGGTGG + Intronic
1083780468 11:64914898-64914920 GGGGCTGGTGGGGGGGCCGTGGG + Intronic
1083854679 11:65386865-65386887 GGCGCTGGTGGGAGGGGTGCGGG - Intronic
1083894515 11:65613480-65613502 GGGCCAGGTGGGTGGCCAGGTGG - Exonic
1083897777 11:65628761-65628783 GGGGGTGGTGGGGGGCTGGGAGG + Intronic
1083961807 11:66018754-66018776 GGGCCTGGCTGGAGGGCTGGAGG - Intronic
1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG + Intronic
1084010682 11:66346822-66346844 GGGGCTGTGGAGAGGCCTGCGGG - Exonic
1084180054 11:67441667-67441689 GGGGCTGCTGGGATGTATGGAGG + Intronic
1084191975 11:67503599-67503621 CGGGTTGGTGCGGGGCCTGGGGG - Intronic
1084399701 11:68936514-68936536 GCGGCAGGAGGGAGGCCAGGAGG + Exonic
1084403074 11:68956122-68956144 GGGGCAGGGTGGTGGCCTGGGGG + Intergenic
1084417704 11:69042989-69043011 GGGGCAGGCAGGAGGACTGGTGG + Intergenic
1084475605 11:69386972-69386994 GGGGTTGAAGGGAGGCCTGGAGG - Intergenic
1084476832 11:69394091-69394113 CCGGCTGCTGGGAGGGCTGGAGG + Intergenic
1084558453 11:69889304-69889326 GGTGCTGATGGGAGCTCTGGGGG - Intergenic
1084604186 11:70162789-70162811 GGGGCTGGTGTGGGGCGTGTAGG - Intronic
1084648730 11:70475683-70475705 GGGGCTGGTGGGTGCACTGCTGG + Intronic
1084891094 11:72237542-72237564 CTGGCTGGTGAGGGGCCTGGGGG - Exonic
1084944794 11:72632774-72632796 GGGGGTGGTGGGAGGTGTGAGGG - Intronic
1084972903 11:72781343-72781365 GGGGCTGTTCGGGGTCCTGGCGG + Intronic
1085253663 11:75159923-75159945 TGGGCAGGTGAGAGGCCAGGGGG + Intronic
1085390913 11:76181745-76181767 CGGGCGGGCGGGTGGCCTGGCGG + Intergenic
1085454871 11:76660122-76660144 GGGGGCCTTGGGAGGCCTGGAGG - Exonic
1085472902 11:76769421-76769443 GGGGGTGGCGGGAGGCCTGTGGG - Intergenic
1085718478 11:78893241-78893263 CCTGCTGATGGGAGGCCTGGTGG + Intronic
1085806680 11:79643117-79643139 AGGGCAGGAGGGAGGGCTGGAGG + Intergenic
1086479556 11:87219455-87219477 GGGGGTGGTGGCGGGGCTGGGGG + Intronic
1086681807 11:89681868-89681890 GGGGGTGGTGGGGGGCAGGGAGG + Intergenic
1088100442 11:106148667-106148689 GGGGCTGGGGGCATGCGTGGGGG - Intergenic
1089262617 11:117232828-117232850 GGGTCGGGTGGGGGGCGTGGAGG + Intronic
1089291828 11:117441854-117441876 GGGGGCGGTGAGAAGCCTGGGGG + Intronic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089557376 11:119321708-119321730 GGGGCCTGTGGGAAACCTGGGGG + Intergenic
1089821231 11:121228080-121228102 GGGCCTGGTGGGAGGCATTTGGG - Intergenic
1090004150 11:122984994-122985016 GCGGCTGGTGGGTGGGGTGGGGG - Intergenic
1090040873 11:123290085-123290107 GGGCCTGGTGGGAGGTGTGTGGG - Intergenic
1090425431 11:126603891-126603913 GGGGCTAGTGGGAGGAGGGGGGG - Intronic
1090429386 11:126633398-126633420 GGGGCTGGTGGGAGGTGTTTGGG + Intronic
1090594922 11:128310801-128310823 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1091374071 12:14902-14924 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
1091376942 12:31282-31304 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
1091583896 12:1805200-1805222 GAGTCTGGAGGGAGGCCAGGAGG + Intronic
1091599163 12:1907707-1907729 GTGTCTGGTGGACGGCCTGGTGG + Intronic
1091673170 12:2467460-2467482 GGGGAGGCTGGGAGACCTGGGGG - Intronic
1091743502 12:2976553-2976575 GAGGCTGAGGGGAGGCCAGGGGG + Intronic
1091888314 12:4032246-4032268 GGGGAAGCTGGGTGGCCTGGGGG - Intergenic
1092154749 12:6274830-6274852 AGGGCTGAGGGGAGGCCTGTGGG - Intergenic
1092237982 12:6821750-6821772 GGGGGAGGAGGGAGGCCCGGGGG + Exonic
1092263152 12:6963055-6963077 GGAGAGGGTGGGAGGCCTAGAGG + Intergenic
1092273146 12:7038924-7038946 GGAACTGGAGAGAGGCCTGGCGG + Intronic
1092291201 12:7160313-7160335 GAGGCAGGTGGGAGGACAGGTGG - Intergenic
1092482206 12:8870175-8870197 GGGGTTGGTGGGTGGGCAGGGGG - Intronic
1092510263 12:9147614-9147636 GGGACAGGGGGGAAGCCTGGGGG + Intergenic
1092526792 12:9314491-9314513 GGGGCTGGTGAGGGGCCGGGAGG - Intergenic
1092540479 12:9417288-9417310 GGGGCTGGTGAGGGGCCGGGAGG + Intergenic
1093488769 12:19681515-19681537 GGGGCTGTTAGGGGGCATGGTGG - Intronic
1093715970 12:22382071-22382093 GGTGGTGGTGGGAGTGCTGGGGG + Intronic
1093809001 12:23470233-23470255 GGGCCTGTTGGGAGGACGGGGGG + Intergenic
1094512565 12:31105191-31105213 GGGGCTGGTGAGGGGCCGGGAGG - Intergenic
1094512801 12:31106300-31106322 GGGGCAGGTGCAAGGGCTGGGGG - Intergenic
1095259857 12:40085398-40085420 GGGGGTGGTGGCAGGTCTTGAGG + Intronic
1095390585 12:41701310-41701332 AGTGCTGGTGGGAGACCTGCTGG - Intergenic
1095399729 12:41800667-41800689 GGGGGAGATGGGAGGCATGGAGG - Intergenic
1096106494 12:48999308-48999330 GGGGCGGGTGGGAGGGTGGGGGG - Exonic
1096302977 12:50448150-50448172 GGGGCTGGGGCCAGACCTGGTGG - Intronic
1096461098 12:51821728-51821750 GGGGCCGGGGGTGGGCCTGGGGG + Intergenic
1096499147 12:52054900-52054922 GGGGCCGGTGGGAGGACTGAAGG - Exonic
1096618172 12:52846390-52846412 GGGGGTCTTGGGAGGCATGGTGG - Intronic
1096810213 12:54164558-54164580 GGCGCAGGAGGGAGGCCAGGGGG - Intergenic
1096977476 12:55707814-55707836 CGGGCGGGCGGGAGGGCTGGCGG - Intronic
1096981172 12:55728868-55728890 GGGCCTGGGGCGAGCCCTGGAGG + Intronic
1097166156 12:57087731-57087753 GGGGCTGGGGTGGGGCATGGCGG - Intronic
1097194226 12:57235008-57235030 GGGGCTGGAGGGGGTACTGGCGG + Exonic
1097217878 12:57428499-57428521 GGGTGTGGTGGGGGGCGTGGTGG + Intronic
1097222634 12:57460046-57460068 TGGGCCGGCGGGAGGGCTGGGGG + Intergenic
1097249780 12:57626246-57626268 GGGGCTGGGGTGAGGGCTGGTGG - Exonic
1097261578 12:57723497-57723519 AGGGCTGCAGGGAGGGCTGGCGG + Intergenic
1100235087 12:92652851-92652873 GGGGCTGGCCTGAGGCCTGATGG - Intergenic
1100334684 12:93618388-93618410 GGCTTGGGTGGGAGGCCTGGGGG - Intergenic
1100688425 12:97012015-97012037 GGTGCTGGTTTGTGGCCTGGAGG - Intergenic
1101045534 12:100801741-100801763 GGGGCTGGGGGGTGGGGTGGAGG + Intronic
1101106846 12:101448858-101448880 GGGGCGGGTGGGGGGATTGGGGG + Intergenic
1101320119 12:103666077-103666099 GGGGCTGGTGGGAGGAGTTTAGG - Intronic
1101510844 12:105391058-105391080 GGGCCTGGTGGGAGGTCTTTGGG - Intronic
1101717451 12:107322851-107322873 AGGGCAGGTGGGATGCCTGAAGG - Intronic
1101860011 12:108475185-108475207 GGGGGTGGTGGGGGGGGTGGGGG + Intergenic
1102413739 12:112742636-112742658 GGGGCTGCTGTCAGGGCTGGGGG + Intronic
1102561110 12:113762874-113762896 GGGGCTGGAGGAAGGCTGGGGGG - Intergenic
1102900411 12:116632287-116632309 TGTGCTGGTGGGTGGCCTGGAGG + Intergenic
1102959881 12:117085511-117085533 GGGGCCAGTGGGAGGCAGGGTGG - Intronic
1103359632 12:120346156-120346178 GGTGCTGGGGGCAGGGCTGGCGG + Exonic
1103410854 12:120710528-120710550 GGGGCTGGTGGCTGGCAAGGAGG + Exonic
1103479293 12:121240826-121240848 GGGGCGGGTCGGTGCCCTGGAGG + Exonic
1103613428 12:122137759-122137781 GGGGATGGTGGGCCCCCTGGAGG + Intronic
1103779271 12:123388747-123388769 CGGGCTGGCGGGAGGGCGGGCGG + Intronic
1104170830 12:126278631-126278653 GAGGCTGAGGGGAGGTCTGGAGG - Intergenic
1104383810 12:128331163-128331185 GGGGATGGAGGGAGGACTGTTGG - Intronic
1104450733 12:128866491-128866513 GAGGCTGTTGGGGGGCTTGGTGG - Intronic
1104595390 12:130116951-130116973 GGGCGTGGTGGGAGGGCTGCTGG + Intergenic
1104769495 12:131352250-131352272 GGAGCTGCAGGGAGACCTGGTGG - Intergenic
1104832907 12:131766575-131766597 GGGGCTGGCAGGAGGGCTTGGGG + Intronic
1104854417 12:131895201-131895223 GGGGCTCTCGGGAGGCGTGGGGG - Intronic
1104879924 12:132063723-132063745 GGGGCTGTCGGGAGGGCTGTCGG + Intronic
1104968784 12:132521844-132521866 GGGGCTGGTGTGGGGCCTCTTGG + Intronic
1104971475 12:132532771-132532793 GGGGCCGGTGAGAGGCCCTGAGG + Intronic
1105446579 13:20462208-20462230 GGGGCAGGAGGAGGGCCTGGTGG + Intronic
1105446593 13:20462249-20462271 TGGCCTGGTGGGAGGCCCTGGGG + Intronic
1105543971 13:21338665-21338687 GGGGCTGATGGGAAGACAGGAGG - Intergenic
1105606723 13:21932120-21932142 GGGGGTGGAGTGAGGACTGGGGG + Intergenic
1105655224 13:22429431-22429453 GGGGCTGGTGGGGGTATTGGGGG - Intergenic
1107434204 13:40367480-40367502 GGGGCTTGTGGTGGGCCTTGTGG - Intergenic
1107675841 13:42795854-42795876 GGGGCTGGTTGGGGGCTGGGAGG + Intergenic
1107834863 13:44404947-44404969 GGGGCTGGCTGGGGGGCTGGGGG + Intergenic
1107995240 13:45852773-45852795 AGGGCTGGTGGGTGGGCGGGAGG + Intergenic
1108273271 13:48783683-48783705 GGGGCTGCGGGGAGGGGTGGAGG + Intergenic
1108530735 13:51324973-51324995 TGGGCTGGTGGGGGGCACGGTGG - Intergenic
1109756775 13:66771327-66771349 GGGGCTGAAGGGAGGAATGGAGG - Intronic
1112266771 13:97931635-97931657 GGGGGTGGGGGGAGGGGTGGGGG + Intergenic
1112361746 13:98724961-98724983 GGGCCTGGTGGGAGGTGTGTGGG + Intronic
1113701231 13:112390133-112390155 GGGGGTGGGGGGAGGAGTGGAGG + Intronic
1113789563 13:113020665-113020687 GGGGCTTGTGGGAGGGGAGGAGG - Intronic
1113794726 13:113050638-113050660 GGGGGCGGTGGGAGCCGTGGGGG + Intronic
1113795033 13:113051850-113051872 GGGGGTGGGTGGGGGCCTGGTGG - Intronic
1113941906 13:114022863-114022885 GGGGCTGGTGTGAGTCCCTGGGG + Intronic
1114182856 14:20380341-20380363 GGGGCTGGTTGGCTGCCTGCTGG + Exonic
1114241392 14:20871641-20871663 GAGACTGGTAGGAAGCCTGGAGG + Intergenic
1114656207 14:24316982-24317004 GGTGCTCGTGGGCGCCCTGGTGG + Exonic
1114660169 14:24338783-24338805 GGGGCTGGTGGGGCAGCTGGTGG + Intronic
1114989937 14:28273808-28273830 GGGCCTGGTGGGAGGCCATGGGG - Intergenic
1115203312 14:30875359-30875381 GGGGCTGTGGGTGGGCCTGGAGG - Intronic
1115488286 14:33934173-33934195 GGGGATGGTGGGAGGTGGGGTGG - Intronic
1115851190 14:37591788-37591810 GGGGCTGGCGGCGGGCCCGGGGG + Exonic
1115877097 14:37873356-37873378 GGTGTTGGTGGAAGGGCTGGTGG + Intronic
1116145390 14:41061432-41061454 TGGCCTGGTGGGAGGCCTGGTGG + Intergenic
1116400196 14:44497219-44497241 GGGGCTGGGGTGGGGCCTGCAGG - Intergenic
1116658778 14:47681572-47681594 TGCCCTGGTGGGAGGCTTGGGGG - Intergenic
1117574945 14:57088388-57088410 GGGGTTGGTGGGATCACTGGTGG + Intergenic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1118008952 14:61590493-61590515 GAGGCTGGTGGGGTTCCTGGTGG - Intronic
1118328166 14:64795534-64795556 GGAGCGGGTGAGAGCCCTGGAGG - Exonic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1118750812 14:68806869-68806891 GGGACTGGTGGGAGGGAGGGTGG + Intergenic
1119163381 14:72471709-72471731 GGGGCTGCTGGGTGGTCAGGAGG - Intronic
1119379480 14:74219489-74219511 GGGGATGCTGGGAGGATTGGGGG - Intergenic
1119437806 14:74609620-74609642 GTGGCAGGAGGGGGGCCTGGAGG - Intronic
1119480872 14:74956824-74956846 GGGGCTGGTGGGTGGCTGTGGGG + Intergenic
1119502631 14:75143557-75143579 GGCTGTGGTGGGAGGCATGGAGG - Intronic
1119633695 14:76256834-76256856 GAGGCTGATGGGAGGCTTTGAGG - Intergenic
1119888725 14:78166217-78166239 GGGGCAGGTTGGGAGCCTGGAGG + Intergenic
1120752458 14:88210575-88210597 AGAGCTGGTGGGAGGACGGGTGG - Intronic
1121315871 14:92960731-92960753 GGGGCTGGTGGAAGGCGGGCAGG + Intronic
1121404907 14:93713849-93713871 GGGGGCGCTGGGAGGCCAGGTGG + Intergenic
1121641298 14:95486352-95486374 AGGGGTGGGGGGTGGCCTGGGGG - Intergenic
