ID: 1006175667

View in Genome Browser
Species Human (GRCh38)
Location 6:32119963-32119985
Sequence GCAAGTGAGCAGAGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006175661_1006175667 6 Left 1006175661 6:32119934-32119956 CCTGGATGAGGACAACTGGGGAC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG 0: 1
1: 0
2: 2
3: 29
4: 377
1006175660_1006175667 7 Left 1006175660 6:32119933-32119955 CCCTGGATGAGGACAACTGGGGA 0: 1
1: 0
2: 0
3: 17
4: 156
Right 1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG 0: 1
1: 0
2: 2
3: 29
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006175667 Original CRISPR GCAAGTGAGCAGAGGTCAGA GGG Intronic
900747125 1:4368035-4368057 GCAGGTGCACAGAGGTCAGTGGG + Intergenic
901258981 1:7857223-7857245 GGCAGAGGGCAGAGGTCAGAAGG - Intergenic
902091138 1:13904151-13904173 GCAAGGGAGCAGAGGATGGAGGG + Intergenic
903396122 1:23003034-23003056 GAAAGAGGGGAGAGGTCAGATGG + Intergenic
903664408 1:24997621-24997643 GAGACTGAGCAGAGTTCAGAGGG - Intergenic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906684582 1:47755376-47755398 GCCAGTGTGCTGAGGCCAGAAGG + Intergenic
906744619 1:48213051-48213073 GGAGGTGGGGAGAGGTCAGATGG + Intergenic
907299325 1:53476742-53476764 GCAAGAGAGCAGAGGGCAGGAGG - Intergenic
907310928 1:53538648-53538670 GCAAGGGAGAACAGGACAGAGGG + Intronic
907451289 1:54547495-54547517 GCCTGTGGGCAGAAGTCAGAGGG + Intronic
907477312 1:54714401-54714423 GCAAGTGGGTAGGGGCCAGAAGG - Intronic
907788192 1:57634932-57634954 GCATTTGAGCAGAGATCTGAAGG + Intronic
908022520 1:59913084-59913106 GCAAGTAAGACGAGGTCAAAAGG - Intronic
910133419 1:83936868-83936890 GAAAGTCAGGAGAGGTCTGAAGG - Intronic
910486414 1:87719659-87719681 GCAACTGTGCAGAGGGGAGATGG + Intergenic
910647150 1:89525650-89525672 GCAGGTGCTGAGAGGTCAGAAGG + Intronic
910902123 1:92132415-92132437 ACCAGTGGGCAGAGGTCAGTGGG + Intronic
911169362 1:94755122-94755144 GAAAGTCAGCAGAGGGCAAATGG - Intergenic
913721861 1:121604170-121604192 GAAAGTGGGCAGAGGACAGAGGG - Intergenic
913741645 1:121851752-121851774 GAAAGTGGGCAGAGGACAGAGGG - Intergenic
916751576 1:167727740-167727762 GTAAGAAAGCAGAGGTCAGTTGG + Intronic
916805186 1:168252609-168252631 GCAAAAGATCAGAGTTCAGAGGG - Exonic
916941692 1:169684466-169684488 GGAAGAGGGGAGAGGTCAGATGG - Intronic
918404702 1:184200277-184200299 GCGAGTGAGAAGAGGGCTGAAGG - Intergenic
921072788 1:211675925-211675947 GCCAGAGTGCAAAGGTCAGAAGG - Intergenic
921181912 1:212638045-212638067 GCCAGAGAGGAGAGGTAAGAGGG - Intergenic
922235222 1:223717582-223717604 CCCAGGGAGCAGGGGTCAGAAGG + Intronic
922689861 1:227679731-227679753 GCAAATGAGGTGATGTCAGATGG + Intergenic
923708177 1:236362796-236362818 GCAAGGCAGCAGAGATAAGATGG - Intronic
924431119 1:243997561-243997583 GAAAATAAGGAGAGGTCAGAGGG - Intergenic
1062820361 10:530187-530209 GCACGTGAGCACAGATCAAAGGG + Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1064934187 10:20662027-20662049 CAAAGTGAGCAGAGATCAGCAGG + Intergenic
1068311737 10:55286683-55286705 TCAATTCAGCAGAGGTCAAATGG - Intronic
1068924146 10:62517393-62517415 ACAAGAGAGCACAGGCCAGAGGG - Intronic
1069085250 10:64131316-64131338 GGAAGTGAGAAAAGGTCAGATGG - Intergenic
1069782508 10:70965680-70965702 GAAGGTCAGAAGAGGTCAGATGG - Intergenic
1069875640 10:71561375-71561397 GCAAGGGAGAAAAGGCCAGAGGG - Intronic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1070191735 10:74117688-74117710 ACAAGTGAGCAAAGATCTGAAGG + Intronic
1070873227 10:79776859-79776881 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071556054 10:86602311-86602333 GCAAGAGAGCAGAGGGCAGGAGG - Intergenic
