ID: 1006175984

View in Genome Browser
Species Human (GRCh38)
Location 6:32121860-32121882
Sequence GAGGAGCCACTAAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006175984 Original CRISPR GAGGAGCCACTAAAGGAGAA AGG (reversed) Intronic
904102154 1:28040578-28040600 GAAGGGCCATCAAAGGAGAAAGG + Intronic
905124568 1:35707885-35707907 GAGGAGACACAAAAGGGGGAGGG + Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905724070 1:40233568-40233590 GTGGAGCCACTAAAGCAACATGG + Intronic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
906308493 1:44736719-44736741 GAGGAGCCAGCAAAGGAGATGGG - Intergenic
907733194 1:57087400-57087422 AAGGAGTCACCAAGGGAGAAGGG + Intronic
907742440 1:57180171-57180193 GAGGACACAGAAAAGGAGAAGGG + Intronic
908020620 1:59894367-59894389 GAAGAACCACTGAAGGAGGAAGG - Intronic
910454580 1:87383721-87383743 GAGGAGACATTCAAGGTGAAGGG + Intergenic
912221102 1:107676467-107676489 AAGAAGCCAATAGAGGAGAAAGG + Intronic
912748460 1:112265792-112265814 GAGGAAGGACTAAAGAAGAAAGG - Intergenic
914831258 1:151172574-151172596 TATGAGCCACTAGAGGATAAAGG + Intronic
914850202 1:151308531-151308553 GAGGAGTCACTAAAAGAGACAGG - Intronic
914854475 1:151341231-151341253 GAAGAGTCCCTAGAGGAGAATGG + Exonic
915324888 1:155076593-155076615 AAGGAGCCACCCAAGGGGAAGGG + Intergenic
915625387 1:157111331-157111353 AAGGAGCCAGTGGAGGAGAAGGG - Intergenic
915734156 1:158074217-158074239 GAGGAGCCACTCATGGAGTATGG + Intronic
918289545 1:183093450-183093472 GAGGACCCAGAAAAGGAGACTGG - Intronic
918438742 1:184544515-184544537 GAGGAGCCACTAACACAGCAAGG - Intronic
919138707 1:193542988-193543010 GATGAGCCAAAAAAGGAGAAGGG - Intergenic
921019036 1:211219791-211219813 GAGGGGCCAACAGAGGAGAAAGG - Intergenic
921591702 1:217011779-217011801 GAGTAGCCACAAGAGGAGGAAGG - Intronic
921872153 1:220152655-220152677 CAGGAGCCACTACAGTAGAGTGG - Intronic
922085409 1:222342065-222342087 GAGGAGCCACATCAGGAGAAGGG + Intergenic
922348768 1:224718686-224718708 GAGGTGACACTTCAGGAGAAAGG + Intronic
924383502 1:243483511-243483533 GAGGAGGCACTGGAGGAGAGAGG - Intronic
1064574309 10:16728880-16728902 CAGGAGGCTCTAGAGGAGAATGG - Intronic
1065469610 10:26064169-26064191 GAGAAGCCACTAATTGACAAGGG + Intronic
1068748346 10:60561756-60561778 GAGAAGACACTGCAGGAGAAAGG - Intronic
1069250785 10:66263964-66263986 GAGGAGCTAACAAAGGAGATTGG - Intronic
1069567305 10:69472370-69472392 GAGGAGACACTAAATCAGAAAGG - Intronic
1070588858 10:77787383-77787405 GAGGAAACACTTGAGGAGAAAGG - Intergenic
1070727717 10:78803527-78803549 GAGCAGCGGCTAAAGGAGAAGGG - Intergenic
1073466774 10:103698858-103698880 GAGGAGGCCTTAAAGGACAAGGG + Intronic
1073662296 10:105489853-105489875 GAAGAGCCCCTGAAGGAGATAGG + Intergenic
1074338298 10:112600431-112600453 GAGGAGCAAGTAAAGAAGAGTGG - Intronic
1075564281 10:123492393-123492415 GGGGAGCAGCTAAGGGAGAAGGG + Intergenic
1076826560 10:132972464-132972486 GAGGGGCCTCTAAAGAAGCACGG - Intergenic