1121730277 14:96182017-96182039 GAAGCTGGGGGGAGACCTGGGGG - Intergenic
1122052573 14:99070114-99070136 GGAGCTGGTGTGAGGCCAGGAGG - Intergenic
1122142212 14:99669068-99669090 AGGGCTGGACAGAGGCCTGGAGG - Intronic
1122158757 14:99767796-99767818 GGGACTTGGGGGAGGCCTTGAGG - Intronic
1122220769 14:100238366-100238388 GAGGCGGGTGGGCGGCCCGGGGG - Intronic
1122327431 14:100891050-100891072 GAGGCTGGTGAGATTCCTGGGGG + Intergenic
1122359924 14:101153084-101153106 GGGCCTGGAGGGAGGCCTGGGGG - Intergenic
1122507001 14:102238100-102238122 GGGGTTGGTGAGAGGCTCGGAGG - Intronic
1122602930 14:102930235-102930257 TGGGCTGGCGGGCGGCGTGGCGG + Exonic
1122603000 14:102930487-102930509 GGAGCTGGTGAGGGGGCTGGAGG + Exonic
1122736575 14:103847190-103847212 CGGGCCGGTGCGAGGCCGGGCGG - Intronic
1122774099 14:104109657-104109679 GGGGCTGGGGTGTGGACTGGGGG + Intronic
1122774952 14:104113015-104113037 GGGGTTGGAGGGCTGCCTGGGGG - Exonic
1122783304 14:104152838-104152860 GGGCCTGTGTGGAGGCCTGGGGG + Intronic
1122811527 14:104291743-104291765 GGGCCAGGAGCGAGGCCTGGAGG - Intergenic
1122855757 14:104559416-104559438 GGGGATGGAGGGAGGCCGGGTGG - Intronic
1122863488 14:104593200-104593222 GGGCCCTGTGCGAGGCCTGGAGG + Exonic
1122992146 14:105241520-105241542 GGAACTGGTGGGGGGCCTGGGGG - Intronic
1123028070 14:105437940-105437962 GGAGCTGGTGAGAAGGCTGGAGG + Intronic
1123068087 14:105628183-105628205 GGGGCAGGTGGGGGGGCAGGAGG - Intergenic
1123110687 14:105865592-105865614 GCGGCTGGTAGGGGGCCTGTGGG + Intergenic
1123702128 15:22922580-22922602 GGGGATGGAGGGTGGTCTGGAGG + Intronic
1124106745 15:26745183-26745205 GGGCCTGGTGGGAGGCGTTTGGG - Intronic
1124277239 15:28336279-28336301 AGGGCAGGTGGGGGGCCTGTGGG + Intergenic
1124305462 15:28575327-28575349 AGGGCAGGTGGGGGGCCTGTGGG - Intergenic
1124381634 15:29172561-29172583 CGGGGTGATGAGAGGCCTGGGGG + Intronic
1124619484 15:31265690-31265712 GGGTCTGGTGGGGGGGCAGGAGG + Intergenic
1124636160 15:31366306-31366328 GGGGCTGGGGTCAAGCCTGGAGG - Intronic
1125004956 15:34806925-34806947 GGTGGTGGTGGGGGGCATGGAGG - Intergenic
1125084823 15:35717489-35717511 GGGGCTGGAGGGAGATCTGTGGG + Intergenic
1125503589 15:40253802-40253824 GGTGCTGCTGGGAGCACTGGAGG + Intronic
1125508414 15:40280525-40280547 GGGGGAGCTGGGAGGCGTGGAGG + Intronic
1125529054 15:40399624-40399646 GGGGGTGGTGGCGGGGCTGGGGG - Intergenic
1125694275 15:41622038-41622060 GGGGAGGGTGGGGGGCGTGGCGG + Intronic
1125751248 15:42030586-42030608 GGAGATGGTGGGAGGCCAGGTGG + Intronic
1125863423 15:43019733-43019755 GGGCGTGGTGGCAGGCGTGGTGG - Intronic
1126883677 15:53126287-53126309 GGGGTTGGGGGCAGGCCCGGAGG + Intergenic
1127206451 15:56725060-56725082 GGGGCTTGAGAGAGGCCTGGGGG - Intronic
1127503845 15:59579434-59579456 GGGGCCTGTGGGAGGGGTGGGGG - Intergenic
1127834181 15:62776862-62776884 GGGGCTGGTTGGGGGCATGGTGG + Exonic
1127841555 15:62836163-62836185 CTGGCTGATGGAAGGCCTGGTGG - Intronic
1128349303 15:66878279-66878301 GGTGCTGAGGGGAGGACTGGGGG + Intergenic
1128353954 15:66911431-66911453 GAGGCTGGAGCCAGGCCTGGAGG - Intergenic
1128467889 15:67928150-67928172 GGGGCTGCCGAGAGGGCTGGGGG + Intergenic
1128527409 15:68421896-68421918 GGGGCTGCTGGCAAGCCTGCTGG + Intronic
1128534766 15:68482081-68482103 GAGGCTGGTGGGGGACCGGGGGG + Intergenic
1129069343 15:72937874-72937896 GTGGGTGGTGGGAGGAGTGGAGG + Intergenic
1129232824 15:74206193-74206215 GGGGCAGGTGGGAGGCAATGGGG - Intronic
1129236897 15:74229087-74229109 GGTGCTTGTGGGGAGCCTGGGGG - Intergenic
1129356594 15:74995983-74996005 GGGGCTGGCGGGGGGGATGGAGG - Intronic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1129686349 15:77688219-77688241 TGGGCTGTTGGGAGGCTCGGGGG - Intronic
1129734651 15:77952772-77952794 GGAGCTGGTGGCAGGTCTGGGGG - Intergenic
1129840939 15:78743219-78743241 GGAGCTGGTGGCAGGTCTGGGGG + Intergenic
1130047119 15:80453994-80454016 AGGCCCGGCGGGAGGCCTGGAGG - Intronic
1130752260 15:86724690-86724712 GGGCCTGGTGGGAGGTGTTGGGG + Intronic
1131027025 15:89151963-89151985 GGGGCTGTTGGGAAGCCTGCTGG + Intronic
1131154847 15:90068409-90068431 GGCCCTGGTGGGAGGCCAGGTGG - Exonic
1131535380 15:93232858-93232880 GGGGGTGGTGGGGGGTGTGGGGG + Intergenic
1131753227 15:95532425-95532447 CAGCCTGGTGGGAGGGCTGGGGG - Intergenic
1131764472 15:95660439-95660461 GGGGCAGGAGGGAGGGCAGGGGG - Intergenic
1131829911 15:96347582-96347604 GAGGCTGGTGGAGGGGCTGGCGG - Intergenic
1131838087 15:96409880-96409902 GGGGCTGGTGGGCGGCGCGGCGG - Intergenic
1131850438 15:96537436-96537458 GGGGCTGGTTGGGGGGCTGGGGG - Intergenic
1132243708 15:100279001-100279023 GTGGTGGCTGGGAGGCCTGGTGG - Intronic
1132449978 15:101961712-101961734 GGGGCTGGAGGGAGGCGGGCGGG + Intergenic
1132452527 15:101976153-101976175 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
1132454371 16:14469-14491 GGGGCTGGTGACGGGCCCGGAGG - Exonic
1132483385 16:177441-177463 GGGGCTGGGGGGAGGCCCAAGGG - Exonic
1132498040 16:273107-273129 GGGGCTGTGGGGAGGCCCGGTGG - Intronic
1132500305 16:281963-281985 GGGGCTGGTGAGGAGCCTGGTGG + Intronic
1132579280 16:677707-677729 GGGGCCGGGGGGAGGGCCGGGGG + Intronic
1132588793 16:717406-717428 GGGGCTGGTAGGAGGGAGGGTGG + Exonic
1132591564 16:728447-728469 GGGGCCGGCGGGAGGCGGGGTGG - Intronic
1132607006 16:797770-797792 TGGGGTTGTGGGGGGCCTGGGGG + Intronic
1132608753 16:804706-804728 GAGGGTGGTGGGAGGCCTTGAGG + Intergenic
1132612608 16:824782-824804 GGGCCTGCTGAGAGCCCTGGTGG + Intergenic
1132658326 16:1050524-1050546 GGGGCAGGTGGGATGCCTGTGGG + Intergenic
1132734358 16:1378238-1378260 GGGGCTGTGGGCAGGCCTGCGGG - Intronic
1132742901 16:1424489-1424511 GAGGATGGTGGGAGCCCAGGAGG - Intergenic
1132814725 16:1820290-1820312 GGGTCTGGGGCGTGGCCTGGGGG + Intronic
1132889326 16:2196297-2196319 GGCGCGGGTGGGAGCCCCGGGGG - Intronic
1132931739 16:2462250-2462272 TGGGCTTGTGGGAGCCCTGGGGG + Intronic
1133024229 16:2980693-2980715 GTGTCGGGTGCGAGGCCTGGAGG - Intergenic
1133211099 16:4263890-4263912 TGGGCTTGTGTGTGGCCTGGAGG + Intronic
1133298784 16:4768933-4768955 GGGGTGGGTTGGCGGCCTGGAGG + Intergenic
1133309911 16:4838407-4838429 AGGGCTGCTGTGAGGACTGGAGG + Intronic
1133463014 16:6003468-6003490 GGGCCGGGTGGGAGGGGTGGTGG - Intergenic
1133506742 16:6419672-6419694 GGGAATGGTGGGATGCCTGTAGG - Intronic
1133525616 16:6602569-6602591 TGTGCTGCTGGGAGGCCAGGCGG + Intronic
1133921732 16:10159477-10159499 GGAGCTGATGGGATGCTTGGAGG + Intronic
1134135648 16:11674787-11674809 TGGGCAGGTGGGAGGCAGGGAGG - Intronic
1134432527 16:14224188-14224210 GGGCCTGGTGGGAATCATGGGGG - Intronic
1134624703 16:15715131-15715153 GGGGCTCGAGGGAGGCTGGGTGG + Intronic
1134693645 16:16207249-16207271 GGGGCTGGTGCCATGACTGGTGG - Intronic
1134978201 16:18587394-18587416 GGGGCTGGTGCCATGACTGGTGG + Intergenic
1135056121 16:19233272-19233294 GGAATGGGTGGGAGGCCTGGAGG + Intronic
1135222471 16:20624846-20624868 GGGGCAGGTGGGTGGAATGGGGG - Intronic
1135771426 16:25221150-25221172 AGGGCTGGAGGGAGGCTTGGAGG + Intronic
1136073944 16:27805202-27805224 GGGGGTGGGGGGAGGGCTGTGGG + Intronic
1136073973 16:27805267-27805289 GGGGGTGGGGGGAGGGCTGTGGG + Intronic
1136074044 16:27805428-27805450 GGGGGTGGGGGGAGGGCTGTGGG + Intronic
1136074059 16:27805461-27805483 GGGGGTGGGGGGAGGGCTGTGGG + Intronic
1136074116 16:27805590-27805612 GGGGGTGGGGGGAGGGCTGTGGG + Intronic
1136074159 16:27805687-27805709 GGGGGTGGGGGGAGGGCTGTGGG + Intronic
1136110176 16:28059632-28059654 GTGGCTGAGGAGAGGCCTGGAGG - Intronic
1136135719 16:28255825-28255847 GGGGCTGGGGGGAGGCGGGAAGG + Intergenic
1136282338 16:29221112-29221134 GGGGCGGCTGGGAGGCCCTGGGG + Intergenic
1136395884 16:29992155-29992177 GGGGCTGCTCCCAGGCCTGGGGG + Intronic
1136481354 16:30543926-30543948 GGGGTTGGTGAGAGGCTGGGAGG + Intronic
1136590807 16:31216614-31216636 GGGGCTGGCCGGAGGTCTGAGGG + Intronic
1136996683 16:35195562-35195584 GGGGCTGGTTGCTGCCCTGGCGG - Intergenic
1137627114 16:49916194-49916216 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
1137665260 16:50246016-50246038 GGGGCTGGGGGGCGCCCAGGAGG - Intergenic
1137673216 16:50291345-50291367 GGGGGTGGAGGGAGGGCGGGTGG + Intronic
1138114519 16:54349885-54349907 GGGCCTGGTGGGAGGCGTGTGGG + Intergenic
1138389206 16:56657986-56658008 GGGGCAGGTGGAAGGCGTGGTGG - Exonic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1138422599 16:56909415-56909437 GGGGATGGTGGTAGGGATGGGGG - Intronic
1138440935 16:57034698-57034720 GGGGGTGGGGGGAGCCCTGAGGG - Intronic
1138521727 16:57575095-57575117 AGGGCTGGAGGGCGGCCTGGAGG + Intronic
1139356022 16:66367425-66367447 GGTGCTGGTGGGAGGAATGGTGG - Intronic
1139471558 16:67180548-67180570 GGGACTGGTAGGCGGGCTGGGGG + Exonic
1139520671 16:67481014-67481036 GGGACTGGTGCGCGGCCTGAAGG - Exonic
1139531370 16:67544292-67544314 CGGGCTGCTTGGAGGCCTGAGGG - Exonic
1139622554 16:68158428-68158450 GGGTCAAGTGGGATGCCTGGAGG - Intronic
1139669357 16:68481430-68481452 GGGGTGGGTGTGAAGCCTGGCGG + Intergenic
1139670699 16:68491022-68491044 AGGGGTGGTGGGAGGGATGGGGG + Intergenic
1139797845 16:69497623-69497645 GGGGCTGGTGGGAGGAGGAGGGG - Intergenic
1139836170 16:69840306-69840328 GGGGCTGGGCGGGGGCCAGGAGG + Intronic
1139954316 16:70685988-70686010 GGGGCTGGCGGGCGGCGCGGGGG + Exonic
1140225137 16:73071010-73071032 GGGGCGGGGGGGAGGGTTGGGGG - Intergenic
1140467160 16:75191702-75191724 GGGGCTGGTGGGAGGTGTTTGGG - Intergenic
1140517404 16:75553970-75553992 GGGGATGGTGGGAGGAATTGGGG - Intronic
1140778374 16:78271744-78271766 GAGGGCGTTGGGAGGCCTGGCGG + Intronic
1140802265 16:78499359-78499381 GGGGCTGGTGGACAGCCAGGGGG - Intronic
1141123807 16:81385631-81385653 TGGGGTGGTGGGAGGCCCTGTGG + Exonic
1141158241 16:81611654-81611676 AGAGGTGGTGAGAGGCCTGGAGG - Intronic
1141400781 16:83745076-83745098 AGGGCTGGTGTGAGGGCTGAAGG + Intronic
1141440282 16:84025637-84025659 CTGGGTGGAGGGAGGCCTGGTGG - Intronic
1141503509 16:84460504-84460526 AGGGCAGGTGCGATGCCTGGGGG + Intronic
1141592262 16:85077017-85077039 CGGGTTGGGGGGGGGCCTGGAGG - Intronic
1141593870 16:85085950-85085972 GAGACTGGTGGGAAGCGTGGGGG + Intronic
1141689165 16:85586801-85586823 GGGGCTGCCAGGGGGCCTGGGGG - Intergenic
1141790438 16:86230742-86230764 AGGGCTGGAAGGAGGCTTGGAGG + Intergenic
1141837972 16:86555153-86555175 AGGGCAGGTGGGGGGCCTGGCGG - Exonic
1141895087 16:86954076-86954098 GGGGCTGGGGGGAGGGCCGGCGG + Intergenic
1141982903 16:87560982-87561004 GGGGCTGGAGCTAGGCCTGGAGG + Intergenic
1142086710 16:88187030-88187052 GGGGCGGCTGGGAGGCCCCGGGG + Intergenic
1142108727 16:88319758-88319780 TGGGCTGCAGGGAGGCCTGGGGG - Intergenic
1142194311 16:88732575-88732597 AGGGCTGGTGGGCGGCTGGGCGG - Intronic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142224921 16:88872660-88872682 GGGGCTGGCGGGAGAGCCGGCGG - Intergenic
1142228682 16:88889333-88889355 GGGGGTGGTGGGAGGGAGGGAGG + Intronic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142356367 16:89603797-89603819 GGGGCTGGAGGAAGCACTGGGGG + Intergenic