1071640152 10:87299009-87299031 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071655080 10:87438936-87438958 CCATGTGGGCAGTGGTCAGAGGG + Intergenic
1072035953 10:91562977-91562999 TCAAGTTGGCAGTGGTCAGATGG - Intergenic
1072045523 10:91650938-91650960 GCAAGAGAGCAGAGGGTAGGAGG + Intergenic
1072416087 10:95248152-95248174 GGAGGTGAGAAGGGGTCAGATGG - Intronic
1072939094 10:99743542-99743564 GCAATTGAGGAGAGTTAAGAAGG - Intronic
1073148873 10:101298313-101298335 GCAGGGGAGGAGAGGTGAGAAGG + Intergenic
1075872534 10:125781354-125781376 GAAAGTGAGCAGAGCTCAGGGGG + Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1077110133 11:858683-858705 GCATGTGAGCGGAGGTCCGTGGG - Intronic
1077159265 11:1105275-1105297 GGACATGGGCAGAGGTCAGAGGG - Intergenic
1077977331 11:7261652-7261674 ACAAATGAGTAAAGGTCAGAAGG + Intronic
1079247765 11:18765611-18765633 CCAAGTGATAACAGGTCAGAAGG + Intronic
1079592591 11:22198080-22198102 GTAAGTGTGCAGGGGTGAGAGGG + Intronic
1080997614 11:37623083-37623105 GCCAGAGAGAGGAGGTCAGAAGG - Intergenic
1082794212 11:57368329-57368351 GCAAGTGGGCAGAGGGCCCATGG - Intronic
1083460393 11:62807202-62807224 GGAAGGGAGCAGAGGCCAGCTGG - Exonic
1084611075 11:70203391-70203413 GCCAGCGAGCCGAGGACAGAGGG + Exonic
1085026014 11:73237008-73237030 GGAAGGGTGGAGAGGTCAGAGGG - Intergenic
1086138217 11:83464179-83464201 GAAAGGGAACAGAAGTCAGATGG + Intronic
1086419144 11:86620895-86620917 ACAAGTGGGCCTAGGTCAGATGG - Intronic
1087130848 11:94668288-94668310 GCAAGGGGGCAGAGGCCAGGGGG - Intergenic
1088582736 11:111331322-111331344 GAAAGAGAGCAGAGGTGAGGGGG - Intergenic
1088714333 11:112535743-112535765 GAAAGAGAGCAGAGCTGAGAGGG - Intergenic
1088864930 11:113838618-113838640 GAATTTGAGCAGAGGTCTGAAGG - Intronic
1090634065 11:128678128-128678150 GCAAGGGAGCTGAAGTGAGAGGG + Intergenic
1091004799 11:131943115-131943137 GGAGGTGAGAAGAGGCCAGAAGG - Intronic
1091227298 11:133965177-133965199 GACAGGGGGCAGAGGTCAGATGG + Intergenic
1091364710 11:135007968-135007990 GAAAGAGGGCAGAGGGCAGAAGG + Intergenic
1091531863 12:1365286-1365308 GCAAGTGAGCAGAGCACGTAAGG - Intronic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1091655688 12:2345192-2345214 CCAAGTGCGCAGAGGTGAAAGGG + Intronic
1091692511 12:2606660-2606682 GCAAGTGAGTAGAGGTGGGAGGG + Exonic
1092153709 12:6268603-6268625 GCCAGTCAGCTGAGGTCAGAGGG + Intergenic
1092237944 12:6821640-6821662 GCCAGTGAGCCCAGGCCAGAGGG - Exonic
1092621530 12:10276422-10276444 GGAAGTGAGCAAAGGCCAAAAGG - Intergenic
1092624163 12:10307746-10307768 GAAGGTGAGAGGAGGTCAGAGGG - Intergenic
1093428048 12:19051613-19051635 GCATCTGAGCAGAGATCTGAAGG - Intergenic
1093552448 12:20430627-20430649 GAAAGTGAGCAAAGTTGAGATGG + Intronic
1093822688 12:23641151-23641173 GAAAGTGAGCATTGATCAGAGGG + Intronic
1094000412 12:25688322-25688344 GCAAATGAGAAGAGGCAAGAGGG + Intergenic
1094096704 12:26713141-26713163 GCATGTGAGCAGAGGCCTGCAGG + Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1097270625 12:57771955-57771977 GCTAGTGAGGAGTGGGCAGAGGG - Exonic
1097326819 12:58286667-58286689 GCAAGTTAGCAGGGGAGAGAAGG - Intergenic
1097607102 12:61768950-61768972 GCCAGTGAGCAGGGGTGAGAAGG - Intronic
1098744824 12:74222654-74222676 GCAAGTGAGTAGGGGTGAGGGGG + Intergenic
1102546363 12:113659573-113659595 GCAAGTGTCCAGAGGTGGGAGGG + Intergenic
1103036485 12:117660958-117660980 GCAAGTGTGCAGGGCACAGAAGG + Intronic
1103507445 12:121451437-121451459 TCAACTGCACAGAGGTCAGATGG + Intronic