1077027922 11:449987-450009 GAAGCGCCCCAAAAGGAGAACGG + Intronic
1077867805 11:6237454-6237476 CGGGAGCCACTATATGAGAAAGG + Intronic
1079154530 11:17932598-17932620 AAGGAGCCATAGAAGGAGAAAGG + Intronic
1079927651 11:26514893-26514915 GAAGATTCACTAAAAGAGAATGG + Intronic
1080196098 11:29611035-29611057 TAAGAGGCACTATAGGAGAATGG + Intergenic
1080945121 11:36964139-36964161 AAGAAGACACAAAAGGAGAATGG + Intergenic
1081887125 11:46507532-46507554 GAGGATGCGCTAAAGGAGCAGGG - Intronic
1081890743 11:46540210-46540232 GAGGTACTACTAAAGCAGAATGG + Intronic
1084082840 11:66840244-66840266 GAGTAGCCACTGAGGGACAAAGG - Intronic
1086060519 11:82695458-82695480 GAGGAGACAGTATAAGAGAAGGG - Intergenic
1086380074 11:86243791-86243813 GAGGAGGCAGGAAGGGAGAAAGG - Intergenic
1087721381 11:101669682-101669704 GAGGAGCCAGCAAAGGAGTTAGG - Intronic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1091182635 11:133620574-133620596 CAGGTGACAGTAAAGGAGAAAGG + Intergenic
1091416646 12:293132-293154 GAGAAACCACTAAAAGTGAAAGG - Exonic
1092949876 12:13491754-13491776 GAGAAGAGACTAAAAGAGAAAGG + Intergenic
1096427334 12:51515262-51515284 GAGGAGTGAATATAGGAGAAAGG - Exonic
1096883072 12:54688317-54688339 GAGGGGCCAGCAAAGGAGACTGG + Intergenic
1097779782 12:63688321-63688343 GCAGAGCACCTAAAGGAGAATGG - Intergenic
1098287079 12:68918195-68918217 GAGGAGCCAAGAATGGAGATGGG - Intronic
1099953936 12:89334086-89334108 GAGGAGTCATTAAAGCAAAAGGG - Intergenic
1100262703 12:92948006-92948028 GAGGAGAAACTAATGGAGTAAGG + Intergenic
1101043873 12:100784662-100784684 GAGGATCCTCCAAAGGAAAAAGG + Intronic
1101211763 12:102542064-102542086 GAAGAGCCACTTATGGAGATGGG + Intergenic
1101566633 12:105911952-105911974 GAGAAACCTATAAAGGAGAAGGG - Intergenic
1101807674 12:108078738-108078760 GAGGAGGCACTAATGTATAATGG + Intergenic
1102650918 12:114441843-114441865 GAGGAGCCAATGAAGGAGGCAGG - Intergenic
1103985997 12:124767805-124767827 GAGGTGCCACTAACTGAGGAGGG - Intergenic
1105668374 13:22586174-22586196 GAGATGCCACTCAAGGAGACTGG + Intergenic
1106491589 13:30229165-30229187 GAGGAGCCATAGAAGGAAAAGGG - Intronic
1106970657 13:35137632-35137654 GAGAAGGTAATAAAGGAGAAGGG - Intronic
1107021751 13:35759399-35759421 GAAGACCAACTAAATGAGAAAGG - Intergenic
1108459417 13:50650295-50650317 GGAGAGCCACCAAAGGACAAGGG - Intronic
1109864296 13:68242629-68242651 GGGAAGCCACTGAAGGAGAATGG - Intergenic
1110766835 13:79289762-79289784 GAGGAGCCAGTGACTGAGAAAGG - Intergenic
1110904441 13:80867860-80867882 AAGGAGAAAATAAAGGAGAATGG + Intergenic
1112213395 13:97404053-97404075 CAGGAGCCACTGCAGGAGACAGG + Intergenic
1112544957 13:100358693-100358715 GAAGAGACACAAAAGGACAAAGG + Intronic
1113317428 13:109197105-109197127 GCGGAGCCGCTGAAGGAGAGGGG - Intronic
1114157881 14:20127795-20127817 GAGAAGCTATTAAAGGACAAGGG + Intergenic
1115275601 14:31605813-31605835 GAGGAGACGAGAAAGGAGAAGGG - Intronic