1142375806 16:89706623-89706645 GAGGCAGGTGGCAGGGCTGGTGG - Intergenic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142472698 17:172161-172183 AGGGCGTCTGGGAGGCCTGGAGG + Intronic
1142578853 17:927896-927918 GGGGTTGGTGAGAGTCCAGGTGG - Intronic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142613899 17:1124157-1124179 GGGGGTGGAGGGTGGCCGGGGGG + Intronic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142743108 17:1942045-1942067 GAGGCTGGTGGGAGGGGTGCAGG - Intronic
1142854437 17:2721998-2722020 AGAGCTGGGGGGAGGCCAGGCGG + Intergenic
1143010671 17:3864746-3864768 GGGGCCTGGGAGAGGCCTGGAGG - Intronic
1143033755 17:3982662-3982684 GAGGCTGGGTGGAGGCATGGAGG - Intergenic
1143164462 17:4891037-4891059 GGGGCCCTGGGGAGGCCTGGGGG - Exonic
1143189552 17:5031712-5031734 GGGGTGGGTGCGAGGCGTGGGGG + Intergenic
1143473502 17:7190602-7190624 GGGGTGGGAGGGAGGCCGGGGGG + Exonic
1143509657 17:7388510-7388532 GGGCGTGGAGGCAGGCCTGGAGG - Exonic
1143513133 17:7406637-7406659 GCGGCTGGTGGGGGGGCGGGGGG + Intronic
1143585537 17:7848602-7848624 GGTGGTGGTGGTAGGGCTGGTGG - Exonic
1143592381 17:7893491-7893513 GGGGGTGGTGGAAGGGCGGGGGG - Exonic
1143632017 17:8144926-8144948 GGGGCTGGGGGCTGGGCTGGGGG + Exonic
1143780237 17:9225454-9225476 GGGGCTGGCGGGGGGCCCTGAGG + Intronic
1144207996 17:12992886-12992908 GGAGCTGGCAGGCGGCCTGGAGG - Exonic
1144346380 17:14353515-14353537 GCGGATGGTGGGAGGGGTGGAGG + Intergenic
1144394774 17:14833650-14833672 GGTGTTGGTGGGAGGCTAGGTGG - Intergenic
1144710691 17:17399644-17399666 GAGGGAGGTGGGAGCCCTGGAGG - Intergenic
1144752124 17:17656185-17656207 GGGGCTGGTGGGAGGTGTTGGGG - Intergenic
1144922122 17:18772744-18772766 GGGGGTGGTGGGAGACGGGGAGG + Intronic
1144967889 17:19089366-19089388 GGGGGTGGCGGGAGGGTTGGGGG - Intergenic
1144980028 17:19162697-19162719 GGGGGTGGCGGGAGGGTTGGGGG + Intergenic
1144988194 17:19215535-19215557 GGGGGTGGCGGGAGGGTTGGGGG - Intergenic
1145007180 17:19344465-19344487 GGGCCAGGCGGGAGGCCAGGAGG + Intronic
1145059126 17:19721204-19721226 CTGTCTGGTGGGAGACCTGGGGG - Intergenic
1145261784 17:21358846-21358868 GGGGCAGCAGGGAGGCCTGCAGG + Intergenic
1145760971 17:27425357-27425379 TGGGAGGGTGGGAGGCCTCGGGG + Intergenic
1145786484 17:27597203-27597225 GTGGCTGGTGGGAGGCAGGTGGG + Intronic
1145980801 17:29010345-29010367 GGGGGTGGTGGGCAGGCTGGAGG - Intronic
1146003938 17:29149089-29149111 GGGCCTGGAGGCCGGCCTGGCGG - Intronic
1146075611 17:29725737-29725759 GGGGCCTGTCGGAGGGCTGGGGG + Intronic
1146161015 17:30559515-30559537 TGGGAGGGTGGGAGGCCTCGGGG + Exonic
1146259648 17:31413111-31413133 GGGAATGGAGGGAGGACTGGCGG + Intronic
1146384064 17:32353671-32353693 GGGGGCGGGGGGAGGGCTGGGGG + Intronic
1146442319 17:32907917-32907939 GGGGTGGGTGGGGAGCCTGGGGG + Intergenic
1146855666 17:36257210-36257232 TGGGAGGGTGGGAGGCCTTGGGG - Intronic
1146864955 17:36331165-36331187 TGGGAGGGTGGGAGGCCTTGGGG + Intronic
1146871572 17:36381121-36381143 TGGGAGGGTGGGAGGCCTTGGGG - Intronic
1146878931 17:36432203-36432225 GGGGAGGGTGGGAGGCCTTGGGG - Intronic
1146882871 17:36453349-36453371 GGGGAGGGTGGGAGGCCTTGGGG - Intergenic
1146968601 17:37054174-37054196 GTGGCTGGTGGGGGGCGTGTGGG + Intronic
1147067814 17:37931759-37931781 CGGGAGGGTGGGAGGCCTTGGGG + Intronic
1147074458 17:37981745-37981767 TGGGAGGGTGGGAGGCCTTGGGG - Intronic
1147079345 17:38011314-38011336 TGGGAGGGTGGGAGGCCTTGGGG + Intronic
1147085981 17:38061284-38061306 CGGGAGGGTGGGAGGCCTTGGGG - Intronic
1147095285 17:38135256-38135278 CGGGAGGGTGGGAGGCCTTGGGG + Intergenic
1147101926 17:38185249-38185271 TGGGAGGGTGGGAGGCCTTGGGG - Intergenic
1147285937 17:39402336-39402358 GGTGCTGCAGGGAGGCCTGGGGG + Intronic
1147322171 17:39653095-39653117 GGGGGTGGTGGCAGGCCCAGAGG + Intronic
1147322712 17:39656019-39656041 TGGGTGGGTGGCAGGCCTGGGGG + Intronic
1147384671 17:40074264-40074286 GTGGCAGGTGGGAGGGCTGGGGG - Exonic
1147562097 17:41515602-41515624 GGGGCTCATTGGTGGCCTGGAGG - Exonic
1147567410 17:41546247-41546269 GGGGCTGGCGGGGGGCCTCCTGG - Intergenic
1147644183 17:42024010-42024032 GTGGCTGGGGCGTGGCCTGGCGG - Exonic
1147667930 17:42160332-42160354 GAGCCTGCTGGGTGGCCTGGGGG + Exonic
1147755209 17:42762899-42762921 AGGGGAGGAGGGAGGCCTGGTGG - Exonic
1148437199 17:47694035-47694057 GGGGTTGGGGGGAGGGGTGGGGG + Intergenic
1148618425 17:49016783-49016805 GGGGCGGGCGGGCGGGCTGGCGG - Intronic
1148754388 17:49965093-49965115 GGGGCCGGTGGGTGGGATGGAGG + Intergenic
1148755577 17:49971461-49971483 GGGCCTGGAGGGAGGCCTTGGGG + Intronic
1148795874 17:50196417-50196439 GGGGCAAGATGGAGGCCTGGGGG - Intronic
1149124892 17:53217089-53217111 GGGGCTTGTCGGGGGCCGGGGGG - Intergenic
1149571275 17:57674085-57674107 GGGGATGGAGGGAGGGATGGGGG - Intronic
1149846518 17:60011759-60011781 TGGGAGGGTGGGAGGCCTTGGGG - Intergenic
1149866549 17:60154238-60154260 GGGGTGGGTGGGAGGGGTGGGGG + Intronic
1150084864 17:62268334-62268356 TGGGAGGGTGGGAGGCCTTGGGG - Intergenic
1150254112 17:63730483-63730505 GAGGATGGTTGGAGCCCTGGAGG - Intronic
1150267751 17:63842233-63842255 GAAGCAGCTGGGAGGCCTGGGGG - Intronic
1150607590 17:66707448-66707470 GAGGCTGGTTGGAGGCCTTCAGG + Intronic
1150652954 17:67021740-67021762 GGGGCTGGTGTCAGGGCTGCTGG + Intronic
1150656229 17:67041635-67041657 GGAGCAGGTGGAAGGGCTGGAGG - Intergenic
1151368215 17:73630697-73630719 CGGGGAGGTGGCAGGCCTGGGGG + Intronic
1151456023 17:74226271-74226293 GGGGCTGGGGCCAAGCCTGGAGG + Intronic
1151471182 17:74318843-74318865 GCTGGTGGAGGGAGGCCTGGAGG + Intergenic
1151571025 17:74925391-74925413 GGGGAGGGTGGGAGGACAGGTGG - Intronic
1151678178 17:75610515-75610537 GGGGCCCAGGGGAGGCCTGGAGG - Intergenic
1151767603 17:76140323-76140345 CGGGCCGGAGGGCGGCCTGGAGG - Exonic
1151791267 17:76307403-76307425 AGGCCTGGAGGGCGGCCTGGAGG + Intronic
1151817192 17:76477134-76477156 CAGGCTGGTGGCTGGCCTGGAGG + Intronic
1151876460 17:76870136-76870158 GGGGCTGGGCCGAGACCTGGAGG - Intronic
1152139642 17:78528893-78528915 GTGTCTGGTGGGAGTGCTGGTGG - Intronic
1152273451 17:79339511-79339533 GGAGCTGGTGGGAGGGAAGGAGG + Intronic
1152422418 17:80201241-80201263 GTGGATGGTGGAAGCCCTGGGGG + Intronic
1152488005 17:80608161-80608183 GGGGCAGGTGGCAGGAGTGGGGG - Intronic
1152588790 17:81200922-81200944 GGAGCTCGAGGGAAGCCTGGTGG + Intronic
1152597249 17:81243819-81243841 GGGGCTGGGAGGAGGCTGGGAGG - Intergenic
1152597277 17:81243878-81243900 GGGGCTGGGAGGGGGCCGGGAGG - Intergenic
1152662929 17:81551339-81551361 GGGGAAGGTGGGAGGCCATGTGG - Intronic
1152703334 17:81830347-81830369 GGGGCTGGGGCCAGGCGTGGTGG + Intronic
1152783134 17:82235267-82235289 AGGGCCGGTGGGAGGCAAGGGGG + Exonic
1152800326 17:82327928-82327950 GGGGCTGGTGGACGGGCTGGGGG - Intronic
1152801172 17:82331268-82331290 GGAGCTGGGGGGAGACCGGGAGG + Intronic
1152814683 17:82400267-82400289 GGGGCATCTGTGAGGCCTGGAGG - Intronic
1152930985 17:83109760-83109782 GTGGCCAGTGGGAGGCCTGCTGG - Intergenic
1153085744 18:1284832-1284854 GAGGCTGGAGGTGGGCCTGGTGG + Intergenic
1153140986 18:1972240-1972262 GGGGCTGGTTCCAGGCCTGGTGG - Intergenic
1153322090 18:3783605-3783627 GGGGCTGTGGGGAGGGCTGGAGG + Intronic
1153665460 18:7364190-7364212 GGGGCTGTAGGGTGGCCAGGAGG - Intergenic
1153881074 18:9422230-9422252 GGGGCGGGTGGGAGGTGGGGAGG + Intergenic
1154095690 18:11413212-11413234 GGTGCTGGGCTGAGGCCTGGGGG - Intergenic
1154250240 18:12738241-12738263 GGGGCACGTGGGAAGCTTGGCGG - Intergenic
1154502116 18:15002249-15002271 GGGGCTGGGGAGAGGCCAGTGGG - Intergenic
1155156708 18:23163571-23163593 GGGGCTGGGGAGAGGATTGGAGG + Intronic
1155354181 18:24935651-24935673 TGGGCTGGTGGGTGCACTGGAGG - Intergenic
1156437471 18:37148129-37148151 GGGCCTGTTGGGAGGTGTGGTGG - Intronic
1156453802 18:37281580-37281602 GAGGCTGCTAGGAGACCTGGAGG + Intronic
1156497696 18:37536827-37536849 AGGCCTGGAGGGAGGCTTGGAGG + Intronic
1156553139 18:38039637-38039659 GTGCCTTGTGGGAGCCCTGGGGG + Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157322728 18:46646899-46646921 GGAGCTGGAGGATGGCCTGGGGG - Intronic
1157523300 18:48360375-48360397 TGGGATGGTGGTAGGCATGGGGG + Intronic
1157590843 18:48835819-48835841 AGGGCAGGTGGGGGGCTTGGTGG - Intronic
1158300250 18:56043999-56044021 GGGCCAGGTGTGAGGCCAGGTGG + Intergenic
1158471805 18:57743664-57743686 GGCGCAGGTGGGAGATCTGGGGG + Intronic
1158525163 18:58206770-58206792 GGTGTTTGTGGGAGGCATGGTGG + Intronic
1158855867 18:61542952-61542974 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
1158885340 18:61821647-61821669 GGTACTGGTTGGTGGCCTGGGGG - Intronic
1159460258 18:68714838-68714860 GGGTCTGGGGCGAGGCCTGCGGG - Intronic
1160024741 18:75208559-75208581 GGGGGAGGAGGGAGGGCTGGAGG + Intronic
1160034151 18:75285877-75285899 GGGGCAGGTGGGGGGTGTGGGGG - Exonic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160163257 18:76491371-76491393 GGGGCGGGAGCGAGGCCCGGAGG - Intronic
1160225675 18:77009091-77009113 GGGTCTGGAGGGGGGCCTGGTGG + Intronic
1160241184 18:77124426-77124448 GTGGGGGGTGGGAGGCGTGGTGG - Intronic
1160453515 18:78980366-78980388 GGGGCTGCGGGGTGGCCGGGGGG + Intronic
1160515184 18:79475703-79475725 AGGTCTCCTGGGAGGCCTGGTGG - Intronic
1160541501 18:79626335-79626357 AGGGCTGGTGGGACGGCTGCCGG + Intergenic
1160563888 18:79775048-79775070 GGGGCTGGGGAGAGGGTTGGTGG + Intergenic
1160635276 19:70836-70858 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
1160675562 19:389412-389434 AGAGTTGGTGTGAGGCCTGGTGG - Intergenic
1160724230 19:610578-610600 GGGGGTGGCGGGGGTCCTGGGGG - Intronic
1160756048 19:757636-757658 GGGGCTTGTTGAAGGCCTTGGGG - Exonic
1160797707 19:953459-953481 GGGGGGTGTGGGAGGCCTGGGGG - Intronic
1160874781 19:1291881-1291903 GGGCCTGGAGGGCTGCCTGGAGG + Intronic
1160893721 19:1393162-1393184 GGGGATGGGGCGAGGCCTCGTGG + Intronic
1160960300 19:1717959-1717981 GGGGCAGGTGGGTGGGTTGGTGG + Intergenic
1160960343 19:1718157-1718179 GGGGCAGGTGGGTGGGTTGGTGG + Intergenic
1161002728 19:1919047-1919069 GGGCCTGCTGGGAAGCCAGGCGG + Intronic
1161038501 19:2098011-2098033 GAGGCTGAGGGGAGCCCTGGCGG + Intronic
1161068109 19:2248193-2248215 GGGGCTGGTGGGTGGACTCCGGG - Exonic
1161075508 19:2283288-2283310 GGGGATTGGGGGAGGCCAGGGGG - Intronic
1161160152 19:2757297-2757319 GGGGCTGGGGGGTGGCCAGCAGG - Intronic
1161222876 19:3126091-3126113 GAGGGAGGTGGGAGCCCTGGAGG + Intergenic
1161250415 19:3276795-3276817 GTGTCTGGTGGGAGGCGGGGGGG + Intronic
1161270152 19:3385206-3385228 TGGGCAGGTGGGAGGGTTGGGGG - Intronic
1161284899 19:3463912-3463934 GGGGCTGGTGGAGAGGCTGGAGG - Intronic
1161286455 19:3471016-3471038 AGGGATGGAGGGAGGACTGGAGG + Intergenic
1161296382 19:3522655-3522677 GGGGCTGGGAAGAGTCCTGGAGG - Intronic
1161303745 19:3555982-3556004 AGGGCTGTTGGGAGGGCAGGAGG - Intronic