1104695743 12:130862384-130862406 GCAGGTGAGCACAGGAGAGAAGG - Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1106748546 13:32731403-32731425 ACATGTGAGCAGAGTTCTGAGGG - Intronic
1110242247 13:73282298-73282320 GCCAGTGAGAAGAAGGCAGAAGG - Intergenic
1113529501 13:111011789-111011811 GCAAGGGAGGAGAGTTCAGGAGG - Intergenic
1113726154 13:112603846-112603868 GGAAGGGAGAAGAGGGCAGAGGG + Intergenic
1114443963 14:22773738-22773760 GGAATTGAGAAGAGGTCAGCTGG + Intronic
1115109714 14:29807185-29807207 GCAAGAAAGCAGAGCTCAGACGG + Intronic
1115803164 14:37019217-37019239 GCAACTGAGAAGAGGCCACATGG - Intronic
1117313902 14:54555443-54555465 GCAAGTGAGCACAGGTTATTCGG - Intergenic
1117819803 14:59636346-59636368 GCAAGGGAGCAGAGGGCAAGAGG - Intronic
1118760671 14:68878804-68878826 GAAAGACAGCAGAGGGCAGAGGG + Intronic
1118973012 14:70653372-70653394 GCAAGACAGGAGAGGTGAGAAGG + Intronic
1119119595 14:72062305-72062327 GCAAGTGAGGAGAGGTGGGTAGG + Intronic
1119674275 14:76542239-76542261 GTAAGGGGGCAGTGGTCAGAGGG - Intergenic
1120663124 14:87274347-87274369 GCAATTTAGTAGAGGTGAGATGG + Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121732684 14:96197527-96197549 ACAAGTGATCAGAGGACAGGAGG + Intergenic
1121876436 14:97457452-97457474 GTAAGTGGGCAGAGGGCAGCTGG + Intergenic
1122366582 14:101198106-101198128 GCCAGTGAGGAGAGGGCAGGTGG + Intergenic
1123869020 15:24552775-24552797 GCAAGTCAGCAGAGGAGAAAGGG + Intergenic
1125743725 15:41985088-41985110 GCTAGTGAGCAGAGGAACGAGGG - Intronic
1126043837 15:44619577-44619599 GCAAGTGACAAGAGCTGAGATGG - Intronic
1126843653 15:52740238-52740260 GGAGGTGGGGAGAGGTCAGATGG - Intergenic
1128034701 15:64514593-64514615 GAAAGTGAGAAGAGGCTAGAAGG - Intronic
1128564273 15:68689819-68689841 ATAAATGTGCAGAGGTCAGAAGG + Intronic
1129272317 15:74425607-74425629 GCAAGTGAGCACAGGTGTGCAGG + Intronic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1132257202 15:100385953-100385975 GCATGTCAGCAGAGGTCTCAGGG + Intergenic
1132599752 16:768218-768240 GCCATTGAGCTGAGGTCAGCTGG + Intronic
1134759300 16:16699473-16699495 CCTAGAGAGCAGGGGTCAGAGGG - Intergenic
1134986771 16:18659710-18659732 CCTAGAGAGCAGGGGTCAGAGGG + Intergenic
1136516089 16:30769158-30769180 GCAAGTGGGCAGAGACAAGATGG - Intronic
1137511526 16:49104982-49105004 TCCAGTCAGCAGAGGTGAGATGG - Intergenic
1138438353 16:57019563-57019585 GTCAGTGAGCACAGGGCAGATGG + Intronic
1139144590 16:64308335-64308357 GGAGGTGAGCAGAGGGCAGCAGG + Intergenic
1141943741 16:87296147-87296169 GACAGAGAGCAGAGGTCAGCTGG + Intronic
1141948043 16:87323678-87323700 GCAGGTCTGCAGAGGACAGACGG - Intronic
1142638154 17:1270497-1270519 GGCAGTGGGCAGAGGGCAGAGGG + Intergenic
1142730537 17:1852532-1852554 GCCAGAGGGCAGAGGGCAGAGGG + Intronic
1143331672 17:6141386-6141408 GCCAGGGAGCAGAGGTCAGAAGG + Intergenic
1143537785 17:7551419-7551441 GCATGGCAGCACAGGTCAGATGG - Intronic
1143965543 17:10754260-10754282 GGAAGTGACTAGAAGTCAGAAGG - Intergenic
1143987561 17:10928088-10928110 GCAAGGGAGGAAAGGTTAGAAGG + Intergenic
1144022632 17:11250745-11250767 ACACGTGAGCAGAGTTAAGAGGG - Intronic
1144329281 17:14209929-14209951 GGAGGTTAGCAGTGGTCAGATGG - Intergenic
1145007382 17:19345218-19345240 GCAAGTGGGCAGAGGCCATGAGG + Intronic
1145298299 17:21612170-21612192 GCAAGTGGGCGGAGGAAAGAGGG - Intergenic
1146315205 17:31801492-31801514 CCAACTGGGCAGAGGTCAGCTGG + Intergenic
1146941362 17:36846341-36846363 GCAAGTGAGGGAAGGGCAGATGG + Intergenic
1147158544 17:38557895-38557917 GAAAGTAGGCAGAGGGCAGAGGG + Intronic
1147744584 17:42687504-42687526 GCAAGCGAGCAGAGTTCCGAGGG + Intronic
1147878158 17:43636361-43636383 GCAGGTGAGCAGATTTCTGAAGG + Intergenic