1115275608 14:31605849-31605871 GAGGAGACAAGGAAGGAGAAGGG - Intronic
1115829184 14:37315913-37315935 GAGGAGCCAGGAGAGGAGATTGG + Intronic
1116901604 14:50367103-50367125 GAGGAAACACGAAAGGGGAAAGG + Intronic
1118264588 14:64282709-64282731 GATGGACCACTAAAGGAGAAAGG + Exonic
1118972307 14:70647350-70647372 GATGAGCCAGGAAAGGAAAAGGG + Intronic
1122768611 14:104087019-104087041 GAGCAGCCACTTCAGCAGAAAGG - Intronic
1123192657 14:106586080-106586102 CAGGTGTCACTAATGGAGAAAGG - Intergenic
1124025331 15:25960248-25960270 AAGGAGCCACTAAAGGTAGATGG - Intergenic
1125710520 15:41781860-41781882 GAAGAGCCACTAAAGGAAGATGG - Intronic
1126390459 15:48144169-48144191 GAGGAGAAAAAAAAGGAGAAAGG + Intronic
1126867706 15:52954328-52954350 AATGAGCCATTAAAGGAGGAAGG - Intergenic
1126908154 15:53389566-53389588 GATGAGCCACTAAGCAAGAAAGG - Intergenic
1127171852 15:56311098-56311120 AAGGAGTCACCAAGGGAGAAGGG - Intronic
1127760591 15:62135811-62135833 GAGGAGGCAATGAAGAAGAAAGG - Intergenic
1128780920 15:70358155-70358177 CAGGAGACACTGAAGGAGACTGG + Intergenic
1128889366 15:71317202-71317224 GAGTAGCCATAAAAGGAAAAAGG + Intronic
1129118685 15:73381523-73381545 GAGGAGCCAGTAGAAGAGGATGG - Intergenic
1129147984 15:73666606-73666628 GAGGAGTAGCTAAAAGAGAATGG - Intergenic
1129787505 15:78319511-78319533 GAGGATCCACGAGAGGGGAAGGG + Intergenic
1131159919 15:90099008-90099030 GAGGAGCCAGTAGTGGGGAAAGG - Intronic
1131911391 15:97208348-97208370 GAGTTGCCACTAAAAGAAAAGGG - Intergenic
1134215136 16:12311435-12311457 CAGGAGCCAGGAAAGGAGGACGG - Intronic
1136494225 16:30632106-30632128 GGGGAGCCAAGATAGGAGAATGG - Intergenic
1138264411 16:55650271-55650293 GAAGAGCCAGGGAAGGAGAAAGG - Intergenic
1139174464 16:64670738-64670760 GAGGAGCTAGGAAAGAAGAAGGG - Intergenic
1140332436 16:74070863-74070885 GAGGAGCCACAAAAGTGGCAAGG + Intergenic
1140384370 16:74521561-74521583 GAGGAGCCACTAGTGGGGATGGG + Intronic
1140602657 16:76497463-76497485 GAGGAGGCAGCAAAGGAAAATGG + Intronic
1143188226 17:5023437-5023459 GAGGAGTGAGAAAAGGAGAAGGG - Intronic
1145934748 17:28708415-28708437 GAGGAGACAGCAAAGGAGACAGG - Intronic
1146486320 17:33245846-33245868 GAGGAAGCACTAATGGAGGAAGG + Intronic
1147333932 17:39715726-39715748 TAGGCGCCACTATGGGAGAAAGG - Exonic
1147791743 17:43018104-43018126 CACGAGGCACTGAAGGAGAATGG - Exonic
1148977695 17:51544202-51544224 GAGGAGCCATTAGAAGAAAATGG - Intergenic
1149339862 17:55674190-55674212 GAGGAGCCACAAAAGGGGTAGGG - Intergenic
1149651662 17:58279790-58279812 GAGGAGTCACTAGTGGAGCAGGG + Intronic
1151698693 17:75731232-75731254 GCGGATCCGCTAAAGGAGGAAGG - Exonic
1152047690 17:77948850-77948872 GAAGAGCCTCAAAAGGAAAAGGG - Intergenic
1153449765 18:5214041-5214063 GAGAAACCAATAAAGGAGACAGG + Intergenic
1153671899 18:7419576-7419598 AAGGAGGGACAAAAGGAGAAAGG + Intergenic
1154267335 18:12890689-12890711 GGAGAGACACTTAAGGAGAAAGG + Intronic