1161480041 19:4505871-4505893 GGGGCTGAGGGGAGGCCGGGCGG - Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161604381 19:5206598-5206620 GGGGCCGGTGGGGGGGCTCGAGG + Exonic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161717893 19:5887070-5887092 GGGGCTGGAGCCAGGCATGGTGG - Intronic
1161978216 19:7617688-7617710 GGGGCTGGTGGGTGGGTGGGTGG + Intronic
1161999202 19:7732267-7732289 TGGGCTGGAGTGAGGCCGGGCGG + Intronic
1162135099 19:8550520-8550542 AGGGCTGGATGGAGGCCTGTGGG - Intronic
1162145245 19:8609323-8609345 GGGGAGGGTGCCAGGCCTGGAGG + Intronic
1162146667 19:8616575-8616597 GGGGGAGGAGGGAGTCCTGGGGG + Intergenic
1162155153 19:8672975-8672997 GAGGCTGGTGGGGGCCCAGGTGG + Intergenic
1162315246 19:9934844-9934866 GGGGGTGTTGGGAGGAATGGAGG - Intronic
1162329470 19:10018747-10018769 GGGCCTGGTGGGGCCCCTGGAGG + Exonic
1162520892 19:11178705-11178727 GGAACTTCTGGGAGGCCTGGAGG + Exonic
1162660880 19:12168359-12168381 GGGGCTTGTCGGGGGCGTGGTGG - Intronic
1162782724 19:13014874-13014896 GGGGCTGGTGGTAGGCGAGGTGG + Intronic
1162789220 19:13054445-13054467 GGGGCTGGAGGTGGGCTTGGTGG + Intronic
1162793260 19:13073854-13073876 GGAGGTGGGGGGAGGCCTGATGG - Intronic
1162954414 19:14090414-14090436 GGGCCGGGCGGGAGGCATGGCGG - Exonic
1163016903 19:14461902-14461924 AGTGATGGTGGGTGGCCTGGGGG + Intronic
1163104797 19:15117045-15117067 GGGGCTGGGTGGAGGCCAGGGGG - Intronic
1163157083 19:15445466-15445488 AAGGCTGGTGGGAGGCCTGGGGG + Intronic
1163375451 19:16927595-16927617 GGTGCAGGATGGAGGCCTGGGGG - Intronic
1163517890 19:17775808-17775830 GGGGGGGGTGGGAGTGCTGGTGG + Intronic
1163533006 19:17861693-17861715 GGAGCGGGTGGGTGGCATGGTGG + Intronic
1163573561 19:18097754-18097776 GGGGCCGGGGGCGGGCCTGGCGG + Intronic
1163622121 19:18367347-18367369 GGGTGTGGTGGGAAGGCTGGGGG + Exonic
1163676128 19:18656170-18656192 GGGGTTGGTGGGGGACCTGCAGG + Intronic
1163695033 19:18759801-18759823 GAGGACGGTGGGGGGCCTGGGGG - Intronic
1163831771 19:19550476-19550498 GGGACTGGCGGGAGGCCTCAAGG + Intergenic
1163861872 19:19747068-19747090 TGGGAGGGTGGGAGACCTGGGGG + Intergenic
1164137442 19:22427605-22427627 GGGGCTTGAGGGAGGGCTGGTGG - Intronic
1164393094 19:27842587-27842609 GGGGTTGGTGAGAGTCTTGGAGG + Intergenic
1164468253 19:28506403-28506425 GGGGCTGGGGTGAGGGGTGGTGG - Intergenic
1164479838 19:28602803-28602825 GGGGTTGGTAGGAGGACTAGGGG - Intergenic
1164676011 19:30102070-30102092 GGGCCTGGTGGGAGGCTTTTGGG - Intergenic
1165046400 19:33108297-33108319 GGGCCTCGTGGGGAGCCTGGAGG - Intronic
1165060149 19:33201213-33201235 GAGGCTGGGGGGAGGGATGGAGG + Intronic
1165071887 19:33260667-33260689 GGGCCGGGTGGGAGGCCTCGTGG - Intergenic
1165074470 19:33273284-33273306 GTGGCAGGTGGGTGGCCAGGAGG + Intergenic
1165296064 19:34926887-34926909 GGCGCCGGTGGGCGGCCTTGTGG + Exonic
1165329722 19:35134755-35134777 GCGGATGGAGGGCGGCCTGGTGG - Exonic
1165330385 19:35138701-35138723 GGGGCTGGAGGGGGGCCAGGGGG - Intronic
1165435753 19:35793891-35793913 GGGGATTGGCGGAGGCCTGGAGG - Intergenic
1165902047 19:39173649-39173671 GGCTCGGGTGGGAGGCCGGGAGG - Exonic
1166043824 19:40218031-40218053 GGGGCTGCTGGTGGGCCCGGGGG + Exonic
1166075794 19:40413241-40413263 GGTGCTGGGAGGGGGCCTGGGGG - Intronic
1166385193 19:42376680-42376702 GGGGGTGGTGGGGGTGCTGGGGG + Exonic
1166563134 19:43746737-43746759 GGGGGTGGTGGGATGGATGGGGG + Intronic
1166746725 19:45145288-45145310 GGGGCGGGCGGAAGGCCGGGTGG + Intronic
1166812423 19:45522396-45522418 GGGGGTGGGGGGGGACCTGGAGG - Exonic
1167171618 19:47836180-47836202 TGGGCTGGTGTGAGGCCCTGAGG - Intronic
1167423081 19:49415171-49415193 TGAGGTGGGGGGAGGCCTGGAGG + Intronic
1167463044 19:49636311-49636333 GGGGCTGGTGGGAGGTTGGCTGG + Intronic
1167517645 19:49932637-49932659 GGGGCTGGTGGTAGTGGTGGTGG - Exonic
1167567919 19:50268386-50268408 GGGTCTGGAGGGTGGCCTGGTGG - Intronic
1167924926 19:52813599-52813621 GGGGTGGGTGGTAGACCTGGAGG - Intronic
1168064022 19:53909348-53909370 GTGGGGGGTGGGAGGCCGGGAGG + Exonic
1168153341 19:54460589-54460611 GGGGCTCGGGGGGGGCCCGGGGG - Intronic
1168339653 19:55615772-55615794 GGCGCTCGGGGGCGGCCTGGTGG - Exonic
1168405551 19:56108440-56108462 GAGGCAGCTGGGAGGACTGGAGG - Intronic
1168406981 19:56115640-56115662 GGTGCGGGTGGGAGGCATGCGGG - Intronic
1168563500 19:57403594-57403616 GGGGCTGGTGGAAGGCAGGAGGG - Intronic
1168642749 19:58040767-58040789 GGGGCTGGGGTGAGGCCCAGAGG - Intronic
1202694152 1_KI270712v1_random:112292-112314 GGGGCCGGTGTGAGGGCTGCGGG - Intergenic
925147664 2:1591849-1591871 GGGGCAGGTGGAGGGGCTGGAGG + Intergenic
925356884 2:3248037-3248059 GGGCCTGGTGGGAGGTATTGGGG + Intronic
925415596 2:3668136-3668158 AGGGGTGTTGGGATGCCTGGGGG + Intronic
925448235 2:3946259-3946281 GGGGCAGGGGCCAGGCCTGGAGG + Intergenic
925675307 2:6356070-6356092 GGGGCTGATTGAGGGCCTGGGGG + Intergenic
926163205 2:10502349-10502371 GGGGGTGGAGGGGGGCGTGGCGG - Intergenic
926165121 2:10517730-10517752 GGGTCTGCTGGGAGGCCTTTGGG - Intergenic
926191297 2:10729882-10729904 GGGGCTGGGTGGTGGCCTGCTGG + Intronic
926728122 2:16014322-16014344 GGAGCTGGTGGGAGGACTGAGGG - Intergenic
927108199 2:19845402-19845424 GGGGCTGGCAGGGGGCCAGGAGG + Intergenic
927343537 2:22010017-22010039 GGGCCTGGTGGGAGGCATTTAGG + Intergenic
927517745 2:23682004-23682026 GGGGCCTGTGGGACACCTGGGGG - Intronic
927596655 2:24403212-24403234 GGGGCTGGGGGGAGGGCGGGCGG - Intergenic
927596681 2:24403262-24403284 GGTGGTGGAGGGAGGCCTGGGGG - Intergenic
927596692 2:24403286-24403308 GGTGGTGAAGGGAGGCCTGGGGG - Intergenic
927946603 2:27138478-27138500 GGTGCTGGTGGCAGGCCAAGGGG + Exonic
928169470 2:28994137-28994159 GAGGCTGAAGGGAGGGCTGGAGG + Intronic
928300894 2:30122618-30122640 GGGGCTTGGAGGAGGCCTGGTGG + Intergenic
928593923 2:32842919-32842941 GGGGCAGGTGGGTGGCGGGGCGG - Intergenic
929668208 2:43850069-43850091 GGGTGTGGTGGCAGGCATGGTGG + Intronic
929681689 2:43998267-43998289 GGGGGTGGAGAGGGGCCTGGAGG + Intergenic
929761060 2:44806539-44806561 GGGACTGGAGGGAGGGCAGGAGG - Intergenic
930118465 2:47740196-47740218 GGGCCTGGTGGGAGGCATTTGGG - Intronic
931432101 2:62216353-62216375 TGGGTGGGAGGGAGGCCTGGGGG + Intronic
931704453 2:64935814-64935836 GGGCCTGGTGGGAGGCGTTTGGG + Intergenic
932415970 2:71574150-71574172 GAGGCCGGTGGGAAGGCTGGGGG - Intronic
932447685 2:71790857-71790879 GAGGCTGCCAGGAGGCCTGGAGG - Intergenic
932459383 2:71872599-71872621 GGGGCTGGTGTCAGGCAGGGCGG + Intergenic
932490563 2:72117367-72117389 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
932736571 2:74258856-74258878 GGGGTGGCTGGAAGGCCTGGAGG + Intronic
932767717 2:74481979-74482001 GGGCCTGGTCGGGGGCGTGGCGG - Exonic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933749126 2:85591856-85591878 GGATATGGTGTGAGGCCTGGGGG + Exonic
933764053 2:85695235-85695257 CTGGCTGGTGGGAGTCCAGGAGG - Intronic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
934042125 2:88136408-88136430 TGGGATGGGGGGAGACCTGGAGG + Intergenic
934158682 2:89227607-89227629 GGGCCTGGTGGGAGGTTTGGGGG + Intergenic
934208592 2:89954820-89954842 GGGCCTGGTGGGAGGTTTGGGGG - Intergenic
934563515 2:95325251-95325273 GGGACTGGAGTGGGGCCTGGCGG + Intronic
934650082 2:96085648-96085670 GGGGCTGCTGAGAGGCCCTGGGG + Intergenic
935080592 2:99789575-99789597 GGGGATGCAGAGAGGCCTGGTGG - Intronic
935361643 2:102250841-102250863 GGGGCTGGGCGGGGGCGTGGGGG + Intergenic
935397061 2:102619926-102619948 GGGGCCCGTGGGCGCCCTGGCGG + Exonic
935471416 2:103464978-103465000 GGGTCTGGTGGGAGGCGTATGGG + Intergenic
935782285 2:106518880-106518902 GGGGATGGTTGGAGGGCTGAAGG - Intergenic
935800732 2:106692655-106692677 AAGGCTAGTGGGAGTCCTGGGGG - Intergenic
935832744 2:107017458-107017480 GGGGCTGGTGGGGGGGCGAGTGG - Intergenic
936501802 2:113072551-113072573 TGGGCTGGTGGAAGCCTTGGTGG + Exonic
936566204 2:113584207-113584229 GGGGCTGGAGGGAGGCGGGCGGG + Intergenic
936568739 2:113598627-113598649 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
937321611 2:120964279-120964301 GGGGCTGGAAGGAGACCTGGTGG + Intronic
937900781 2:127017487-127017509 CGGGGTGGTGGGAGGCGAGGTGG - Intergenic
938074142 2:128322885-128322907 GGGACTGTGGGCAGGCCTGGCGG + Intergenic
938104248 2:128519569-128519591 AGGACTGGTGGGAGGCAAGGGGG - Intergenic
938227517 2:129628498-129628520 AGGGCTGGAGGCAGGGCTGGAGG + Intergenic
938450201 2:131411652-131411674 GGGGCTGTGGGGTGGCCTGGGGG - Intergenic
938501294 2:131832421-131832443 GGGGCTGGGGAGAGGCCAGTGGG - Intergenic
938562792 2:132489418-132489440 GGGGCTGGCGGCAGGCCGTGGGG + Intronic
939985966 2:148830150-148830172 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
940207039 2:151214264-151214286 GAGGCTGGTGGGAGGCAGGTGGG + Intergenic
941060562 2:160842503-160842525 GGGGTGGGTGGGAGGTCCGGGGG - Intergenic
942265870 2:174225051-174225073 GGGCCTGGTGGGAGGCGTTTGGG + Intronic
942364718 2:175212770-175212792 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
942519033 2:176783594-176783616 AGGGCTGTTGGCTGGCCTGGTGG - Intergenic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
945094871 2:206209532-206209554 GGGGCATGTGGGAGGGCTAGGGG - Intronic
945255689 2:207801249-207801271 GGGGTTGGTGGGGGGCGGGGTGG - Intergenic
947144971 2:227055992-227056014 GGGATTCCTGGGAGGCCTGGGGG + Exonic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947534127 2:230930125-230930147 GGAGCTGCTGGGAGGCCAGAGGG - Intronic
947569597 2:231221914-231221936 GGTGGGGGTGGGAGGCATGGAGG + Intronic
947586825 2:231361691-231361713 GGGGCAGCTGGCATGCCTGGTGG - Intronic
947749818 2:232526239-232526261 GGGGCTGCTGGCTGCCCTGGCGG + Exonic
947841691 2:233211877-233211899 GTGGCAGGTGGCAGGGCTGGGGG - Intronic
948423490 2:237874475-237874497 GGGGCTGGTGTGAGCAGTGGAGG - Intronic
948478542 2:238236661-238236683 AGGGCTTGTGGGGAGCCTGGGGG + Intergenic
948514965 2:238498140-238498162 GGTGCTGAATGGAGGCCTGGTGG + Intergenic
948536645 2:238652003-238652025 GGGGCTGGTGGGAGGTGTCTGGG - Intergenic
948748060 2:240110071-240110093 GGGGCTGGAGGGAGGGCAGGAGG + Intergenic
948765035 2:240215230-240215252 GCAGCAGGTGGAAGGCCTGGTGG + Intergenic
948817822 2:240522020-240522042 CAGGCTGGTGGGGAGCCTGGCGG + Intronic
948830095 2:240594459-240594481 CAGGCTGGGGGGAAGCCTGGAGG - Intronic
948847598 2:240690583-240690605 GGTGCTGGAGTGAGTCCTGGGGG + Intergenic
949032214 2:241802553-241802575 GGGGCCAGAGGGAGGCCGGGTGG + Intronic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1168851804 20:982001-982023 GTTTCTGGTGGGAGCCCTGGGGG + Intronic
1168948667 20:1781872-1781894 GGGGCTCGGGGGAGGTCAGGGGG - Intergenic
1169075992 20:2760076-2760098 GAGGCAGGTGAGAGGCCGGGCGG - Exonic
1169144094 20:3241115-3241137 GAGGCAGGTGGGAGGACTGAAGG - Intergenic
1169209189 20:3756194-3756216 GTGGCTGGTGCCAGGCCTGTGGG - Intronic
1169354712 20:4897003-4897025 GGACTTGGTGGGAGCCCTGGAGG - Intronic
1169414240 20:5402458-5402480 GGGCCTGGTGGGAGGTCTTTGGG - Intergenic
1170155257 20:13263325-13263347 GGGGGTGGTGGGGGGCTTGTTGG - Intronic