1147918227 17:43901040-43901062 GACTGAGAGCAGAGGTCAGAGGG - Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148864084 17:50619627-50619649 GCAGGGGAGCAGGGGTCAGAGGG - Intronic
1149119784 17:53148648-53148670 GCAATTGAACAAAAGTCAGAAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151517621 17:74606502-74606524 GCAAGTGAGCAGTGCTAAGGGGG + Intergenic
1151549693 17:74814983-74815005 GCACTTGAGCAGGGCTCAGAAGG + Intronic
1151713895 17:75821800-75821822 GCGAGTGAGCAGAGGGCAGCTGG + Intronic
1151887787 17:76933323-76933345 GGAAGGGAGCAGAGGGTAGAGGG - Intronic
1152742905 17:82026176-82026198 GCGAGGGGGCAGAGGTCAGGAGG - Intronic
1158415477 18:57246447-57246469 GCAAGTGAGCACAGGGCCGCAGG + Intergenic
1158684257 18:59598734-59598756 CCAAGTGAGCAGTTCTCAGATGG + Intronic
1158872265 18:61699474-61699496 GCAAGAGAGCAGAGAACAGATGG + Intergenic
1159103210 18:63977969-63977991 GGACGGAAGCAGAGGTCAGAGGG - Intronic
1159156524 18:64590403-64590425 GAAAATGAGCAGCGGTCACATGG + Intergenic
1159384369 18:67704216-67704238 GCTAGTGTGCAGATGTAAGAGGG + Intergenic
1160036463 18:75305832-75305854 GCACGTGGGCAGTGGTCAGAGGG - Intergenic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1163710880 19:18846116-18846138 GCAGGTGAGCTGAGCTCAGCTGG + Exonic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1164620025 19:29689860-29689882 CCAAGAGAGAAGAGGTTAGAGGG + Intergenic
1165312191 19:35035133-35035155 GCAAATCTGCAGAGGTGAGATGG + Intronic
1165490924 19:36122170-36122192 GCAGGTGAGCAGAGCGCAGGAGG + Intronic
1165742005 19:38210313-38210335 GGAAGGGAGCAGGGGTGAGAAGG - Intergenic
1165825752 19:38704901-38704923 GGAAGGGGGCAGAGGGCAGAAGG - Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167151799 19:47714248-47714270 ACAAGTGAGCCTGGGTCAGAAGG - Intronic
1167368532 19:49066946-49066968 GCAAGGGGGAAGAGGGCAGATGG - Intergenic
1168103643 19:54153908-54153930 GCAAGGGAGCAGAGGCCAGCAGG - Intronic
1168248035 19:55124161-55124183 GGAAGAGGGGAGAGGTCAGATGG - Intergenic
1168583441 19:57574389-57574411 GGAAGTGCTCAGTGGTCAGAAGG - Intronic
924998739 2:386897-386919 GGCAGAGAGCAGAGGGCAGAGGG - Intergenic
925252162 2:2448883-2448905 GCCAGTGTGCAGAGATCACAGGG + Intergenic
925735137 2:6957313-6957335 GAGAGTGCTCAGAGGTCAGAAGG + Intronic
926190814 2:10726233-10726255 GAAAATGAGCTGAGGTCAGATGG + Intronic
926828319 2:16932086-16932108 GAAAGAGAGCAGAGCACAGATGG + Intergenic
927003916 2:18827770-18827792 GTAAGTGAGTAGAAGTCAGCAGG - Intergenic
927138079 2:20111872-20111894 ACAAGTGAGCAGAGGGCTCAAGG + Intergenic
928230835 2:29497507-29497529 GAGAGTGAGCTGAGGTCAGTGGG - Intronic
929076769 2:38084814-38084836 GGAGGTGGGGAGAGGTCAGATGG + Intronic
930171100 2:48252567-48252589 GCATCTGAGCAGAGGACAAAAGG + Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
931571169 2:63670703-63670725 GCAAGTTGGCAAAGGGCAGATGG - Intronic
932470299 2:71950786-71950808 CCAAGGGAGCAGAGGTGAGTGGG - Intergenic
932818452 2:74879948-74879970 GCAAGGGAGCAGTGGCCAGGGGG + Intronic
933784846 2:85830417-85830439 GCAGCTAAGGAGAGGTCAGAGGG - Intergenic
934066382 2:88345791-88345813 TGAGGTGAGGAGAGGTCAGAAGG - Intergenic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935039842 2:99415587-99415609 GCAAGTGCTCAGTGGTCACATGG - Intronic
937002921 2:118484605-118484627 GCAGGTGAGCAGAGGTTCCAAGG - Intergenic
937206334 2:120239260-120239282 TCAAGTGAGCAGAGCACACAGGG + Intergenic
937865912 2:126751789-126751811 GGCAGGGAGCAGACGTCAGATGG + Intergenic
941974221 2:171385744-171385766 GTAAGTGAAGAGAGGTGAGAGGG + Intronic