1158305169 18:56097369-56097391 AAAGAGCCACTGGAGGAGAATGG - Intergenic
1158594914 18:58807532-58807554 GAGGAGGCTCTGACGGAGAAGGG + Intergenic
1158627637 18:59085242-59085264 CAGGAGCCACACTAGGAGAATGG - Intergenic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1160931116 19:1569834-1569856 GAGAAGCCACCAAAAGTGAAGGG - Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1164259119 19:23553904-23553926 GAGGAGCCACAGAGGAAGAAGGG - Intronic
1164713589 19:30376124-30376146 ATGGAGCCACTAGAGGACAAGGG - Intronic
1165383173 19:35495232-35495254 GAGGAGCCCTGAAGGGAGAAAGG + Intronic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
928036415 2:27828324-27828346 GGGGAGGCAGGAAAGGAGAAAGG + Intronic
928488847 2:31759848-31759870 GAGGAGTGAATAAAGAAGAATGG - Intergenic
931487873 2:62711686-62711708 GAGGAGCCAACAAAGGAGACAGG + Intronic
931880325 2:66562275-66562297 GAGGATAAACTAAAGGACAAAGG + Intronic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932527621 2:72488255-72488277 GAGGAACCATGAAAGGAGATTGG - Intronic
932552563 2:72785982-72786004 GGGGAGCCAAGACAGGAGAATGG + Intronic
935040762 2:99424797-99424819 GTGGAGCCACTTCAGGAGCATGG - Intronic
935203653 2:100879820-100879842 TAGCAGCCACTCAAGGAGAGAGG + Intronic
935711782 2:105905559-105905581 GGGCAGCCGCTAAATGAGAAAGG - Intergenic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
937495196 2:122411840-122411862 GAGGAGGAAAGAAAGGAGAAGGG - Intergenic
937705811 2:124919587-124919609 GAGGAGCCATGAAAGTGGAAAGG - Intergenic
937911421 2:127077469-127077491 GAGGAGCCACACCAGGAGAGGGG + Intronic
938899496 2:135787828-135787850 GAGGGGCAACCATAGGAGAAAGG + Exonic
939860704 2:147416806-147416828 TAGGGAGCACTAAAGGAGAAGGG - Intergenic
940024497 2:149191907-149191929 GAGGAGCCAGCAAAGGAAAAAGG + Intronic
940910417 2:159205174-159205196 AAAGAGCCACAAAAGGGGAAAGG - Intronic
941219600 2:162759629-162759651 GAGGACCAAATGAAGGAGAAAGG + Intronic
941641676 2:167995717-167995739 GAGCAGAAATTAAAGGAGAATGG + Intronic
944253998 2:197605924-197605946 GAGGAATCAATAAAGGAGGAGGG - Intronic
945980367 2:216305270-216305292 GTGGAGCCAGGAAAGGAGATAGG + Intronic
946199937 2:218065519-218065541 GAGGAGCCACTGAATGAGGTGGG + Intronic
947767028 2:232644382-232644404 CAGGAGCCACTAAAGGAATGAGG - Intronic
948268131 2:236653613-236653635 GAGGAGCTGCTCAAAGAGAAGGG - Intergenic
1168985313 20:2043386-2043408 GAAGAGACACTGAAGGAGAAAGG + Intergenic
1177064771 21:16416540-16416562 GAAGAGACCCTAAAGGAAAAAGG - Intergenic
1177512592 21:22109275-22109297 GAGAAGTCACCAAAGGAGAGTGG + Intergenic
1179448631 21:41452311-41452333 TAGAAGCCCCTAAAAGAGAAAGG + Intronic
1182424666 22:30265817-30265839 AAGGAGCCACTTATGGAGAGAGG - Intronic
1182569112 22:31222901-31222923 GAGGAGCCAGTGAGGGAGAGGGG + Intronic
954775969 3:53018868-53018890 GAGGAGGCAGCAAAGGAGACAGG - Intronic
955081642 3:55663302-55663324 GAGCAGCCAGTAGAGGAGAAAGG + Intronic
955653384 3:61218502-61218524 GAGTGGCAACTAAAGGACAAAGG + Intronic