1170599610 20:17831269-17831291 GGGGCTAGGGTGAGGGCTGGCGG + Intergenic
1171077839 20:22147254-22147276 ATGGCAGGTGGGAGGCCTGGGGG - Intergenic
1171210120 20:23310427-23310449 GGGGCTGGTGGGCTCCCTGCAGG - Intergenic
1171412913 20:24958609-24958631 GGGGCTGGAGTGAGGGCTGCAGG + Intronic
1172130339 20:32650770-32650792 GGCGCTGGTGGCTGGGCTGGGGG + Intergenic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1172587353 20:36093836-36093858 GGGGCTGGGGGGAGGCCGGAGGG - Intronic
1172874248 20:38154739-38154761 GAGGTTGGGGGGAGGGCTGGGGG - Intronic
1173026347 20:39310831-39310853 CGGGCTGCTGGGAGGCCTCCTGG + Intergenic
1173579200 20:44135014-44135036 GGGGTAGGGGGGATGCCTGGGGG + Intronic
1173824056 20:46035962-46035984 GGGGCTTGGCAGAGGCCTGGGGG + Intronic
1173896095 20:46551915-46551937 GGGGCTCAGGGGAGGCCTGCTGG - Intergenic
1173944603 20:46940804-46940826 CTTGCTGGTGAGAGGCCTGGGGG - Intronic
1174381687 20:50159777-50159799 GGGGGTGGGGGGTGTCCTGGAGG + Intergenic
1174528521 20:51192602-51192624 GGGGGTGGTGGGTCGGCTGGAGG - Intergenic
1175050022 20:56146677-56146699 GGGGATGGGGGGAGGGGTGGGGG - Intergenic
1175073986 20:56358742-56358764 GGGGCTGGTGGGCGGAGAGGAGG + Intergenic
1175173099 20:57093335-57093357 GAGGCTGGTGGGAGGGTGGGTGG + Intergenic
1175237838 20:57525925-57525947 GGGGTTCTTGGGAGACCTGGGGG + Intergenic
1175237908 20:57526108-57526130 AGGGGTGCTGGGAGACCTGGGGG + Intergenic
1175238031 20:57526445-57526467 GGGGGCGCTGGGAGACCTGGGGG + Intergenic
1175267089 20:57709614-57709636 GGGGCTCGGGGGCGGCCGGGGGG + Exonic
1175398517 20:58685006-58685028 GGGGCTGGGGCCAGGCATGGTGG - Intronic
1175406945 20:58741163-58741185 GGTGCGGGTGGGTGGCGTGGGGG - Intergenic
1175423999 20:58852999-58853021 GGGGCTGGGGGGCAGCCTGGGGG + Exonic
1175785974 20:61712047-61712069 GAGGCTGGAGAGAGGCTTGGAGG + Intronic
1175816677 20:61886713-61886735 GGGGCTGGTGAGTGCTCTGGAGG - Intronic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1175839019 20:62015004-62015026 TGGGCTGGTTGGGGGCATGGGGG - Intronic
1175883188 20:62272217-62272239 GGGGCTGGCAGGAGGCCCTGTGG - Exonic
1175903114 20:62367618-62367640 GGAGCTGGTGGGCGCTCTGGGGG - Intergenic
1175903973 20:62370912-62370934 GAGGCAGGTGGCAGCCCTGGGGG - Intergenic
1175921097 20:62450956-62450978 GGAGGTAGAGGGAGGCCTGGTGG - Intergenic
1175988142 20:62774519-62774541 TGGGCTGGCGGGAGGCATGGAGG + Intergenic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1176094311 20:63332976-63332998 GGGGCTGATGGGAGACGTGCAGG - Intronic
1176138581 20:63535750-63535772 GGGGGGGGCGGGAGGCCAGGTGG - Intronic
1176138774 20:63536162-63536184 GGAGGGGGTGGGAGGCCAGGTGG - Intronic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1176165795 20:63672855-63672877 GGGTCTGGTGAGCGGCCTGTGGG - Intronic
1176295259 21:5068767-5068789 GGGGCAGGGGGGAGGCCTCCTGG - Intergenic
1176300313 21:5096170-5096192 GGGGCGGGCGGGTGGCCTGAGGG - Intergenic
1176654333 21:9576379-9576401 GGCTCTGCTGGGAGCCCTGGGGG - Intergenic
1176663208 21:9660130-9660152 GGGGCTTGTGGGCAGGCTGGCGG - Intergenic
1176918884 21:14662333-14662355 GAGGCTCTTGGGAGGCCTGATGG - Intergenic
1177166878 21:17613033-17613055 GGGGCTCGGGGGTGGCCTCGCGG - Intergenic
1178205106 21:30455914-30455936 GGGCCTGGTGGGAGGTGTTGAGG - Intergenic
1178231928 21:30795697-30795719 CGGGATGGTGGGAGGGCTGAAGG + Intergenic
1178707331 21:34886807-34886829 GAGGGTGGTGGGAGGACAGGCGG - Intronic
1178742952 21:35220219-35220241 GGGCCTGTTGGGAGGCAGGGTGG + Intronic
1178893810 21:36542687-36542709 GGGGCTGCTGGGGGGCCTCTGGG - Intronic
1179110916 21:38444364-38444386 GGGGCTGCTCGGAGGACTGAGGG + Intronic
1179176343 21:39010766-39010788 GGAGCTGGAGGGAGGCCTGGGGG - Intergenic
1179476998 21:41653354-41653376 GGGGCTGGGGGAAGGAATGGTGG - Intergenic
1179529741 21:42010443-42010465 GGGGCGGGGGGGGGGCCTCGCGG + Intergenic
1179626774 21:42653553-42653575 GGGGCGGGCGGGCGGCCGGGAGG + Intergenic
1179635944 21:42709292-42709314 GGGCCTGTTGGGAGGGTTGGGGG + Intronic
1179638894 21:42733902-42733924 GGGGCTGGTGGGAGGTGTTTGGG + Intronic
1179861790 21:44193361-44193383 GGGGCAGGGGGGAGGCCTCCTGG + Intergenic
1179907951 21:44433929-44433951 GGGGCTGGGTGGAGGCAGGGAGG + Intronic
1179943831 21:44657122-44657144 GGTGCTGGTGGGTGGTCTGGGGG - Intronic
1179978010 21:44881647-44881669 GGGTCTGGGGTGAGGCATGGAGG + Intergenic
1180005344 21:45018338-45018360 GGGGCTGCTGGGGGTCCTGCCGG - Intergenic
1180201845 21:46229088-46229110 GGGGCTGGTGGGTGGGGAGGTGG + Intergenic
1180201859 21:46229115-46229137 GGGGCTGGTGGGTGGGGAGGTGG + Intergenic
1180904644 22:19400889-19400911 GGGGCTGATGGTTGGCCTGTGGG - Intronic
1180956197 22:19742500-19742522 GGGGCTGGTGGGTTTCCTGGGGG - Intergenic
1181005593 22:20012061-20012083 GGGGACTTTGGGAGGCCTGGAGG - Intronic
1181030986 22:20148826-20148848 GGGGCGCGCGGGGGGCCTGGGGG + Intronic
1181061584 22:20284471-20284493 GGGGCTGGTGAGAGCCCGGTGGG + Intergenic
1181522417 22:23457210-23457232 GTGGCTGGCGGGTGCCCTGGGGG - Intergenic
1181571127 22:23768237-23768259 GGGGTTGTTGCGAGCCCTGGAGG + Exonic
1181573276 22:23779281-23779303 GAGGCTGCTGGCAGGCCGGGGGG - Exonic
1181956477 22:26590751-26590773 GGGGGTAGTGGCAGGGCTGGGGG - Intronic
1181997917 22:26897641-26897663 GAGGCTGGTGGGAGGTGAGGGGG + Intergenic
1182072961 22:27476258-27476280 GGGGATGGTGAGAGCCCAGGAGG + Intergenic
1182424437 22:30264651-30264673 GGGGCTGGTGGGATGCCCGTGGG + Intronic
1182524329 22:30906157-30906179 TGGGCTGGTGGGTGGGCTTGTGG - Intronic
1182618624 22:31605464-31605486 GGGGCATGTGGGAGGACTGCTGG - Intronic
1182661991 22:31931710-31931732 GGGGCTCAGGGAAGGCCTGGAGG + Intergenic
1183074759 22:35419844-35419866 GAGGCTGGTGTGAGGCCAGGAGG - Intronic
1183269743 22:36853670-36853692 GGCGCTGGAGGGAGGCCGGAAGG - Intergenic
1183288157 22:36980954-36980976 GGGCCTGGTGGGAGGCGTTTGGG - Intergenic
1183397445 22:37580133-37580155 TGGGCTGGAGGGAGGCCAGGAGG - Intronic
1183709521 22:39494694-39494716 GTGGCTGGTGAAAGGCCTGTTGG - Intergenic
1183744673 22:39685735-39685757 GGGGGAGGTGGGAGCCGTGGAGG - Intronic
1183981048 22:41540446-41540468 GAGGGTGGTGGGAGTCCTGGAGG - Intronic
1184117826 22:42432287-42432309 GGGGCTGCGGGGAGCCCAGGAGG + Exonic
1184248155 22:43246004-43246026 GGGGCTGCAGGGAGGCCTGAGGG + Intronic
1184412219 22:44331849-44331871 GGGGCCGGCGGGCGGCCGGGCGG - Intergenic
1184417526 22:44360939-44360961 GAAGCTGGTGGGATTCCTGGGGG - Intergenic
1184432921 22:44452059-44452081 GGGCCTGGTGGGAGGTGTGTAGG + Intergenic
1184453688 22:44597447-44597469 GGGGCTGGTGCGGGGCCTGGGGG - Intergenic
1184484323 22:44766883-44766905 GGGGCTTTGGGGAGGCCTTGGGG + Intronic
1184492919 22:44820554-44820576 GGGGCTGGTGGGACCCCTGCAGG - Intronic
1184679885 22:46064833-46064855 GGGGCTGATTGAGGGCCTGGTGG - Intronic
1184736031 22:46398276-46398298 GGGGCAGGTGGCTGGCATGGCGG + Intronic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
1184988991 22:48154771-48154793 GGGGCTGGGGAGGGGGCTGGAGG + Intergenic
1185020847 22:48374028-48374050 GGGGATGCTGGGAAGCGTGGAGG - Intergenic
1185039586 22:48497494-48497516 GGGGCGGGGCTGAGGCCTGGGGG + Intronic
1185039607 22:48497552-48497574 GGGGCGGGGCTGAGGCCTGGGGG + Intronic
1185039650 22:48497669-48497691 GGGGCGGGGCTGAGGCCTGGGGG + Intronic
1185039693 22:48497786-48497808 GGGGCGGGGCTGAGGCCTGGGGG + Intronic
1185163571 22:49244143-49244165 GGGAGTGGTCAGAGGCCTGGGGG - Intergenic
1185167312 22:49269672-49269694 GGGGATGGTGGGAGGTGAGGTGG - Intergenic
1185211027 22:49570580-49570602 GAGGCTGGTGGGGGGGGTGGTGG - Intronic
1185268742 22:49918685-49918707 GGAGCGGGTGGGCGGCCGGGAGG + Exonic
1185296973 22:50059138-50059160 GGGGCTGGTGGGGGACTTGAAGG + Intergenic
1185373838 22:50473145-50473167 AGGCCAGGTGGGAGGCGTGGTGG - Intronic
1185377703 22:50489690-50489712 GGGTTGGGTGGGGGGCCTGGGGG + Intronic
950085027 3:10251197-10251219 CAGTCTGGTGGGAGGGCTGGAGG + Intronic
950138558 3:10600104-10600126 GGGGCTGGTGGGGGGCCATGGGG + Intronic
950249215 3:11449992-11450014 GGGGGTGGGAGGAGTCCTGGGGG + Intronic
950451151 3:13066605-13066627 TGGGATCGTGGGAGGCCAGGAGG + Intronic
950531879 3:13556924-13556946 GGGGCGTGAGGGAGTCCTGGTGG - Intronic
950543437 3:13625523-13625545 GGGGAAGGTGGGAGCCCTGCTGG - Intronic
950664094 3:14484428-14484450 GGGGAAGGTGGGAGCCATGGAGG + Intronic
951871747 3:27369415-27369437 AGCGCTGGTTGGTGGCCTGGAGG - Exonic
952064230 3:29548289-29548311 GGGCCTGGTGGCATGCCTGTTGG + Intronic
952268084 3:31806212-31806234 GAGGCTGCTGGGAGGGCTGAGGG - Intronic
952765792 3:36952951-36952973 GGGGCTGGAGGCAGGACTGATGG + Intergenic
952851427 3:37732836-37732858 GTGGCTGGTGGAAGGGCTGGGGG - Intronic
952882678 3:37994485-37994507 GGGGCAGGAGGGAGCCGTGGAGG + Intronic
952969019 3:38639025-38639047 GGGTGAGGTGGGAGGCCAGGCGG - Intronic
953151583 3:40330064-40330086 AGGGCTGCAGGCAGGCCTGGAGG + Intergenic
953346803 3:42182649-42182671 GGGGACTGTGGAAGGCCTGGAGG + Intronic
953407847 3:42668462-42668484 GGAGGTGGGGGGAGGGCTGGAGG - Intergenic
953492792 3:43364588-43364610 GAGGCTCGTGGGGGGCGTGGTGG + Intronic
953614430 3:44477575-44477597 GGAGTCGGTGAGAGGCCTGGCGG - Intronic
953680673 3:45035935-45035957 GGGGGCCGTGGGGGGCCTGGAGG + Exonic
953930930 3:47005332-47005354 GGGGCTGGTGGGCAGACTAGGGG + Intronic
953979106 3:47404897-47404919 GGGGATGTGGGGAGGCCTGGGGG - Intronic
953980962 3:47412850-47412872 CTGGCTGGCGGGAGGCCTGGGGG - Exonic
954035679 3:47849777-47849799 GGGGTGGGCGGGAGGCCTGCAGG - Intronic
954125344 3:48524959-48524981 GGGTCTGGTGCCAGGGCTGGGGG + Intronic
954359966 3:50116470-50116492 GGGGCAGGTTGGCGGCCAGGTGG + Intronic
954376123 3:50195065-50195087 GGAGCTGGGGTGGGGCCTGGAGG - Intronic
954378020 3:50205157-50205179 GGGGCTGGTCGGGGGAATGGCGG - Intergenic
954388019 3:50254593-50254615 GGGGCAGTGGTGAGGCCTGGGGG - Intronic
954388929 3:50258966-50258988 GGGGCTGGGGGGGGGCTTGCTGG - Exonic
954449575 3:50564398-50564420 GGGGCTGGGGAGAGGGCTGCAGG - Intronic
954460894 3:50626282-50626304 GGAGCTGGTGGGAGTCTGGGAGG + Intronic
954636128 3:52071785-52071807 GGGGATGGTGGGGGGGCTCGTGG - Intergenic
955747646 3:62155894-62155916 GGGGCTGGTGGAAGCCATGAAGG + Intronic
956097783 3:65735639-65735661 GGTGCTGCTGTGGGGCCTGGGGG - Intronic
956467874 3:69536548-69536570 GGGGATGGTGAGAGGGCAGGAGG + Intronic
956884538 3:73545879-73545901 GGGGTTGGTGGGAGGTGAGGGGG + Intronic
957215727 3:77317660-77317682 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215755 3:77317729-77317751 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215784 3:77317798-77317820 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215809 3:77317854-77317876 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957771095 3:84693226-84693248 GGGACTGCTGGGAGGCCAGGAGG - Intergenic
958799407 3:98738081-98738103 GGGGGTGGGGGGAGGGCGGGGGG - Intronic
959717861 3:109453103-109453125 GGGGATGGTGGTAGTACTGGAGG + Intergenic