944605497 2:201348385-201348407 GTCAGAGAGCAGAAGTCAGATGG - Intronic
944855301 2:203761532-203761554 GCAGGTGAGCAGCATTCAGAGGG - Intergenic
945968312 2:216211516-216211538 TCAAGTGGGCAGAAGTGAGATGG + Intergenic
946145574 2:217728135-217728157 GCACGTGAGCAGAGGAGATAAGG + Intronic
946238892 2:218341951-218341973 ACAAGGGAGCAGGGGACAGAAGG - Intronic
946353035 2:219168156-219168178 GCAGGGCAGTAGAGGTCAGAAGG - Intronic
947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG + Intronic
947544603 2:231001926-231001948 GCATGTGAGCCGAGTCCAGAAGG + Intronic
948371768 2:237494187-237494209 GGCAGAGAGCAGAGGACAGAGGG + Intronic
948688162 2:239684525-239684547 GCTGGTGAGCAGAGCTCATATGG + Intergenic
948750854 2:240132086-240132108 GCAGCAGAGCAGAGGTCGGAAGG - Intronic
1170068954 20:12344321-12344343 CCAAGAGGGGAGAGGTCAGACGG + Intergenic
1170106142 20:12755537-12755559 CCAAGAGGGGAGAGGTCAGATGG - Intergenic
1170538332 20:17363697-17363719 GCCAGCGAGCTAAGGTCAGAGGG + Intronic
1170708446 20:18767176-18767198 CCAAGGGAGCAGAGTTCAGTAGG + Intergenic
1171370854 20:24661277-24661299 GCAAGTGAGCAGAAGAAAGAAGG + Intronic
1172005247 20:31815219-31815241 GCTAGTAAGCAGAGGTCTGTGGG - Intergenic
1172362633 20:34324741-34324763 TGAAGTGAGCTGAGGGCAGAGGG + Intergenic
1172846979 20:37935412-37935434 GCAATTGTGCAGAGTTCTGAAGG - Intronic
1173434182 20:43017565-43017587 GCAAGTGAGGAGAGGTGGGGAGG - Intronic
1173922330 20:46755650-46755672 ACATTTGAGCAGAGGTCAGAAGG - Intergenic
1174128902 20:48328148-48328170 GCAAGAGGGCGCAGGTCAGAGGG + Intergenic
1174177013 20:48651603-48651625 ACATCTGAGCAGAGATCAGAGGG + Intronic
1174397791 20:50258771-50258793 ACAAGTGAGAAGACTTCAGATGG - Intergenic
1174488747 20:50877342-50877364 GCAAGAGTGCAGAGGTCATTAGG + Intronic
1174867694 20:54152847-54152869 GCAAGTGTGCAAAGAACAGAGGG + Intergenic
1174919126 20:54683138-54683160 CCCAGTGAGCAGGGGTCAGTGGG - Intergenic
1176137165 20:63529259-63529281 CGAAGCCAGCAGAGGTCAGAGGG - Exonic
1176284592 21:5012712-5012734 TCACGTGGGCAGGGGTCAGAGGG - Intergenic
1178150449 21:29788425-29788447 GCCAGTGAGCACAGTTGAGATGG + Intronic
1178635459 21:34298397-34298419 GCAACTGAGGAGAGGACAGATGG - Intergenic
1179420083 21:41228529-41228551 GCCAGTGTGCAGAGATCACATGG + Intronic
1179872589 21:44250763-44250785 TCACGTGGGCAGGGGTCAGAGGG + Intronic
1180857777 22:19059193-19059215 ACAAGGGAGCAGAGGTGAAAAGG + Intronic
1180979588 22:19872335-19872357 GCAGGTGGGCAGAGGCCAGCAGG + Intergenic
1181339417 22:22166140-22166162 CCCAGTGAGCAGGGGACAGAGGG - Intergenic
1181584332 22:23844871-23844893 GGAAGGGAGCAGAGGAGAGAAGG + Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182692694 22:32175091-32175113 TCAAGTGCCCAGAGGTCACAGGG - Intergenic
1182955091 22:34416835-34416857 TCAAGTAAGGAGAGGACAGATGG + Intergenic
1183490165 22:38111724-38111746 GGAACGGAGCAGAGGGCAGAGGG + Exonic
1183827636 22:40400971-40400993 GCTAGAGAGCAGAGCTGAGAAGG - Intronic
1184258587 22:43301545-43301567 GCACGTGAGCTGAGGTCTGAAGG - Intronic
1184334338 22:43844612-43844634 CCAGGTGTGCAGAGCTCAGAGGG - Intronic
1184600108 22:45538426-45538448 TCAAGGGAGCAGAGCCCAGAAGG - Intronic
1184724132 22:46333280-46333302 TCAGGTGAGCAGAGGACTGATGG - Intronic
1185294310 22:50045833-50045855 GTAAGTGAGGAGACGGCAGAGGG - Intronic
950264140 3:11562218-11562240 GCCAGTGAGGAGAGGCAAGATGG - Intronic
952655266 3:35778368-35778390 GCAAGAGATCAAAGGGCAGAGGG + Intronic
953077225 3:39581858-39581880 GGAGGAGAGGAGAGGTCAGAAGG + Intergenic
953563591 3:44013104-44013126 GGATGTGTGCAGAGGTCTGAGGG + Intergenic
954176916 3:48852096-48852118 GCAAGTATGCAGAGGGCATAAGG - Intergenic