956047755 3:65214546-65214568 GATGAGGCACAGAAGGAGAAAGG + Intergenic
956334471 3:68147532-68147554 GTGGGGCCACTAGAGGAGACAGG - Intronic
959961711 3:112305215-112305237 AAGGAGCTCCTAAAGGAGCAAGG + Intergenic
960066666 3:113381463-113381485 GATGAGCCATTAAAGTAGGATGG - Intronic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
962007579 3:131363102-131363124 TAGGAGCCACTAGAGGTGTAGGG + Intergenic
962213009 3:133494849-133494871 GAGGTCCTACTAGAGGAGAATGG - Intergenic
962553494 3:136522314-136522336 AAGCAGACACTACAGGAGAACGG + Intronic
963225556 3:142858168-142858190 GAGGAGGCACCAAAGGGGAGAGG - Intronic
963511352 3:146251936-146251958 GAGACGCCAATAAAGGGGAAAGG + Intergenic
964874115 3:161346864-161346886 GAGGGGCCACGGAGGGAGAAGGG + Intronic
964981143 3:162682091-162682113 GACAAACCACTAAAAGAGAAAGG - Intergenic
966013519 3:175112152-175112174 GAGGAATCACCAATGGAGAATGG - Intronic
966163844 3:176994972-176994994 GAGAAGCTACTAATGGAAAATGG + Intergenic
968431213 4:560217-560239 GTGGAGCCACTAGCAGAGAAGGG + Intergenic
968719082 4:2186355-2186377 GAGGAGACACCAAATCAGAAAGG + Intronic
971030210 4:22628300-22628322 GAGGAGCTACCAAAGGAAGATGG - Intergenic
971201233 4:24511148-24511170 GAGGAGCCACCAAGGGCAAATGG + Intergenic
971390300 4:26179170-26179192 GAGGAGAGAGTAAAGGAAAAAGG - Intronic
971642680 4:29156117-29156139 GAGAAGACAATAAAGTAGAAGGG + Intergenic
972080918 4:35147938-35147960 GAGGAGCTAATAGAGGAGCAAGG + Intergenic
972169207 4:36324245-36324267 GAGGGGCCAGAGAAGGAGAAAGG - Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974441499 4:61924269-61924291 GAGGAACCAATGAAGGAGACTGG - Intronic
974513658 4:62878732-62878754 GAGGAGCCAAGAAATGACAAAGG - Intergenic
977247692 4:94652893-94652915 CAAGAGTCACAAAAGGAGAAAGG - Intronic
979546558 4:121946689-121946711 GAGTAGACAGAAAAGGAGAAGGG + Intronic
981478366 4:145210723-145210745 GAGGAGGCACTAAGAGATAAGGG + Intergenic
982338151 4:154263592-154263614 GAGAACCCACAAAAGGTGAAGGG + Intronic
982686718 4:158499271-158499293 TAAGAGCCAAGAAAGGAGAAAGG + Intronic
985217227 4:187666861-187666883 GAGGAGACGCTAAAGGAAGATGG - Intergenic
986059511 5:4174781-4174803 GAGGAGCCAGTAAGTTAGAAAGG + Intergenic
989194801 5:38706389-38706411 CAGGAGTCACTAAAAGAGAGGGG + Intergenic
989414384 5:41156402-41156424 GAGTTGCCACTAAAGGATCAGGG - Intronic
989444418 5:41510698-41510720 GCGGAGGCACTAAGGGAGCACGG - Intergenic
989685182 5:44077574-44077596 AAGCACCCACTAAAGGGGAAAGG - Intergenic
991266466 5:64725575-64725597 TCGGAGTCACTAAAGGAGGAAGG - Intronic
992371059 5:76144632-76144654 GAGGAGATACAAAAGGAGAAGGG + Intronic
992678218 5:79126990-79127012 GAGGAGCCACAGAGGAAGAAAGG + Intronic
993541330 5:89156299-89156321 GAGGAGTCAAGAAAAGAGAAGGG - Intergenic
994661772 5:102662439-102662461 GAGGAGCCACTCAAGGTGTTAGG - Intergenic
996152600 5:120058201-120058223 GAGGAGACCCTAAAGCAGCAGGG + Intergenic