960040758 3:113148115-113148137 GGGGGTGGAGTGAGGCCAGGAGG + Intergenic
960345257 3:116522528-116522550 GGGCCTGGTGGGAGGTGTGTGGG + Intronic
960516037 3:118603906-118603928 GGGGCTGGTGGGAGGTGTTAAGG + Intergenic
960939187 3:122922481-122922503 GGGGATGGCGGCAGCCCTGGTGG - Intronic
960954397 3:123021555-123021577 GGGGCTCTTGGGAGGCCTTCCGG + Intronic
961343549 3:126246385-126246407 GGGGGTGGGGGGGGTCCTGGGGG + Intergenic
961378948 3:126484771-126484793 GAGGCTGGTGGGAGGTGTGAGGG - Intronic
961612584 3:128152926-128152948 GGGGCGGGGGGGAGGGCGGGGGG - Intronic
961661821 3:128473083-128473105 TGGGCTGGTGTCAGGGCTGGTGG + Intergenic
962016084 3:131441915-131441937 GGGACAGGTGGGAGGATTGGCGG - Intergenic
963112617 3:141699730-141699752 GGGGTTGGTGAGAGGCTCGGAGG + Intergenic
963650689 3:147976444-147976466 GGGCATGGTGGGAAGCCTGGAGG + Intergenic
963732642 3:148987677-148987699 CGGGCTGGCGGGCGGCCGGGTGG - Intergenic
963842862 3:150125634-150125656 GGGGATGGTGTGAGGAGTGGTGG + Intergenic
964138373 3:153370020-153370042 AGGGCTGGTGGCAGTGCTGGCGG + Intergenic
964669582 3:159210066-159210088 GGGACAGTTGGGTGGCCTGGAGG + Intronic
964688023 3:159419271-159419293 AGGGCTGGAGGGAGGACTAGAGG + Intronic
966910526 3:184557138-184557160 GGGCCTGGAGGGGGGCCAGGCGG + Intronic
966926048 3:184645309-184645331 GGGGCAGGTGGAAGGCCTGGTGG - Intronic
967836508 3:193968732-193968754 GGGCCTAGTGGGAGGCCTTCAGG - Intergenic
967982880 3:195076188-195076210 GGGCCTGGAGGAAGGTCTGGGGG + Intronic
968545047 4:1194168-1194190 GGGGGTGGAGGGAGGCCGGCCGG - Intronic
968583092 4:1403900-1403922 GGGGCGGGAGGGAACCCTGGGGG - Intronic
968591520 4:1462146-1462168 GGGACTGGAGGGAGGCGGGGCGG - Intergenic
968593219 4:1470037-1470059 AGAGCTGCTGGGTGGCCTGGTGG + Intergenic
968611281 4:1558257-1558279 CGGGCTGTTCTGAGGCCTGGCGG - Intergenic
968622299 4:1609280-1609302 GGGGCTGGAAGGAGGCCCGAGGG - Intergenic
968650336 4:1757859-1757881 GGCGGTGGCCGGAGGCCTGGAGG - Intergenic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968731534 4:2271515-2271537 GAGGCTGGCTGGAGGCCAGGCGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968946371 4:3666746-3666768 GGGGCCGGTGGGAGGCTTCCTGG + Intergenic
969235908 4:5864954-5864976 TGGGCTGGGGGGAGGCAGGGAGG + Intronic
969312848 4:6364136-6364158 GGGGCTCGAGGGAGTCATGGAGG + Intronic
969718848 4:8882051-8882073 GGCGCTGGTGGAAGGCCCAGGGG - Intergenic
969818718 4:9705022-9705044 GGGGTGGGTGGGAGCCCTGGTGG - Intergenic
969843566 4:9901666-9901688 GGGGCTGGTGGGGGGGCATGGGG - Intronic
970313217 4:14804560-14804582 GGGGCTGCAGGGAGGTCTGCAGG - Intergenic
971972085 4:33633885-33633907 GGGCCTGGTGGGAGGCCCCATGG + Intergenic
972265950 4:37459988-37460010 GGGGCTGTAGGGAGGGCAGGGGG - Intronic
972299832 4:37774176-37774198 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
972396534 4:38663761-38663783 GGGCCGGGCGGGAGGGCTGGCGG + Intergenic
972543165 4:40056775-40056797 AGGGCGGGTGGGCGGCCGGGTGG - Intergenic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
973626602 4:52778790-52778812 GCTGGAGGTGGGAGGCCTGGTGG - Intergenic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
975549478 4:75596513-75596535 GGGGCTGCTGGGAGGCATGAGGG - Intronic
976101685 4:81571038-81571060 GGGGCTGGTGTGAGGGCTTTGGG - Intronic
976185786 4:82441479-82441501 GGGTGTGGTGGCAGGCGTGGTGG + Intronic
976246780 4:83012747-83012769 GGGGCTCCTGGGCGGGCTGGCGG - Intronic
977572336 4:98641766-98641788 GGGGACAGTGGGAGTCCTGGTGG - Intronic
978141077 4:105318058-105318080 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
978178047 4:105758353-105758375 GGGCCTGGTGGGAGGCGTTTGGG + Intronic
978369785 4:108018605-108018627 GGGGCGGGTGGGAGGAGAGGAGG - Intronic
978829385 4:113066175-113066197 GGGGCTGGGGGGAGGAGGGGAGG - Intronic
978947317 4:114515640-114515662 GGGGCTGGTGGGAAATCTGGAGG - Intergenic
979377463 4:119963942-119963964 GGGGCTGTTAGGGGTCCTGGCGG + Intergenic
981003670 4:139853398-139853420 AGGGCAGGTGGGGGGCCTGCAGG + Intronic
981036080 4:140169995-140170017 GAGGCTGGTGTAAGGGCTGGGGG + Intergenic
981825473 4:148935782-148935804 GGGCCTGGTGGGAGGAGTTGTGG + Intergenic
982598197 4:157412707-157412729 GGGGCTGGTGGGAGGTGTTTTGG - Intergenic
983484249 4:168315578-168315600 GGGGCTTGTCGGAGGGTTGGGGG - Intronic
983917852 4:173311642-173311664 GGGGGTGGGGGGTGGACTGGTGG + Intronic
984498701 4:180531754-180531776 GGGCTGGGTGGGAGTCCTGGAGG - Intergenic
984952488 4:185017858-185017880 GGGGCGGGTGGGAGGATTGGGGG - Intergenic
985009269 4:185565969-185565991 GGTGCAGGGGGAAGGCCTGGGGG + Intergenic
985357086 4:189132911-189132933 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
985412115 4:189695919-189695941 GGGGCTTGTGGGCAGGCTGGTGG + Intergenic
985493365 5:191802-191824 GGCGCTGGTGCGCGGCCTCGCGG + Exonic
985527649 5:415300-415322 TGGTCGGGTGGGAGGCCTAGGGG + Intronic
985527675 5:415368-415390 TGGTCGGGTGGGAGGCCTAGGGG + Intronic
985527687 5:415402-415424 TGGTCGGGTGGGAGGCCTAGGGG + Intronic
985527711 5:415470-415492 TGGTCGGGTGGGAGGCCTAGGGG + Intronic
985527724 5:415504-415526 TGGTCGGGTGGGAGGCCTAGGGG + Intronic
985527736 5:415538-415560 TGGTCGGGTGGGAGGCCTAGGGG + Intronic
985527746 5:415572-415594 TGGTCTGCTGGGAGGCCTAGGGG + Intronic
985541314 5:488897-488919 GGGGCAGGTGGGAGGGCCGTTGG + Intronic
985631541 5:1016685-1016707 AGGGCAGGTGGGAGCCCTGGAGG - Intronic
986145226 5:5071542-5071564 GAGGCTGGTGGGCCTCCTGGGGG + Intergenic
986195766 5:5535390-5535412 TGGGGTGGTGGGAGGCAGGGAGG + Intergenic
986242758 5:5976312-5976334 AGGGGTGGTGGGTGTCCTGGAGG - Intergenic
986473363 5:8097723-8097745 AGGCCTGCTGGGAGGGCTGGCGG + Intergenic
986506293 5:8455627-8455649 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
986690218 5:10307806-10307828 GGTGGAGGAGGGAGGCCTGGGGG + Exonic
987089289 5:14497118-14497140 GGGGCTGGTGGGTGGGAGGGAGG - Intronic
987187964 5:15444536-15444558 GGGCCTGGTGGGAGGACTTTGGG + Intergenic
988369284 5:30346019-30346041 GGGGCGGGGGGGGGGCCGGGGGG - Intergenic
988421872 5:31015572-31015594 GGGGCGGGGGCGAGGCATGGAGG + Intergenic
989137192 5:38167209-38167231 GTGGCTGTGGTGAGGCCTGGGGG + Intergenic
989289546 5:39747355-39747377 GGCCCTGGTGGGAGGTATGGAGG - Intergenic
990207640 5:53446839-53446861 GGGGCTGGGGGGAGGGGCGGCGG + Intergenic
990248162 5:53884347-53884369 GGGGTGGGTGGGATGGCTGGGGG - Intronic
990566167 5:57031593-57031615 GGGGCTGGTGGGTTCCCAGGAGG - Intergenic
991491961 5:67192694-67192716 GGGCCTGGTGGGAGGCGTGTGGG - Intronic
991659119 5:68932491-68932513 GGTGCAGGTGGGGCGCCTGGAGG - Intergenic
992015198 5:72568175-72568197 GGGGGTTGGGGGTGGCCTGGTGG - Intergenic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
993340774 5:86722750-86722772 GGGGCTGGTGGGAGGTGTTTGGG - Intergenic
993660193 5:90623698-90623720 GGGGCAGGGGGAAGGCATGGTGG - Intronic
994355769 5:98792578-98792600 GGGGTTGGTGGGGGGCGGGGGGG - Intronic
994540286 5:101086532-101086554 GTGGGTGGTGGGAGGGCGGGTGG - Intergenic
995244708 5:109922538-109922560 GGGGCTGGGGGGAGGCTGTGGGG + Intergenic
995537653 5:113153308-113153330 AGGGGTTGGGGGAGGCCTGGAGG + Intronic
995908744 5:117159628-117159650 GTGGGTGGTGGGTGGTCTGGAGG + Intergenic
995965235 5:117898635-117898657 GGGCCTGTTGGGAGGCTTGAAGG - Intergenic
997196905 5:131986284-131986306 TGAGCTGGAGGGAGGCCTGGAGG + Intronic
997207809 5:132060251-132060273 GGTCCTGGTGGGTGGCCAGGAGG - Intergenic
997303830 5:132824622-132824644 GGGGCCCCTGGGAGGCATGGGGG + Exonic
997568189 5:134905264-134905286 GGGGGCGGTGCGAGGCCCGGCGG + Intronic
998012921 5:138709598-138709620 GGTGCTGCTGGGTGGGCTGGGGG + Intronic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998158062 5:139797192-139797214 GGGGCTGCTGGGAGGACAGCAGG - Intronic
998173352 5:139885353-139885375 GAGGCCGCTGAGAGGCCTGGAGG + Intronic
998351636 5:141505670-141505692 GGGGGTCCTGGGATGCCTGGAGG + Intronic
998390055 5:141781585-141781607 GGGGCTGGGAGGACACCTGGAGG - Intergenic
998444327 5:142187000-142187022 GGGGGTGCAGGAAGGCCTGGGGG - Intergenic
1000351287 5:160354860-160354882 GGGGCTCCTGGGGGGCCGGGTGG + Exonic
1000833801 5:166132348-166132370 AGGGTTGGTGAGAGGCTTGGAGG + Intergenic
1001035242 5:168292309-168292331 GGGGCAGGTGGGGGCCCAGGCGG - Intronic
1001139733 5:169134589-169134611 GGGGCCTGTCGGAGGGCTGGGGG + Intronic
1001441948 5:171750247-171750269 GGGGATGATGGGAGTGCTGGTGG - Intergenic
1001991314 5:176117888-176117910 GGCGCTGCTGGGAGGCATGTGGG + Intronic
1002021247 5:176365682-176365704 GGGACCGGGGAGAGGCCTGGTGG + Exonic
1002214252 5:177618552-177618574 GGGGGTGGTGGCAGGGGTGGTGG + Intergenic
1002225561 5:177720248-177720270 GGCGCTGCTGGGAGGCATGTGGG - Intronic
1002268288 5:178050957-178050979 GGCGCTGCTGGGAGGCATGTGGG + Intronic
1002430879 5:179203188-179203210 GGAGCTGGTGGGGGCCCTGATGG - Intronic
1002466635 5:179411947-179411969 GGGGATGGTGGAAGGCCGGTGGG - Intergenic
1002466727 5:179412157-179412179 GGGGATGGTGGAAGGCCGGTGGG - Intergenic
1002466867 5:179412477-179412499 GGGGATGGTGGAAGGCCGGTGGG - Intergenic
1002466886 5:179412523-179412545 GGGGATGGTGGAAGGCCGGTAGG - Intergenic
1002466987 5:179412755-179412777 GGGGATGGTGGAAGGCCGGTGGG - Intergenic
1002467005 5:179412800-179412822 GGGGATGGTGGAAGGCCGGTAGG - Intergenic
1002552159 5:180002573-180002595 AGGACTGGTGGGAACCCTGGTGG + Intronic
1002601897 5:180358550-180358572 GGCGCTGGTGGGAGGGCAGCAGG + Intergenic
1003179482 6:3779829-3779851 GGGGCTGGGGAGAGGCCGGGTGG + Intergenic
1003426604 6:6002191-6002213 GGGCCTGGTCCTAGGCCTGGGGG + Intronic
1003508415 6:6759150-6759172 GGGGCTGGTGGGAACACTAGAGG + Intergenic
1003945509 6:11071859-11071881 GGGGATGGGGGGAGGCCGGAGGG - Intergenic
1004356621 6:14934797-14934819 GGGGTTTGTGGGAGGTGTGGTGG - Intergenic
1005954292 6:30652840-30652862 GCTGCTAGTGGGAGCCCTGGTGG + Exonic
1006026248 6:31148834-31148856 GGGGCTGGGGGGAGGGGGGGCGG + Intronic
1006099413 6:31676834-31676856 GTGGCTGGAGGGAGGCAAGGAGG + Exonic
1006131162 6:31870335-31870357 GGGGTTGGTGGGAGTGGTGGTGG - Intronic
1006154444 6:32006734-32006756 GGGGCTGGGGGTGGGCCTGAGGG - Intergenic
1006160757 6:32039470-32039492 GGGGCTGGGGGTGGGCCTGAGGG - Intronic
1006167273 6:32072280-32072302 GGGGCTGGTGGGAGGGGAGCTGG + Intronic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006368622 6:33631048-33631070 GTGGTGGGTGGGAAGCCTGGGGG - Intronic
1006393322 6:33771621-33771643 GGAGCTGGCGGGAGGGCCGGTGG + Exonic
1006404670 6:33838015-33838037 GGAGCTGCAGGGAGGCCTGGGGG + Intergenic
1006599695 6:35217233-35217255 GGGGCGGGGGGGAGGCGCGGCGG + Intronic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006640696 6:35488228-35488250 CGGGCTGCTGTGGGGCCTGGAGG - Intronic
1006641786 6:35493011-35493033 GTGGCTGGTGGGAGCCCAGTGGG - Intronic
1006750388 6:36373253-36373275 TGGGGAGGTGGGAGGCATGGAGG + Intronic
1006985483 6:38172954-38172976 TGGGCTGGTGGGGGTGCTGGAGG - Exonic
1007420286 6:41715091-41715113 GGCCCTGGTTGGAGGCCAGGTGG - Intronic