954218855 3:49140059-49140081 GCAGGAGTGCAGAGGTGAGAGGG - Intergenic
954613961 3:51960129-51960151 GCAAGGGAGCAGTTGTAAGAGGG - Intronic
954884009 3:53856123-53856145 GCAGGTGTGAGGAGGTCAGAGGG + Intronic
954893634 3:53956327-53956349 GTAATTGAGCAGTGGTGAGAGGG - Intergenic
955771476 3:62389135-62389157 GGACCTGAGCAGAGGTTAGAGGG + Intergenic
955856551 3:63278789-63278811 TCAGGTGAGGAGAGGTCGGATGG + Intronic
956249089 3:67216902-67216924 GCAGGTGAGATGAGGTGAGAGGG - Intergenic
957177247 3:76827328-76827350 GTAAGTGTTCAGAAGTCAGAAGG - Intronic
957309490 3:78501165-78501187 GCCAGTGTGCAGAGATCACATGG - Intergenic
960054211 3:113265063-113265085 CCAACTGAGCAGCTGTCAGAGGG + Intronic
960625381 3:119677069-119677091 GGAAGAGGGCAGAGGGCAGAAGG + Intronic
961074730 3:123971645-123971667 GCATGTGAGATGAGGTCAGTGGG + Intronic
961083199 3:124043887-124043909 GTAAGTGAGGAGAGGAGAGAGGG + Intergenic
963056187 3:141188209-141188231 GCAAGTAATAAGAGGGCAGAAGG + Intergenic
963774996 3:149429563-149429585 TGAGGTTAGCAGAGGTCAGAGGG + Intergenic
964284109 3:155098791-155098813 GAAAGTTAGGAGAGTTCAGATGG + Intronic
964983547 3:162714031-162714053 GGAAGAGGGGAGAGGTCAGATGG - Intergenic
967308395 3:188082252-188082274 GCAGATGTTCAGAGGTCAGATGG + Intergenic
967769069 3:193314014-193314036 GAAAGTGAGCAAATGTTAGAAGG - Exonic
968504335 4:964955-964977 GCAAGGGGCCTGAGGTCAGAGGG - Intronic
968647972 4:1749372-1749394 GCAGGTGAGGAGGGGGCAGATGG - Intergenic
969132793 4:5004127-5004149 GCAGCTGAGCAGAGGAGAGATGG + Intergenic
969248998 4:5954964-5954986 GCAGGTCAGCAGAGGTCTGCAGG - Intronic
969249006 4:5955020-5955042 GGAAGACAGCAGGGGTCAGAGGG - Intronic
969313405 4:6367375-6367397 CCCAGAGAGCAGGGGTCAGAAGG + Intronic
969352120 4:6603992-6604014 GGAGGTGAGCAGAGGCCAGGAGG + Intronic
972604139 4:40598777-40598799 ACATATGAGCAGAGGACAGATGG - Intronic
973261220 4:48165964-48165986 GCATGGGAACACAGGTCAGAGGG - Intronic
973390305 4:49548659-49548681 GAAAGTGGGCAGAGGATAGAGGG + Intergenic
973707660 4:53596122-53596144 GCAGATGAGCAGATCTCAGAAGG + Intronic
974173520 4:58295408-58295430 GGAAGAGGGGAGAGGTCAGATGG + Intergenic
974861049 4:67522335-67522357 GCAATTCAGCAGAGCACAGAAGG + Intronic
975382879 4:73722838-73722860 GGAAATGAGCAGAAGTCAGTGGG + Intergenic
975844254 4:78508241-78508263 ACAAGTTAGCGGAAGTCAGAAGG - Intronic
976399111 4:84587658-84587680 GCAAGTCTTCAGAGGGCAGAGGG - Intronic
977128270 4:93198729-93198751 GAAACTGAGAAGAGGTCAAAAGG + Intronic
977294105 4:95192491-95192513 GCAGGGGAGGAGAGGTGAGAAGG - Intronic
977609024 4:99013726-99013748 GTTAGTGATGAGAGGTCAGAGGG + Intronic
977610051 4:99021807-99021829 GTTAGTGATGAGAGGTCAGAGGG + Intronic
978165397 4:105601203-105601225 GAAAGAGTGAAGAGGTCAGAAGG - Intronic
981231294 4:142358872-142358894 TCAACTGAGCAGTGGTGAGAGGG + Intronic
982243073 4:153320086-153320108 GTAAGTCAGCAGAGATCAAAAGG - Intronic
982454643 4:155594335-155594357 GAAACTGAGAAGAGATCAGAGGG - Intergenic
982787341 4:159551113-159551135 GGTAGTGAGAAGAGGTCTGAGGG + Intergenic
984189463 4:176588234-176588256 GCAAGTGAGTAGAGGAAAAAAGG + Intergenic
988959333 5:36353923-36353945 AAAAGAGAGCAGAGGGCAGAAGG + Intergenic
988991830 5:36679218-36679240 GCAAGGGAGCAGGAGGCAGAGGG + Intronic
989116777 5:37962464-37962486 GTCAGTGAGCAGAGGCTAGATGG + Intergenic
989688999 5:44118796-44118818 GGAAGAGGGGAGAGGTCAGAAGG + Intergenic
990303451 5:54472334-54472356 GCAAGAGAGCAGAGGGTGGAAGG + Intergenic
990935233 5:61140801-61140823 GCATGTGATCAGAGGTATGAAGG - Intronic
991144809 5:63288276-63288298 GTCAGTGAGCTGAGGTCACAGGG + Intergenic