996822487 5:127646062-127646084 GAGAAGGCACTAAGGGAGAGGGG + Intergenic
997362333 5:133303063-133303085 CAGGAGGCACAAAAGGACAAAGG - Intronic
997598925 5:135126302-135126324 GAGGAGCCACTAAGCGGGAAAGG - Intronic
997978223 5:138452887-138452909 CAGGAGCCACCAAAGGTGATGGG + Intergenic
999048901 5:148500382-148500404 GAAGAGCCTCTAAAAGAGACTGG + Intronic
999392336 5:151202655-151202677 GAGGAGACGCTAAAGGTGAGGGG - Intronic
999676143 5:154004864-154004886 GAGGAGCCATTGAAGGAAAGAGG - Intronic
1000805831 5:165790522-165790544 GAGGACACACAAAAGTAGAAGGG - Intergenic
1000848330 5:166309278-166309300 GAGGCTCCACTATAGGAGAGAGG + Intergenic
1000863527 5:166485273-166485295 GTGGAGACAGTAAAGGAGAGTGG + Intergenic
1001406302 5:171479911-171479933 GGGGAGGCAGTACAGGAGAATGG - Intergenic
1005891351 6:30141453-30141475 GAGGACCCAGCAAAGGAGACAGG + Intronic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1007116926 6:39349440-39349462 GAGGAGGAAGAAAAGGAGAAGGG + Intronic
1008519296 6:52347751-52347773 GAGGAGGCAGTGAAGGAGAATGG + Intergenic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1012275735 6:97273371-97273393 GAGGAGCCAATAAAAGAGGTAGG - Intronic
1012408030 6:98923244-98923266 GAGAAGCTAGTAAAGGAGTAGGG - Intronic
1015239151 6:131004689-131004711 GAGGTGCCTGTAAAGGAGATGGG + Intronic
1015395492 6:132729494-132729516 GTGGATCCACTAAGGCAGAAAGG - Intronic
1015587912 6:134795093-134795115 GAAGAGACACTACAGAAGAAAGG - Intergenic
1017709967 6:157158655-157158677 GAGGAGCCACAGAAGCAGAGTGG - Intronic
1018315533 6:162553155-162553177 GAGAAGACAATAAAGGAGAGAGG + Intronic
1021637965 7:22709835-22709857 AAGGAGACAGTAAAGCAGAAGGG + Intergenic
1021688680 7:23211771-23211793 GAGCAGCCTCCAGAGGAGAATGG - Intergenic
1022273710 7:28835638-28835660 GAGGACCCACAGAAGGACAAAGG + Intergenic
1022938373 7:35204411-35204433 GCAGAGCACCTAAAGGAGAATGG - Intronic
1023688746 7:42764203-42764225 ATGGAGCCAGTAAAGGAGCATGG + Intergenic
1026205742 7:68255669-68255691 GAGGAGAAAGAAAAGGAGAAAGG - Intergenic
1027434356 7:78148888-78148910 GAGGAGCCACTAATGGATTATGG + Intronic
1028176388 7:87664625-87664647 GATGAGCCTCTAAAGCAGAATGG + Intronic
1028747855 7:94347817-94347839 GTGCAACCATTAAAGGAGAAAGG + Intergenic
1029807080 7:103009410-103009432 GGGGAACCACTACATGAGAAAGG + Intronic
1029917706 7:104229432-104229454 GTGAAGTCACTCAAGGAGAATGG + Intergenic
1030078007 7:105753168-105753190 GAGAAGCCACTGGAGGAGATAGG + Intronic
1030890829 7:114996928-114996950 GAGTAGCTAGTAATGGAGAAGGG + Intronic
1032663964 7:134016368-134016390 GAGGAGCCCCTGAAGAAGATAGG + Intronic
1032783761 7:135184814-135184836 GAGGAGCCACCAAATGAAAAAGG + Exonic
1033221886 7:139532408-139532430 GAGGAGCCAACATAGGAGAGAGG + Intronic
1036657801 8:10689014-10689036 GAGGAGCCAGGGAAGGAGACTGG - Intronic
1036658621 8:10693303-10693325 GAGGAGGCAGTAAAGGAGCTGGG - Intronic
1037691766 8:21186656-21186678 AAGGAGCCCCTAAGGGAGGAAGG + Intergenic
1039296401 8:36160363-36160385 GAGGAGCCAGCAAAGGAGACGGG + Intergenic
1041288299 8:56283195-56283217 GAGGAGCCACTATTCCAGAAAGG + Intergenic
1041400459 8:57437750-57437772 GAGGAACCAACAAAAGAGAAAGG - Intergenic
1041643596 8:60229122-60229144 GAGATGCCAGGAAAGGAGAACGG - Intronic
1044817108 8:96124584-96124606 GAAGAGGGAGTAAAGGAGAAGGG - Intergenic
1045181100 8:99783546-99783568 GAGGCACCATTAAATGAGAAAGG + Intronic
1045440411 8:102203102-102203124 GGGGAGCCACTGAAGGAGATAGG + Intergenic
1047011022 8:120672897-120672919 TAGGAGGCACTGAAGGAGACTGG + Intronic
1047459754 8:125051537-125051559 GTGGAGCAACTGAAGGTGAAAGG + Intronic
1048413414 8:134199461-134199483 GAGGAGCCCCAGAAGGAGATGGG + Intergenic
1049050330 8:140189660-140189682 GGGAAGACTCTAAAGGAGAAGGG - Intronic
1049111997 8:140652197-140652219 GAGGGACAACTAAAGGACAAAGG + Intergenic
1049269499 8:141686746-141686768 GAGGACCCCCGGAAGGAGAAGGG - Intergenic
1049539681 8:143202562-143202584 GAGGAGCCAGCAACTGAGAAAGG + Intergenic
1049653857 8:143789261-143789283 GAGGAGCCAGGAAAGGAGGAGGG + Intergenic
1050010351 9:1179526-1179548 GAGGACCCAGGAAAGCAGAAAGG + Intergenic
1050640329 9:7660689-7660711 GAGGATCTAATAAAGGAGATGGG + Intergenic
1051027427 9:12630136-12630158 GAGGAGACAGGAAAGGAGTAAGG + Intergenic
1051672129 9:19521489-19521511 TAGGAGATGCTAAAGGAGAATGG - Intronic
1055566300 9:77572021-77572043 GAGGAGCAACTGAAAGAGAGTGG + Intronic
1058750413 9:108033780-108033802 GAGCAGGGACTAATGGAGAAGGG - Intergenic
1058766759 9:108189455-108189477 GGGGAGCCAAGATAGGAGAAGGG + Intergenic
1060038777 9:120281844-120281866 GAGGAGGCCCTAAGAGAGAATGG + Intergenic
1060164231 9:121395870-121395892 GAGATGCCACTGAAGGGGAATGG - Intergenic
1060500684 9:124151659-124151681 GAGGAGTAAGAAAAGGAGAAAGG - Intergenic
1062297473 9:135840402-135840424 GAGGAGCCCCGCAAGAAGAAGGG + Intronic
1187364191 X:18652915-18652937 AAGTAGCCACTAAAGTAAAAAGG - Intronic
1187500202 X:19833106-19833128 GAGGAGCCTGGGAAGGAGAAGGG - Intronic
1189161770 X:38816607-38816629 GAGGAGCCACTAATCAACAAAGG - Intergenic
1189799889 X:44682372-44682394 GAGAAACCAATAAAGGATAAAGG - Intergenic
1193187753 X:78533202-78533224 GGGGAGCTATTGAAGGAGAAAGG - Intergenic
1195349997 X:103986634-103986656 GAGGATCCACTAAATGGGAGAGG - Intergenic
1195357446 X:104052205-104052227 GAGGATCCACTAAATGGGAGAGG + Intergenic
1196366866 X:114933318-114933340 GAGGAGTGAATATAGGAGAAAGG + Intergenic
1196598460 X:117572171-117572193 GAGAAGCTACTATTGGAGAAAGG - Intergenic
1196756461 X:119161561-119161583 GAGGAGCCAGGATAGGAGGAAGG - Intergenic
1198487653 X:137104555-137104577 GAGGAGCCACTAGAGGATTGTGG - Intergenic
1198531006 X:137549627-137549649 GAGGGGCCACTAAATGACATGGG - Intergenic
1198762823 X:140051375-140051397 GTGGAGCCACAAAAGGAGTCGGG + Intergenic
1198839816 X:140844355-140844377 GAGGAGGCACTCCAGGAGGAGGG + Intergenic
1202092960 Y:21213259-21213281 GAGGAGAAAGTAAAAGAGAAGGG - Intergenic