1007428200 6:41760593-41760615 GGGGCTGGTGGAGTGCTTGGCGG + Intergenic
1007584234 6:42978976-42978998 GCTGCTGGTGGCAGCCCTGGAGG - Exonic
1007588664 6:43008254-43008276 TGGGCAGGTGAGAGGCCGGGTGG + Exonic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007629529 6:43265118-43265140 GGGGCTGGGGAGAGTCATGGAGG + Intronic
1007722218 6:43891743-43891765 GGGGAGGGTGGCAGGCATGGCGG + Intergenic
1007834822 6:44666341-44666363 GGGCCTGGTGGGGAGGCTGGAGG + Intergenic
1008907953 6:56700226-56700248 CTGGCTGGTGGGAGGAGTGGGGG - Intronic
1008942728 6:57064657-57064679 GTGGATGGTGGGAGGCCCGGGGG + Intergenic
1009442968 6:63704404-63704426 GGGGCTGGTGGGGGTGTTGGGGG - Intronic
1009978543 6:70700040-70700062 GGGCCTGGTGGGAGGTTTGTGGG + Intronic
1010289173 6:74115576-74115598 AGGGCTGGTGGGAGGGGTGGAGG + Intergenic
1011075123 6:83430840-83430862 GGGGCCGATGGGCGGCCAGGTGG + Intronic
1011159822 6:84376671-84376693 AGGGCCTGTGGGAGGGCTGGGGG + Intergenic
1012410263 6:98948050-98948072 GGGCCTGGAGGGAGGCGGGGCGG + Intergenic
1012468925 6:99548080-99548102 GGTGCTGGTGGGATGCCAAGCGG + Intronic
1012510228 6:99993700-99993722 GGGGCGGGTGGGTGGCCGGCTGG - Intronic
1013351915 6:109313458-109313480 GGGGCTGCTATGAGCCCTGGAGG - Intergenic
1015325496 6:131918917-131918939 TGGGCTGGTGTGTGGCCTAGGGG - Intergenic
1015390715 6:132678446-132678468 GGGTCTGGTGGGAGGCATCTGGG - Intergenic
1016015850 6:139185154-139185176 TGGGATAGTGGGAGTCCTGGGGG + Intergenic
1016531018 6:145058250-145058272 GATGCTGGTGGGAGCCCTGCAGG - Intergenic
1017400068 6:154050613-154050635 GGGGCTGATGGGGGGCTGGGAGG + Intronic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1017810786 6:157981982-157982004 GCGGCTGCTGGGGCGCCTGGGGG + Exonic
1017873186 6:158503172-158503194 GGGGCTGGCAGGAGACTTGGGGG - Exonic
1017911179 6:158794291-158794313 GGTGCTGGTGGTAGTGCTGGTGG - Intronic
1018006131 6:159623863-159623885 GGGCCTGGTGGGAGGTGTGTGGG + Intergenic
1018006957 6:159631239-159631261 GGGGCTTGTGGGTGGGGTGGGGG + Intergenic
1018203428 6:161415602-161415624 GGGGCTGGCGGGGGGTCGGGGGG - Intronic
1018395382 6:163374205-163374227 TGGGCTGGAAGGGGGCCTGGTGG + Intergenic
1018807502 6:167272641-167272663 AGTGCTGGTGGGAGGTTTGGGGG + Intronic
1018813337 6:167313495-167313517 GGAGATGGTGGGGGGGCTGGGGG + Intronic
1018889828 6:167975845-167975867 GGGGCTGGTGTCAGGTCTCGAGG - Intergenic
1019089862 6:169519620-169519642 GGGCCTGGTGGGAGGTGTGTGGG - Intronic
1019105517 6:169664125-169664147 GGGCCAAGTGGGAGGCCTGAGGG + Intronic
1019262176 7:87833-87855 GGGGCAGGTGGGTCACCTGGTGG - Intergenic
1019264571 7:106585-106607 GGGGGTGGGGGCAGGGCTGGTGG + Intergenic
1019278990 7:190997-191019 GGGTGTGGGGGGAGTCCTGGGGG - Intergenic
1019282116 7:205828-205850 GGGCTTCGTGGGGGGCCTGGGGG - Intronic
1019305518 7:332690-332712 GGGCCTGGGGAGAGGCTTGGAGG + Intergenic
1019319656 7:409797-409819 GGGGCTGGCAGGAGGCCTGGGGG + Intergenic
1019361750 7:608611-608633 AGGGCTGTAGGGAGGGCTGGGGG + Intronic
1019491552 7:1316145-1316167 GGGGCAGGTTGGGGGTCTGGGGG + Intergenic
1019588917 7:1819357-1819379 GTGGCTGGCGGGCGCCCTGGGGG + Intronic
1019597592 7:1865361-1865383 GGGGCTGGCACCAGGCCTGGGGG - Intronic
1019659729 7:2217433-2217455 AGAGCTGGTGTGAAGCCTGGAGG + Intronic
1019737084 7:2655991-2656013 TGGGCTGGAGGGAGACCTGGGGG + Intronic
1019812782 7:3176661-3176683 GAGGCAGGTGGGGGGTCTGGTGG + Intergenic
1019882196 7:3871759-3871781 GGGCCTGGTGGGTGGCGTTGGGG - Intronic
1020106797 7:5425968-5425990 GGGGCTGCTGGAAGCCCAGGCGG + Intergenic
1020139965 7:5606700-5606722 GAGGTGGGTGGGAGGGCTGGCGG + Intergenic
1020787682 7:12591085-12591107 GGGGTTGGTGAGAGGCTCGGAGG + Intronic
1021119206 7:16778835-16778857 GGGGAGGGTGGGAGTCTTGGGGG + Intronic
1021438938 7:20655471-20655493 GGGGCTGGGGGGAGGTGCGGGGG - Intronic
1021862823 7:24923735-24923757 GGGGCAGGCGGGCGGCCGGGTGG + Intronic
1022236431 7:28466380-28466402 GGGGGTGGTGGAAAGCCTGTAGG + Intronic
1023030693 7:36088162-36088184 GGGCCTGGTGGGAGGCGTTTGGG + Intergenic
1023038871 7:36154965-36154987 GGGGCTCGGGTGAGGCTTGGCGG - Exonic
1023845220 7:44116620-44116642 GAGGATGGTGGGAGGCTTGAAGG - Intronic
1023868946 7:44252460-44252482 GGGGCAGGGGAGAGGGCTGGAGG + Intronic
1023874950 7:44281871-44281893 GAGGCAGGTGGGGGTCCTGGAGG - Intronic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024634656 7:51277018-51277040 GGAGCTGGTGTGAGGACAGGAGG - Intronic
1024934283 7:54697709-54697731 GGGGCTGCTGGAGGGCTTGGCGG - Intergenic
1025144719 7:56493406-56493428 GGGTGTGGTGGGGGGCTTGGAGG + Intergenic
1025260303 7:57413863-57413885 GGGTGTGGTGGGGGGCTTGGAGG + Intergenic
1025280697 7:57625047-57625069 GGCACTGCTGGGAGCCCTGGGGG - Intergenic
1025304033 7:57840460-57840482 GGCACTGCTGGGAGCCCTGGGGG + Intergenic
1025502693 7:61324523-61324545 GGGGCTGGGGGGAAGGGTGGTGG + Intergenic
1025517563 7:61670745-61670767 GGGGCTGGGGGGAAGGGTGGTGG + Intergenic
1025541886 7:62099395-62099417 GGGGCTGGGGGGAAGGGTGGTGG + Intergenic
1025929048 7:65980483-65980505 AGGGCTTGTGCTAGGCCTGGGGG - Intronic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026236917 7:68535092-68535114 GGGGGTGGTGGGTGGCGGGGTGG + Intergenic
1026236925 7:68535107-68535129 CGGGGTGGTGGGTGGCCGGGGGG + Intergenic
1026236937 7:68535126-68535148 GGGGGTGGTGGGCGGCGGGGGGG + Intergenic
1026451267 7:70531705-70531727 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
1026456104 7:70574002-70574024 TGTGCAGTTGGGAGGCCTGGGGG + Intronic
1026680097 7:72460192-72460214 GGGCCTGGTGGGAGGTATGTGGG - Intergenic
1026817200 7:73522145-73522167 GGGGCTGCTGGGAGGCGCGGCGG - Exonic
1026879664 7:73900538-73900560 GTGGGTGGTGAGAGGCTTGGGGG + Intergenic
1026899260 7:74028051-74028073 GGGAGAGGGGGGAGGCCTGGGGG - Intronic
1027236975 7:76303886-76303908 GGGGTGGGTGGGTGGCGTGGGGG + Intronic
1027753124 7:82177092-82177114 GGGGTTGGGGGGCGGGCTGGAGG + Intronic
1027800919 7:82747820-82747842 ATGGCTGGTGAGGGGCCTGGGGG + Intergenic
1028753448 7:94408791-94408813 GGGGCACCTGGGAAGCCTGGAGG - Exonic
1028984559 7:96999311-96999333 GGGGGTGGGGGTAGGGCTGGAGG - Intergenic
1029179065 7:98686158-98686180 AGGGCAAGTTGGAGGCCTGGAGG - Intergenic
1029381912 7:100220417-100220439 AGGGCTCCTGGGAGGCCTGTGGG + Exonic
1029402076 7:100352867-100352889 AGGGCTCCTGGGAGGCCTGTGGG + Exonic
1029456477 7:100674721-100674743 GGGGCTGCTGAGGGCCCTGGGGG + Intronic
1029483789 7:100827422-100827444 GGGGATGGTGGGAGCCCGAGCGG + Exonic
1029506476 7:100966449-100966471 GGCGCTGGTCGGGGGCCTGACGG + Exonic
1029536891 7:101162622-101162644 GGGGCTCGTGGGAGGCCCGAAGG + Exonic
1029551700 7:101240044-101240066 GGGGCTGAGGGGCTGCCTGGAGG + Intronic
1029570071 7:101363261-101363283 GTGGCTGGAGCGAGGCTTGGGGG + Intronic
1029588043 7:101487697-101487719 AGGGCTGGCTGGAGGACTGGAGG - Intronic
1029697076 7:102220625-102220647 GGGGCTGGCAGGAGCCCTAGAGG - Intronic
1029706517 7:102279477-102279499 GTGGCCCCTGGGAGGCCTGGGGG - Intronic
1029747754 7:102525774-102525796 GGGGATGGTGGGGGGCCTACTGG - Intergenic
1029765705 7:102624864-102624886 GGGGATGGTGGGGGGCCTACTGG - Intronic
1030061063 7:105621740-105621762 GGAGCTGCTGGGAGGCCTGGAGG - Intronic
1030147066 7:106367644-106367666 GGGGTAGGTGGGAGGCATGGTGG + Intergenic
1030980669 7:116182074-116182096 GGGGGTGGGGGGAGGCAGGGAGG + Intergenic
1031317286 7:120273403-120273425 GGGGCTGCGGGGCGGCCGGGCGG - Intergenic
1032023179 7:128421440-128421462 GGGGATGGAGGGAGGCTTGGGGG - Intergenic
1032066935 7:128778902-128778924 GCCGCAGGTGGGAGTCCTGGTGG + Intergenic
1032279828 7:130491693-130491715 GGGGCTTGTGGGCAGCCTGTGGG + Intronic
1032279835 7:130491713-130491735 GGGGTTTGTGGGCGGCCTGTGGG + Intronic
1032488192 7:132304293-132304315 GGGGCTGAGGTGAGGCCTGCAGG - Intronic
1032508871 7:132456020-132456042 GGCGCCGGTGGGAGGGCAGGAGG + Intronic
1032637321 7:133723862-133723884 GAGGCAGGTGGGAGGACTGTTGG - Intronic
1032719148 7:134536673-134536695 GGGGCTGGTGAAAGCCCTTGGGG + Exonic
1032724118 7:134575443-134575465 GGGGCTGGTGAAAGCCCTTGGGG + Exonic
1032898341 7:136277627-136277649 GGGGGTGAGGGGAGGGCTGGTGG + Intergenic
1032902330 7:136323767-136323789 TGGGGTGGTGGGGGGCCGGGGGG + Intergenic
1033028399 7:137800325-137800347 GGGCCTGGTGGGAGGCGTTTGGG + Intronic
1033355292 7:140594317-140594339 GGGTCTGGGGTGAGGCCTGAAGG - Intronic
1033588554 7:142792088-142792110 GGGCCTGGGGAGATGCCTGGAGG + Intergenic
1033590054 7:142801435-142801457 GGGCCTGGGGAGATGCCTGGAGG + Intergenic
1034265499 7:149778812-149778834 GGTGCTGTCAGGAGGCCTGGGGG + Intergenic
1034436363 7:151064530-151064552 GGATGTGGTGGGAGGACTGGCGG - Exonic
1034595222 7:152183472-152183494 GGGGCTGGGGCCAGGCATGGTGG + Intronic
1034675546 7:152890378-152890400 GGGCCTGGTGGGAGGGTGGGAGG + Intergenic
1034940356 7:155226645-155226667 AGGGCTGGTGGGGAGCCTGTGGG - Intergenic
1034975729 7:155448458-155448480 TGGGCTGGTGGGAAGTGTGGAGG + Intergenic
1035006291 7:155663569-155663591 GGGCCTGGTGGGAGGCGTTGGGG - Intronic
1035011840 7:155725416-155725438 GGCGCAGGAGGGAGGACTGGAGG + Intronic
1035064390 7:156094686-156094708 ATGGCAGGAGGGAGGCCTGGTGG - Intergenic
1035076499 7:156181041-156181063 CGGGCTGGAGGGTGTCCTGGTGG - Intergenic
1035205187 7:157290242-157290264 GGGGCAGGGGAGAGGACTGGGGG + Intergenic
1035226348 7:157435148-157435170 GGTGGGCGTGGGAGGCCTGGCGG - Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035277067 7:157754028-157754050 GGTGCTGGTGAGAGGCTGGGAGG + Intronic
1035283100 7:157789464-157789486 GAGGCTCGTGGGAGGCCTCCAGG + Intronic
1035306925 7:157939333-157939355 GGGGCTGGTGGCTGTCCTGCAGG + Intronic
1035374074 7:158395834-158395856 GGGGCTGGTGGGATCCAAGGCGG - Intronic
1035381021 7:158441002-158441024 GGGGGTGGTGGTAGTCGTGGTGG + Intronic
1035741742 8:1933554-1933576 GGGGCGGGTGGGGGGTCTTGAGG + Intronic
1036202026 8:6778051-6778073 GGGCCTGGTGGGAGGTGTGGGGG - Intergenic
1036289287 8:7473200-7473222 GGGGGTGGCGGGGGGCCTGTGGG + Intronic
1036332194 8:7838332-7838354 GGGGGTGGCGGGGGGCCTGTGGG - Intronic
1036683095 8:10890281-10890303 AGGGCAGGTGGGAGCCCAGGAGG - Intergenic
1037674790 8:21043469-21043491 TGGGGTGGTGGGAGGTCAGGGGG - Intergenic
1037674891 8:21043682-21043704 TGGGGTGGTGGGAGGTCAGGGGG - Intergenic
1037674910 8:21043725-21043747 TGGGGTGGTGGGAGGTCAGGGGG - Intergenic
1037699880 8:21264449-21264471 GGGCCTGGTAGGAGGGGTGGAGG + Intergenic
1037768965 8:21788021-21788043 GGGGCTGGCGGGAGGTCGGCGGG - Intronic
1037866062 8:22443233-22443255 GGGGCTAGGGGCAGGCATGGTGG + Intronic
1037868277 8:22465989-22466011 GGGGCTGGTCGGAGGATGGGGGG - Intronic
1038372352 8:27006833-27006855 GGGGTGGGGAGGAGGCCTGGAGG + Intergenic
1038575553 8:28701313-28701335 GGGGATTGTGGGAGGCGCGGGGG - Exonic
1038646498 8:29366227-29366249 GGGGTAGGTTGGTGGCCTGGAGG - Intergenic
1039083713 8:33759186-33759208 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1039549186 8:38430730-38430752 GTGGATGGTGGGGGGCCTGAGGG - Intronic