993259261 5:85638578-85638600 GCCAGTGGGCACAGGTCAGTGGG + Intergenic
996622515 5:125525161-125525183 GCAACAGAGCAGAGGCCATATGG - Intergenic
998371130 5:141662067-141662089 GCAACCGTGCAGAGGTCACAGGG + Exonic
998463159 5:142324187-142324209 GCAGCGGAGCAAAGGTCAGACGG + Intronic
999272456 5:150304557-150304579 ACAAGTCACCAGAGGTCAGGTGG + Intronic
999313701 5:150570314-150570336 GCAAGTGAGCAGGAGTCTGGGGG - Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001649358 5:173304395-173304417 GCAAATTGGCAGAGGGCAGAAGG - Intergenic
1002334925 5:178470971-178470993 GAAAGTTAGCAAAGCTCAGAGGG - Intronic
1002401492 5:178993838-178993860 GCAGGAGACCAGAGCTCAGAAGG + Intronic
1002630703 5:180574108-180574130 AAAAGTGAGAAGTGGTCAGAGGG - Exonic
1002823686 6:753603-753625 GAAAGTGAGCTGGAGTCAGAGGG + Intergenic
1004624168 6:17359059-17359081 GCATGTGTGCAGAGATCACATGG - Intergenic
1005246663 6:23893426-23893448 GCAAGTGAGAAGAGTTCCAAGGG - Intergenic
1005338573 6:24821647-24821669 TCAAGTGAGTAGAGGCCAAAAGG - Intronic
1005915043 6:30344438-30344460 GGAAGATAGAAGAGGTCAGAGGG + Intronic
1006072532 6:31507764-31507786 GCAAGTGAGGAGTGGGCAGCAGG + Intronic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006735849 6:36271830-36271852 GCAAGTGGGGAGGGGGCAGAGGG + Intronic
1007080276 6:39095996-39096018 GAAATAAAGCAGAGGTCAGACGG - Intergenic
1007692444 6:43711441-43711463 GGAAGGGGGCTGAGGTCAGATGG + Intergenic
1008389151 6:50929365-50929387 ACATTTGAGCAGAGGCCAGAAGG + Intergenic
1010049134 6:71482781-71482803 AAATGTGAGCAGAGGTGAGATGG - Intergenic
1010597677 6:77784834-77784856 GCAAGTGAACAGGACTCAGATGG - Intronic
1011210608 6:84952259-84952281 GCAAGAGAGCAGGTGTGAGAGGG + Intergenic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1011538641 6:88406623-88406645 GACAGTGGGCACAGGTCAGAGGG + Intergenic
1013674547 6:112443373-112443395 GAAAGTGACCAGAGCCCAGAGGG + Intergenic
1014182075 6:118395900-118395922 GCAAAAGTGCACAGGTCAGAGGG + Intergenic
1014259061 6:119195293-119195315 GCAAGTGAGCAGAGAGCAAGTGG - Intronic
1014395917 6:120926488-120926510 GGAAGAGAGGAAAGGTCAGATGG - Intergenic
1015222107 6:130815612-130815634 GCTAATGAGCAAAGTTCAGAGGG + Intergenic
1016454543 6:144216788-144216810 GGAAGTGAGCAGAGCTCTGAGGG - Intergenic
1016781961 6:147968739-147968761 GCAAGGGAGCACAGAGCAGAGGG - Intergenic
1017677747 6:156831291-156831313 GGAAGAGAGCAGAGGTGGGAAGG + Intronic
1017743542 6:157427290-157427312 GCAAGTGGGCAGAGATGTGAGGG + Intronic
1017781231 6:157716968-157716990 GCAAGTGCGGAGATGACAGACGG - Intronic
1018340308 6:162844472-162844494 GAAAGTGGGCACAGGTCAGTGGG - Intronic
1018346625 6:162905567-162905589 GCAAAGTAGCAGACGTCAGAAGG - Intronic
1019109492 6:169698487-169698509 CCCATTGAACAGAGGTCAGATGG + Intronic
1019641880 7:2107632-2107654 GCATCTGAGCAGAGGCCTGAGGG - Intronic
1019692798 7:2426100-2426122 GCCAGTGAGAAGAGGGCAGCTGG + Intronic
1021327883 7:19296771-19296793 GAAAGTCAGCAAAGGACAGATGG + Intergenic
1023285705 7:38616836-38616858 GGAAGTGAGCAGAGGAGAGGAGG + Intronic
1023648265 7:42341947-42341969 ACAAATGAGCAGGGGACAGAGGG + Intergenic
1024976996 7:55122518-55122540 AAAAGTGAGCGGAGCTCAGAAGG - Intronic
1030163717 7:106532499-106532521 GGAAGAGGGGAGAGGTCAGATGG + Intergenic
1031682690 7:124694126-124694148 GCAACTGAGCATAGGTCTGATGG - Intergenic
1032431894 7:131869261-131869283 GCAAATCCTCAGAGGTCAGAGGG + Intergenic
1032441644 7:131946681-131946703 GGAGGAGAGCAGAAGTCAGAGGG + Intergenic
1032508306 7:132452400-132452422 ACATGTTAGCAGAGCTCAGAAGG + Intronic
1032708618 7:134443477-134443499 GCAAGTGCTCTGAGGACAGAGGG + Intronic
1033057722 7:138074999-138075021 GGTAGGGAGTAGAGGTCAGAGGG + Intronic
1033415384 7:141157132-141157154 GCCAGTGGGAAGAGGGCAGAAGG - Intronic
1034819472 7:154203447-154203469 GCTTCTGAGCAGAGGTCAGGAGG - Intronic
1035180939 7:157089254-157089276 GCCAGGGAGCGGAGGACAGATGG + Intergenic
1035999897 8:4590923-4590945 CCAACTCAGCAGAGCTCAGAAGG - Intronic
1036612968 8:10365904-10365926 GCAAGTATGCAGAGGTAGGAAGG - Intronic
1037687848 8:21158819-21158841 GCAAGCGAGCACAGATGAGATGG - Intergenic
1038030008 8:23629588-23629610 GCAAGAGAGCAGAAGCAAGAAGG + Intergenic
1041324102 8:56647008-56647030 GCTTCAGAGCAGAGGTCAGATGG - Intergenic
1042333193 8:67604391-67604413 GCATTTGAGCAAAGGTCTGAAGG - Intronic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1043558149 8:81458127-81458149 TCAAGTGGGCAGAGGACAGAGGG + Intergenic
1043597554 8:81902604-81902626 GGAGGAGAGGAGAGGTCAGATGG + Intergenic
1043641179 8:82452256-82452278 GCAAGGGAGGAGAGGACAGTGGG + Intergenic
1043882405 8:85559849-85559871 GCATGTGAGCAGAGAACTGAGGG - Intergenic
1044301865 8:90593769-90593791 GCAAATGAGCAGAGTCCTGAGGG + Intergenic
1044402956 8:91793680-91793702 GACAGTGAGCACAGGTCAGTGGG + Intergenic
1044678084 8:94749613-94749635 GTTAGTGATAAGAGGTCAGAGGG + Intronic
1045279644 8:100738965-100738987 GCAAGTGTGCAGAGTTGGGAAGG - Intergenic
1047260860 8:123258263-123258285 GCATGTGGGCAGAGATCACATGG - Intronic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1048744550 8:137599363-137599385 GGAAGTGTGCAGGGGTCACAGGG + Intergenic
1048799291 8:138181446-138181468 GGAAGTGGGCAGAGGTGAGGTGG - Intronic
1048811863 8:138295596-138295618 GCCTGTGAGCAGAGTTCTGAAGG + Intronic
1049570813 8:143369518-143369540 GGAAGTGAGAAGAGGCCAGCCGG - Intronic
1051254026 9:15193204-15193226 GGAAGAAAGCAGAGGACAGATGG - Intronic
1052732638 9:32307530-32307552 CCAAGTGAGGAGATGTGAGAAGG - Intergenic
1052910033 9:33872560-33872582 GCAAATCACCTGAGGTCAGAAGG + Intronic
1053220308 9:36307052-36307074 GCAGGTGAGCAGACTTCAGCAGG + Intergenic
1053361311 9:37488534-37488556 CCAATAGAGGAGAGGTCAGATGG + Intronic
1057242802 9:93426976-93426998 TTAAGGGAGCAGTGGTCAGAGGG - Intergenic
1057495300 9:95555618-95555640 GCATGTGAGCAGAGGTCTGCAGG - Intergenic
1057812679 9:98269908-98269930 GGAAGAGGGGAGAGGTCAGATGG + Intergenic
1057988070 9:99737857-99737879 GCATCTGAGCAGAGATCGGAAGG - Intergenic
1058231808 9:102435555-102435577 GCTAGTGTGCAGAGATCACATGG - Intergenic
1060528198 9:124332346-124332368 CCAAGTCTGCAGAGGTCAGGGGG + Intronic
1061427906 9:130512186-130512208 GACAGTGGGCAGAGGTGAGAGGG - Intergenic
1185452060 X:287875-287897 ACAAGTGAGCACACGTCAGGAGG + Intronic
1189319925 X:40081801-40081823 ACAGCTGAGAAGAGGTCAGATGG + Intronic
1189890391 X:45595533-45595555 GCAGGTGAGGAGAGGCCAGCAGG + Intergenic
1190262084 X:48803710-48803732 GGTGGTGAGGAGAGGTCAGATGG - Intronic
1192050587 X:67720642-67720664 GAAAGAGAGAAGAGGGCAGATGG - Intronic
1192474413 X:71427551-71427573 AAAAGTAAGCAGAGGGCAGATGG + Intronic
1192587469 X:72330378-72330400 GCAATTGAGCTGAGTTCAGCTGG - Intronic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195254021 X:103076198-103076220 CCAAGTGAGCAGAGGTTGGGTGG - Intronic
1195326962 X:103765865-103765887 GGAGGAGGGCAGAGGTCAGATGG + Intergenic
1195486816 X:105418021-105418043 GTAAGTGGGCAGAGGAGAGAGGG - Intronic
1196525577 X:116725040-116725062 GGAGGAGAGGAGAGGTCAGATGG + Intergenic
1198250133 X:134871608-134871630 GCAAGTGAGCAGGGGTTGGAAGG + Intergenic
1199757039 X:150874454-150874476 GCCAGTGGGAAGAGTTCAGAGGG + Intronic