ID: 1006180361

View in Genome Browser
Species Human (GRCh38)
Location 6:32150459-32150481
Sequence CCCACGCACGCGGGGACTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006180361_1006180370 -1 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180370 6:32150481-32150503 GCACCACGAAGCCAGGGGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 243
1006180361_1006180384 29 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180384 6:32150511-32150533 GGGCTGGCGCCGGCGGGGGCGGG 0: 1
1: 0
2: 8
3: 164
4: 1184
1006180361_1006180383 28 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180383 6:32150510-32150532 TGGGCTGGCGCCGGCGGGGGCGG 0: 1
1: 0
2: 3
3: 75
4: 747
1006180361_1006180376 13 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180376 6:32150495-32150517 GGGGCCTGGGCAGTCTGGGCTGG 0: 1
1: 0
2: 5
3: 92
4: 743
1006180361_1006180371 0 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180371 6:32150482-32150504 CACCACGAAGCCAGGGGCCTGGG 0: 1
1: 0
2: 1
3: 21
4: 230
1006180361_1006180368 -7 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180368 6:32150475-32150497 GCGTGGGCACCACGAAGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 104
1006180361_1006180367 -8 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180367 6:32150474-32150496 TGCGTGGGCACCACGAAGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 222
1006180361_1006180380 23 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180380 6:32150505-32150527 CAGTCTGGGCTGGCGCCGGCGGG 0: 1
1: 0
2: 1
3: 19
4: 216
1006180361_1006180381 24 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180381 6:32150506-32150528 AGTCTGGGCTGGCGCCGGCGGGG 0: 1
1: 0
2: 1
3: 19
4: 150
1006180361_1006180382 25 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180382 6:32150507-32150529 GTCTGGGCTGGCGCCGGCGGGGG 0: 1
1: 0
2: 4
3: 23
4: 338
1006180361_1006180373 8 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180373 6:32150490-32150512 AGCCAGGGGCCTGGGCAGTCTGG 0: 1
1: 0
2: 3
3: 50
4: 485
1006180361_1006180378 19 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180378 6:32150501-32150523 TGGGCAGTCTGGGCTGGCGCCGG 0: 1
1: 0
2: 3
3: 23
4: 326
1006180361_1006180369 -6 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180369 6:32150476-32150498 CGTGGGCACCACGAAGCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1006180361_1006180379 22 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180379 6:32150504-32150526 GCAGTCTGGGCTGGCGCCGGCGG 0: 1
1: 0
2: 3
3: 31
4: 308
1006180361_1006180385 30 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180385 6:32150512-32150534 GGCTGGCGCCGGCGGGGGCGGGG 0: 1
1: 0
2: 13
3: 136
4: 1106
1006180361_1006180374 9 Left 1006180361 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1006180374 6:32150491-32150513 GCCAGGGGCCTGGGCAGTCTGGG 0: 1
1: 0
2: 2
3: 54
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006180361 Original CRISPR CCCACGCACGCGGGGACTGT GGG (reversed) Exonic
900158477 1:1212735-1212757 CCCCAGCACCCGGGGCCTGTGGG - Intronic
902897038 1:19485875-19485897 TCCCCGCCCGCGGGGACTGTGGG - Intergenic
904235727 1:29115835-29115857 CCCTCTCAGGCTGGGACTGTGGG - Intronic
922775413 1:228212241-228212263 CACGCGCACGCGGGGGCCGTCGG - Exonic
1067147332 10:43703064-43703086 CCCACGCACGCCCGGACTCCTGG + Intergenic
1076417282 10:130300861-130300883 CCCCGGCAGGCGGGCACTGTAGG - Intergenic
1076563621 10:131383298-131383320 CCCAGGCACGTGGGGATGGTTGG - Intergenic
1078180131 11:9004234-9004256 CCCACGCAGGAGGGGGCGGTTGG - Intergenic
1078748566 11:14138618-14138640 CCAAGGCAGGCGGGGGCTGTAGG + Intronic
1094847262 12:34366755-34366777 CCCAGGCCCCAGGGGACTGTGGG - Intergenic
1098595943 12:72273077-72273099 ACCACGCAGGCGGGGACTCCTGG + Exonic
1102046393 12:109832746-109832768 TCCAGGCAAGCGGGGAGTGTGGG + Intronic
1119668281 14:76499762-76499784 CCCAGGCACACGGGGACAGTGGG + Intronic
1124009054 15:25821139-25821161 TCCAAGCACGCTGGGATTGTAGG - Intronic
1125759344 15:42086204-42086226 CCCACCCACCTGGGGACTCTGGG + Exonic
1126867938 15:52956686-52956708 CCCACACACATGGGGAATGTAGG + Intergenic
1127961634 15:63894831-63894853 CCCAGGCAAGCTGGGACAGTTGG + Intergenic
1139446471 16:67001319-67001341 GCCACGCGCGCGGGAACTGGGGG + Exonic
1142088521 16:88197688-88197710 CCCACGGACGCTGTGACTGCAGG - Intergenic
1152716195 17:81901982-81902004 CCCACGCAAGCCGGGCCTGAAGG + Intronic
1153493001 18:5669326-5669348 TACACGCACTCGGGGACTCTGGG - Intergenic
1159946287 18:74446929-74446951 CCCACGCTGGCGGGGACAGCTGG - Exonic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160708194 19:539603-539625 CCCTCCCATGCGGGCACTGTGGG + Intronic
1164835162 19:31351023-31351045 CCCGCCCTCGCCGGGACTGTCGG - Intergenic
1167071766 19:47226269-47226291 CCCGCGGCCGCGGGGACTGAGGG - Intronic
1168098545 19:54128876-54128898 CCCACACACGCGGGGGATGCTGG - Intronic
948563462 2:238868720-238868742 CCCACACACTCGGGCATTGTTGG + Intronic
948884415 2:240875646-240875668 CGCAGGCACGCTGGGACTGAGGG + Intronic
1170815248 20:19708503-19708525 CCCACGCCCCCAGGGACAGTAGG + Intronic
1173157461 20:40626420-40626442 CCCACACACGTGGGAATTGTAGG + Intergenic
1173662946 20:44746395-44746417 CCCACGCAGGCAGGGACGGGAGG + Intronic
1174162213 20:48559463-48559485 TCCATGCAGGTGGGGACTGTTGG - Intergenic
1175869463 20:62201396-62201418 GCCATGCACGCGTGGACTCTCGG + Exonic
1179110979 21:38444963-38444985 CCCAGGCACGAGGGCTCTGTGGG - Intronic
1179471711 21:41614733-41614755 CCCACACACGCAGGGCCTGAGGG - Intergenic
1181472602 22:23150132-23150154 CGCAGGAACACGGGGACTGTCGG + Exonic
1183819033 22:40329676-40329698 CACACGCATGCGGGCAGTGTGGG - Exonic
1184247827 22:43244663-43244685 CCAGCACACGGGGGGACTGTGGG + Intronic
1184492212 22:44816207-44816229 CCCACTCACACGGTGTCTGTGGG - Intronic
950796113 3:15511889-15511911 CCCCCGTATGAGGGGACTGTCGG - Intronic
973606092 4:52589007-52589029 ACCACACACTGGGGGACTGTGGG + Intergenic
974253109 4:59414675-59414697 CCCACACACGTGGGGATTATGGG - Intergenic
979188633 4:117831537-117831559 CACACGCACGCTGGGGCTTTGGG - Intergenic
985786745 5:1899499-1899521 CCCACCCAGGCCGGGTCTGTTGG - Intergenic
986077477 5:4352856-4352878 CCCACACACATGGGGATTGTAGG + Intergenic
988557794 5:32253071-32253093 CCCACCCACGAGGGGACATTTGG + Intronic
995354687 5:111224321-111224343 CCCGCGCTCGCAGGGACGGTGGG - Exonic
1003157948 6:3612103-3612125 CACACGCACGTGGGTGCTGTGGG - Intergenic
1006180361 6:32150459-32150481 CCCACGCACGCGGGGACTGTGGG - Exonic
1018767255 6:166944419-166944441 CCCACACAGGCAGGGGCTGTGGG - Intronic
1020241058 7:6395466-6395488 AACACGCACCTGGGGACTGTGGG + Intronic
1035258234 7:157645759-157645781 CCCACCCACACCGGGACTCTGGG - Intronic
1044962286 8:97542816-97542838 CCCAAGCCAGCAGGGACTGTGGG - Intergenic
1049266145 8:141668839-141668861 CCCACGAACCCCGGGACTGTCGG + Intergenic
1049807749 8:144548546-144548568 CCCACCCCCTCGGGGGCTGTAGG + Intronic
1061007129 9:127934713-127934735 CCCAGGCACGGTGGGACTGCTGG + Intergenic
1185778814 X:2828862-2828884 CCCGCGCCCGCGGGGGCTGGCGG + Exonic
1200287198 X:154834706-154834728 CCCAGGCAAGCTGGGACTTTTGG - Intergenic
1201188830 Y:11429739-11429761 CCCACCCCCGCCGGGCCTGTCGG - Intergenic