1039567975 8:38564741-38564763 GGGGCCGGTGGGGGGCCGGTGGG - Intergenic
1040323945 8:46331829-46331851 GGGGCTGGTGGGTCAGCTGGCGG - Intergenic
1040499356 8:47993323-47993345 AGGGTTGGTGAGAGGCTTGGAGG + Intergenic
1040516958 8:48143401-48143423 GGGCCTGGTGGGAGGCGTTCTGG + Intergenic
1040569223 8:48592926-48592948 GGGGATGTTGGTAGGCATGGTGG + Intergenic
1042611619 8:70607669-70607691 GGGGCGGGTGGGCGGACTTGGGG - Intronic
1042910243 8:73818659-73818681 GGGCCTGGTGGGAGGTGTGTGGG + Intronic
1043508133 8:80923022-80923044 GTGGCTGGTGGGAGGTCAGTAGG + Intergenic
1045064224 8:98431302-98431324 GAGGCTTGTGGGAGGCTGGGAGG + Exonic
1045145722 8:99341772-99341794 GGCTCTGGTGGGACGCCTGGGGG - Intronic
1045305456 8:100952816-100952838 GCGGCGGGAGGGAGGCCGGGAGG - Intronic
1045369328 8:101505626-101505648 GGGGCTTGTGGGAGGGTTGAGGG + Intronic
1045457433 8:102395098-102395120 GAGGCTGGTGGGAGAGCTGTAGG - Intronic
1045683901 8:104691407-104691429 GAGGGTGGTTGGAGGGCTGGGGG + Intronic
1046181021 8:110647780-110647802 GAGGCAGGAGGGAGGCATGGAGG + Intergenic
1046546714 8:115661777-115661799 GGGGTTGGTGGGAGGTTTTGTGG - Intronic
1046568390 8:115930695-115930717 GGGGGGGGTGGGGGGCGTGGCGG + Intergenic
1046948742 8:120000304-120000326 GGGGCTGGAGGGGGGCCTTGGGG - Intronic
1047218140 8:122895847-122895869 TTGGCAGGTGGGAGGGCTGGGGG - Intronic
1047901906 8:129431948-129431970 GGTGCTGTTGGGGGGCATGGTGG - Intergenic
1048783905 8:138030349-138030371 GGGCCTGGTGGGAGGTGTGTGGG + Intergenic
1049008398 8:139872121-139872143 TGGGCTGGTGGATGGGCTGGTGG + Intronic
1049221706 8:141431554-141431576 GGGGCGGGCTGGTGGCCTGGGGG + Exonic
1049320523 8:141993819-141993841 GGGGTTGGGGGAAGGGCTGGGGG - Intergenic
1049379910 8:142306936-142306958 GGTGCTGGAGGGAGGCCCCGGGG - Intronic
1049396355 8:142402960-142402982 GGGGCTTGCGGGAGGCCGGGCGG - Intronic
1049414971 8:142490988-142491010 GGGGGTGGGAGGCGGCCTGGTGG - Intronic
1049420414 8:142513943-142513965 TGGACTGGTGGGAGGCTGGGAGG + Intronic
1049432809 8:142573171-142573193 GGGCCTGGTGGGAGGCCAAAGGG - Intergenic
1049478818 8:142810397-142810419 AGGGGTGGAGGGAGGGCTGGAGG - Intergenic
1049510609 8:143024997-143025019 TGGGCTGCTGGGCGGCCAGGCGG + Intergenic
1049639344 8:143707606-143707628 GGGGCTGGTGGCCGGGCCGGGGG - Intronic
1049639961 8:143711086-143711108 TGGGCTGGGCAGAGGCCTGGGGG - Intronic
1049653834 8:143789133-143789155 GGTGCTGGTGGGGGCGCTGGCGG + Intergenic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1049741476 8:144243037-144243059 GAGGCTGGGGTGAGGCCTTGGGG - Intronic
1049745434 8:144261239-144261261 GGGGCTGCCGGGCGGCGTGGGGG - Intronic
1049806294 8:144542160-144542182 GGAGCAGGTGGGAGAGCTGGAGG + Intronic
1049808263 8:144551217-144551239 GGGGCTGGCAGGCGGCCGGGAGG + Intronic
1049833970 8:144721170-144721192 GGGGTTGGTGGGAGAGGTGGTGG + Exonic
1049879409 8:145052151-145052173 GGGGCTGGGGCGGGGCCTGGGGG - Intergenic
1049883788 9:14898-14920 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1051809253 9:21031498-21031520 GGCGCGGGTGGAGGGCCTGGAGG - Intronic
1052731464 9:32291234-32291256 GGGGCTGCTGTGGGGCATGGGGG + Intergenic
1053042997 9:34890593-34890615 GGGGCCCATGGGATGCCTGGTGG + Intergenic
1053153849 9:35760243-35760265 GGGGCTGATGGGCGGGGTGGGGG + Intergenic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1053304227 9:36972646-36972668 GGGGGTGGTGGGAGTGCTGGGGG + Intronic
1053360966 9:37486372-37486394 GGGGGAGGCGGGAGACCTGGTGG - Intronic
1053412982 9:37927792-37927814 GAGGCTGGTGGGAACCCTGAGGG - Intronic
1053512612 9:38701547-38701569 GGCTCTGGTGGGTGGCCTCGAGG + Intergenic
1055881061 9:81004140-81004162 GGGCCTAGTGGGATTCCTGGAGG - Intergenic
1055987065 9:82063022-82063044 GGGCCTGGTGGGAGGCCCTCGGG + Intergenic
1056507942 9:87275250-87275272 GGGGCTGGGAGGAGGAATGGAGG - Intergenic
1056663540 9:88562318-88562340 GGGGCGGCTGGGAGTGCTGGAGG + Intronic
1056679148 9:88701920-88701942 GAGGCAGGAGGGTGGCCTGGGGG + Intergenic
1056722229 9:89082143-89082165 GGGGTTGGGTGGAGCCCTGGAGG - Intronic
1056965350 9:91160152-91160174 GGGGGTGGGGGTAGGCCTCGCGG - Intergenic
1057397053 9:94689665-94689687 GGGGCTGGTGGGAAGGCGGGAGG - Intergenic
1057619110 9:96619435-96619457 GGGGCTGGCGGGAGCCTCGGCGG - Exonic
1057706442 9:97398383-97398405 GTGGCTTGGGGGAGCCCTGGAGG - Intergenic
1057914021 9:99041715-99041737 CGGGCTGCAGGGTGGCCTGGAGG + Intronic
1058144814 9:101399261-101399283 GAGGTTGGTGGGGGGCCTGGGGG - Intronic
1059145613 9:111896896-111896918 GGGTCTGGTGGGCGGCCGCGAGG + Exonic
1059407267 9:114108889-114108911 GGTGCTGGTGAGAGGCCTGCTGG + Intergenic
1059656860 9:116365318-116365340 GGGGAGGGTGGCAGCCCTGGTGG - Intronic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1060266176 9:122112601-122112623 GGGGAGGGTCGGAGACCTGGAGG + Intergenic
1060403519 9:123361609-123361631 GGGGGTGGGGGGAGGAATGGAGG + Intronic
1060410075 9:123394457-123394479 GGGGGTGGTGCAAGGCCTTGGGG + Intronic
1060794100 9:126503211-126503233 GGGGCTGGGCGGGAGCCTGGCGG - Exonic
1060821245 9:126662666-126662688 GGAGCCGGTGGGCGGCCTGTTGG + Intronic
1060937218 9:127522570-127522592 GGGGCTGGAGGGGGGCCTCTGGG - Intronic
1061089261 9:128417682-128417704 GGGGAGGGTGGGAGGACTTGGGG + Intronic
1061293936 9:129666960-129666982 GGGGCGGGTGGGAGGGCTGCTGG - Intronic
1061320183 9:129823660-129823682 GGGGCTGGGGGTGGGGCTGGGGG - Intronic
1061320229 9:129823753-129823775 AGGGCTGGAGCGGGGCCTGGGGG - Intronic
1061371012 9:130197600-130197622 CTGGCTGGCGGGAGGGCTGGGGG + Intronic
1061450657 9:130665311-130665333 GGGGGTGGAGGGAGGGCGGGCGG + Intronic
1061451047 9:130667125-130667147 GTGGCTGGGAAGAGGCCTGGAGG - Intronic
1061472265 9:130835816-130835838 GGGGCTGGTGCCGGGGCTGGGGG - Intronic
1061511941 9:131067021-131067043 GGCACTGGTGGCAGGGCTGGGGG - Exonic
1061607613 9:131722904-131722926 GGGGCGGGGGGCAGGCATGGTGG + Intronic
1061613068 9:131761406-131761428 GAGGCTGGTGGGAGGATTGCTGG - Intergenic
1061757805 9:132827530-132827552 GGGGCTGGCGGGAGGGTGGGGGG - Intronic
1061789065 9:133049023-133049045 GAGGCTGCTGGGTGGCCTGACGG + Intronic
1061799035 9:133104217-133104239 GGGGCAGGGGGCTGGCCTGGGGG - Intronic
1061852506 9:133424314-133424336 GGGGAAGGAGGGCGGCCTGGAGG - Exonic
1061905420 9:133694270-133694292 GGGCCAGCGGGGAGGCCTGGTGG + Exonic
1062121508 9:134836398-134836420 GGGCCTGGTGGGAGGCGTCTGGG - Intronic
1062212681 9:135373140-135373162 GGGCCTGGGTGGAGGACTGGGGG + Intergenic
1062266719 9:135689864-135689886 TGGGCAGGTGGGCTGCCTGGAGG - Intergenic
1062289210 9:135787058-135787080 CTGGCTGCTGGGAGGGCTGGGGG - Intronic
1062345101 9:136110915-136110937 CGGGTGGGAGGGAGGCCTGGAGG - Intergenic
1062413101 9:136434543-136434565 GGTGCAGGTGGGAGCTCTGGGGG + Intronic
1062424604 9:136500315-136500337 GGGTCTGGCAGGAGGCCTGGGGG - Intronic
1062430673 9:136525641-136525663 GGGGCCGGTGGGGGTCCTGTGGG - Intronic
1062432584 9:136532678-136532700 GGGGCTGTCAGGAGCCCTGGGGG + Intronic
1062568815 9:137175185-137175207 GGGGCGGGGGCGAGGCCTGCAGG - Intronic
1062577424 9:137215196-137215218 GCTGCTGGTGAGGGGCCTGGTGG + Exonic
1062591706 9:137277437-137277459 GGGGGAGGTGGGGGCCCTGGAGG + Intergenic
1062618308 9:137407859-137407881 GGGTCTGGGGGGAGGCCGGAGGG + Intronic
1062622382 9:137428757-137428779 GGGCCAGGTGGGGGGACTGGGGG + Intronic
1203767965 EBV:36390-36412 GGGGGTGGTGGGAGTGGTGGGGG - Intergenic
1203632054 Un_KI270750v1:79837-79859 GGCTCTGCTGGGAGCCCTGGGGG - Intergenic
1203662891 Un_KI270753v1:61635-61657 GGGGCTTGTGGGCAGGCTGGCGG + Intergenic
1203670479 Un_KI270755v1:7062-7084 GGGGCTTGTGGGCAGGCTGGTGG - Intergenic
1185578274 X:1190971-1190993 GGGGCTGGTGGGGAAGCTGGAGG + Exonic
1185777908 X:2820424-2820446 AGAGCTGGTGGGAAGGCTGGGGG + Intergenic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1185975324 X:4713782-4713804 GGGGCCGGGGGCAGGCATGGTGG - Intergenic
1186554311 X:10541333-10541355 GGGGGTGGTGGGAGGGCAGGGGG - Intronic
1186788764 X:12976405-12976427 GCGGCCGGTGGGAGGGCGGGAGG + Intronic
1187352517 X:18533914-18533936 GGGGCCAGTGGGAGGGTTGGAGG - Intronic
1187700590 X:21961316-21961338 GGCTCTGGTGGGAGGCTTGGGGG + Intronic
1188171965 X:26938585-26938607 GGGCCTGTTTGGAGGGCTGGGGG + Intergenic
1188892314 X:35625945-35625967 GCGGCTGGTGGGGAGCATGGCGG + Intergenic
1189322319 X:40094478-40094500 CGGGCTGGTGGGAGCGCGGGGGG - Intronic
1190108505 X:47574724-47574746 CGGGCTGCTGGGAGGTCTGGCGG + Exonic
1190212763 X:48460957-48460979 GGGGCTGGGGCTAGGGCTGGGGG - Intronic
1190296421 X:49030274-49030296 GGGGGTGGTGGGAGGACTGTCGG - Exonic
1192664452 X:73073605-73073627 GGGGTTGGTGGCAGGGTTGGGGG - Intergenic
1192769110 X:74168565-74168587 AGGGCTGGTGGGAGGTGTGTTGG + Intergenic
1192988743 X:76428271-76428293 AGAGATGGTGGGAGGCCCGGAGG - Exonic
1195094784 X:101492799-101492821 GGGGCTGGTGGCCAGGCTGGTGG + Exonic
1195533329 X:105982438-105982460 GGGGCTGGAGGTGGGCCTAGGGG + Intergenic
1195877899 X:109561471-109561493 GGGCCTGGTGGGAGGTGTCGGGG + Intergenic
1195940830 X:110166570-110166592 GGGGCCCCTGGGAGGCCTGTGGG + Intronic
1196278886 X:113799622-113799644 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1196604703 X:117643687-117643709 GGAGCTGGTGGGAGGCCCTTAGG + Intergenic
1196888577 X:120270798-120270820 GGGTCTGCAGGGAGGCCCGGGGG - Intronic
1197225660 X:123953873-123953895 GAGGCTGGTTTGAGCCCTGGAGG - Intergenic
1197980267 X:132210945-132210967 GGGACTGGTGGTAGGGGTGGGGG - Intronic
1198083385 X:133260966-133260988 GAGCCTTGGGGGAGGCCTGGAGG - Intergenic
1198458160 X:136837827-136837849 GGGGCTGATGGGAGGGCTTGGGG + Intergenic
1199541043 X:148958409-148958431 GGGGCTGGTGAGATGCAAGGAGG - Exonic
1199767564 X:150952302-150952324 GGGGCTTTTGGCAGGGCTGGAGG + Intergenic
1200008054 X:153100925-153100947 GGGGCTTGTCTGAGGACTGGAGG + Intergenic
1200017857 X:153179771-153179793 GGGGCTGGTGCTGGGGCTGGAGG - Intronic
1200042416 X:153379755-153379777 GGGCACAGTGGGAGGCCTGGGGG + Intergenic
1200090962 X:153635740-153635762 GGGGATGGGAGGAGCCCTGGGGG + Intergenic
1200129263 X:153832071-153832093 GGCCATGGTGGGAGGGCTGGAGG - Intergenic
1200137012 X:153880086-153880108 GGGTGTAGTGGGAGGCCAGGTGG - Intronic
1200213788 X:154358560-154358582 GGGGCTGGGGCCAGGCCTGGTGG - Exonic
1200402023 X:156025261-156025283 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
1200684789 Y:6248449-6248471 GGGGTTGGTGGGATGACTGCCGG - Intronic
1200766723 Y:7086369-7086391 GTTGCTGGTGGCAGGCCCGGTGG - Exonic
1200829455 Y:7676968-7676990 GGGGCTGGTGGCAGGGCCCGAGG - Intergenic
1200998299 Y:9400653-9400675 GGGGTTGGTGGGATGACTGCCGG - Intronic
1201000807 Y:9469185-9469207 GGGGTTGGTGGGATGACTGCCGG - Intronic
1201003475 Y:9489517-9489539 GGGGTTGGTGGGATGACTGCCGG - Intronic
1201006131 Y:9509799-9509821 GGGGTTGGTGGGATGACTGCCGG - Intergenic
1201274211 Y:12283489-12283511 GGGGTTGGTGAAAGGCTTGGAGG + Intergenic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic