ID: 1006181002

View in Genome Browser
Species Human (GRCh38)
Location 6:32153513-32153535
Sequence TATAGGGAGGGGAGTAGAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 307}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006180985_1006181002 13 Left 1006180985 6:32153477-32153499 CCCTACGCGCCCTCCGCCCCTTG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG 0: 1
1: 0
2: 2
3: 36
4: 307
1006180996_1006181002 -5 Left 1006180996 6:32153495-32153517 CCTTGAGGGTGGGTCGCTTATAG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG 0: 1
1: 0
2: 2
3: 36
4: 307
1006180995_1006181002 -4 Left 1006180995 6:32153494-32153516 CCCTTGAGGGTGGGTCGCTTATA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG 0: 1
1: 0
2: 2
3: 36
4: 307
1006180993_1006181002 0 Left 1006180993 6:32153490-32153512 CCGCCCCTTGAGGGTGGGTCGCT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG 0: 1
1: 0
2: 2
3: 36
4: 307
1006180991_1006181002 4 Left 1006180991 6:32153486-32153508 CCCTCCGCCCCTTGAGGGTGGGT 0: 1
1: 1
2: 1
3: 7
4: 99
Right 1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG 0: 1
1: 0
2: 2
3: 36
4: 307
1006180986_1006181002 12 Left 1006180986 6:32153478-32153500 CCTACGCGCCCTCCGCCCCTTGA 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG 0: 1
1: 0
2: 2
3: 36
4: 307
1006180994_1006181002 -3 Left 1006180994 6:32153493-32153515 CCCCTTGAGGGTGGGTCGCTTAT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG 0: 1
1: 0
2: 2
3: 36
4: 307
1006180992_1006181002 3 Left 1006180992 6:32153487-32153509 CCTCCGCCCCTTGAGGGTGGGTC 0: 1
1: 0
2: 1
3: 17
4: 228
Right 1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG 0: 1
1: 0
2: 2
3: 36
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006181002 Original CRISPR TATAGGGAGGGGAGTAGAGT AGG Exonic
901033349 1:6321429-6321451 GAAAGGGAGTGGAGTGGAGTGGG - Intronic
901044102 1:6385379-6385401 TTTGGGGAGGGTAGTAGGGTCGG - Intronic
901121436 1:6897375-6897397 TGTGGGGCGGGGAGTAGTGTTGG + Intronic
901146867 1:7070706-7070728 TATAGGGAGGGGACCAGAGAGGG + Intronic
903462521 1:23529778-23529800 TTTAGGGTGGGGGGTGGAGTGGG - Intronic
904814769 1:33187562-33187584 TCTAGAAAGGGTAGTAGAGTCGG - Intergenic
906518122 1:46451567-46451589 TAAAGAGAGGGGAGGAGAGGGGG + Intergenic
906949670 1:50323999-50324021 TATTGGGAGTGGAATAGAGTGGG - Intergenic
907455217 1:54571358-54571380 TATGGGGATGGGAGTGGAATTGG + Intronic
907486914 1:54784389-54784411 TGGAGGGAGGAGAGTAAAGTTGG + Intronic
907518405 1:55007720-55007742 GACAGGGATGGGAGTGGAGTGGG - Intronic
908963980 1:69735801-69735823 GATAGGGAGGGGAAGGGAGTGGG - Intronic
909393866 1:75147830-75147852 TAAAGGGAGAAGAGTAGTGTGGG - Intronic
909684479 1:78331823-78331845 AAGAGAAAGGGGAGTAGAGTTGG - Intronic
910594351 1:88962899-88962921 GAGAGGCAGGGCAGTAGAGTGGG + Intronic
912297590 1:108485359-108485381 TATGGGGAGGTGTGTAGAGGTGG - Intergenic
912517029 1:110222940-110222962 TATGGGCAGGGGAGGAGAGCAGG - Intronic
915590247 1:156866543-156866565 TGTAGGGAGGGGAGCACAGATGG + Intronic
915954279 1:160209751-160209773 GATGGGGAGGGGACTAGAGATGG - Intronic
917452864 1:175161750-175161772 TATAAGGAGGGGAGGAGACATGG - Intronic
920329019 1:205191491-205191513 TAAATGGAGGGGGGTGGAGTTGG + Intronic
920452235 1:206068285-206068307 TAAAGTGAGGAGAGTTGAGTTGG + Intronic
921329377 1:214020212-214020234 AATAGTGAGGGGGGCAGAGTGGG - Intronic
922256677 1:223898500-223898522 CATTGGGTGGGGGGTAGAGTGGG + Intergenic
922907592 1:229186250-229186272 TTTAGAGAGGAGAGTAGAGTTGG + Intergenic
922997275 1:229974135-229974157 TATCGGGAGAGGAGTAGTGGTGG + Intergenic
923143011 1:231177212-231177234 TAGAGAGATGGGAGTTGAGTTGG + Intronic
923808102 1:237282670-237282692 TATAGGGATGGCATTTGAGTGGG + Intronic
924274046 1:242367103-242367125 TATAAGATGGGGAGTAGAGTAGG - Intronic
1062866848 10:863120-863142 TAAAGGGAGGGGGATAGAGAGGG - Intronic
1063574919 10:7252950-7252972 ACTAGGGAGGGGAGAAGAGCTGG + Intronic
1064909961 10:20390057-20390079 TGTAGGGATGGGAGGAGACTGGG - Intergenic
1066021191 10:31304166-31304188 GATGGGGAGGGGAGGAGAGTGGG + Intergenic
1066059739 10:31711951-31711973 TGAAGGTAGGGGAGTGGAGTAGG + Intergenic
1067831546 10:49613781-49613803 TATGGGGTGGGGAGCAGAGGTGG - Intronic
1068804595 10:61180966-61180988 TTGAGGGGTGGGAGTAGAGTGGG + Intergenic
1068936115 10:62637251-62637273 TCTAAGGAGGGGAGAGGAGTTGG - Intronic
1069354900 10:67573736-67573758 TAGAGGGAGGGAAGGAGAGAGGG - Intronic
1069814827 10:71187100-71187122 GAGAGGGAGAGGAGAAGAGTGGG - Intergenic
1070660680 10:78303356-78303378 GAAGGGGAGGGGAGAAGAGTGGG - Intergenic
1070975137 10:80600391-80600413 TCTGGGCAGGGGAGTAGGGTGGG + Intronic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1072330945 10:94351243-94351265 TAAAGGTAGTGGAGTATAGTGGG - Intronic
1073447577 10:103590572-103590594 CAGAGGGAGGGGAGGAGAGGAGG + Exonic
1074014116 10:109516023-109516045 TATGGTGAGAGTAGTAGAGTTGG + Intergenic
1074202126 10:111246899-111246921 GAGAGGGAGGGGAGAAGAGGAGG - Intergenic
1074407879 10:113195420-113195442 TCTAGGGAGGGGAATAGAATTGG - Intergenic
1075443550 10:122498276-122498298 TCTAGGGAGGGGAGTAGAGAAGG - Intronic
1080396086 11:31891237-31891259 TATAGGGAGGAGAGAAGAACTGG - Intronic
1081940471 11:46936957-46936979 TATGGGGAGGGGCGGAGAGGCGG + Intronic
1082028147 11:47587401-47587423 TATAGGGAGGGGAGGAGGGTGGG + Intronic
1082649816 11:55776006-55776028 TATAGGGAAGGGAAAAGAGTAGG + Intergenic
1082718215 11:56641078-56641100 TATAGTGAGGGGAGCAGGATTGG - Intergenic
1083258505 11:61510591-61510613 TATGGGGTGGGGAGTGGAGGGGG - Exonic
1083541807 11:63516450-63516472 TTTAATGAGGGGAGGAGAGTGGG - Exonic
1083685000 11:64370469-64370491 GATGGGTAGGGGAGGAGAGTGGG + Intronic
1084062783 11:66686951-66686973 TCTCGGGATGGGAGGAGAGTTGG - Intronic
1085592602 11:77778128-77778150 GATGGGGAGGGGAGTGGAGGGGG + Intronic
1087195840 11:95303495-95303517 TATAGGGAGAGGTGAAGAGGAGG + Intergenic
1088550373 11:111006536-111006558 TATAGGGAGATGGGTAGAGGCGG - Intergenic
1089645051 11:119873534-119873556 TATATGGAGAGAAGAAGAGTTGG + Intergenic
1090289837 11:125533164-125533186 GAAAGGGAGGGGAGTATACTAGG + Intergenic
1090520659 11:127475537-127475559 TACAGGGAGGGGGGAAGAGCGGG - Intergenic
1091873398 12:3913776-3913798 GAAAGGGAGGGGAGAAGAGTAGG - Intergenic
1092653665 12:10662014-10662036 GCTAGGGAAGGGAGCAGAGTAGG - Intronic
1093250967 12:16804589-16804611 TATAGAGAGGGGAGATGAATTGG - Intergenic
1094388995 12:29928238-29928260 TATTGGGAGGGGAGAGGAGAAGG + Intergenic
1095729712 12:45493298-45493320 TATTTGCAGGGGAGAAGAGTGGG + Intergenic
1096762138 12:53850674-53850696 TATAGGGAGGGGATGTGTGTGGG + Intergenic
1096918565 12:55059666-55059688 GGTAGGGAGGAGAGTAGAGCGGG - Intergenic
1098068661 12:66648066-66648088 TGGAGGGAGGGGGGAAGAGTGGG - Intronic
1098933731 12:76452531-76452553 TAGTGGGAGGGGAGTAGTGATGG - Intronic
1098997543 12:77138232-77138254 TGTAGAGTGGGGAGGAGAGTGGG + Intergenic
1099828510 12:87810542-87810564 TATAGGGAAAGGAGAAGAGATGG - Intergenic
1100128167 12:91456191-91456213 GAAAGGGAGGGGAGTGGAGAGGG - Intergenic
1100781082 12:98027285-98027307 TATAGGGGTGGCAGTAGAGATGG - Intergenic
1101089157 12:101266970-101266992 TACAGGGAGGGGTGGAGAATTGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102828821 12:115975702-115975724 TAAAGGGAGGGGAGTAAAGCTGG + Exonic
1103698373 12:122835115-122835137 TTTAGGGAGGGGATTAGAGGTGG + Intronic
1103951600 12:124554462-124554484 TGGAGAGAGGGGAGTTGAGTGGG - Intronic
1104647173 12:130505654-130505676 TAGTGGGAGGGGAGTGGAGGGGG - Intronic
1105624408 13:22099105-22099127 GGAAGGGAGGAGAGTAGAGTGGG + Intergenic
1106194247 13:27479865-27479887 AACAGGCAGGGGAGTAGGGTGGG - Intergenic
1110552739 13:76826881-76826903 TAAAGGCAGGAGAGTACAGTGGG + Intergenic
1111792063 13:92870345-92870367 TATTTGGAAGAGAGTAGAGTAGG + Intronic
1112105565 13:96235859-96235881 TATATGGAGGGGAGTTCATTAGG + Intronic
1112506100 13:99976618-99976640 TATTGGAAGGGGTGTGGAGTGGG - Intergenic
1112920535 13:104606069-104606091 GATGGGGAAGGGAATAGAGTGGG + Intergenic
1114238891 14:20847733-20847755 TTTAAAGAGGGGTGTAGAGTCGG + Intergenic
1115212720 14:30983999-30984021 TCTAGGAAGGGAAGGAGAGTGGG + Intronic
1120895411 14:89527040-89527062 GATAGGGAGGGGAGGAGAGGAGG + Intronic
1121032076 14:90666796-90666818 CACAGTGAGAGGAGTAGAGTGGG + Intronic
1121432121 14:93895092-93895114 GAGGGGGAGGGGAGGAGAGTGGG - Intergenic
1121518006 14:94566528-94566550 TGCAGGGAGGCGAGTAGATTTGG - Intronic
1121724908 14:96140169-96140191 TAGAGGGAGGTGAGTTGAATAGG - Intergenic
1121891251 14:97593262-97593284 TATGGGGAGGGTTGTAGACTTGG + Intergenic
1122102524 14:99424677-99424699 CAGAGGGAGGGGAGGAGAGGAGG + Intronic
1122516928 14:102315366-102315388 TATAGGGAACGGAGAAGATTAGG - Intergenic
1122651692 14:103230072-103230094 TATGGGGAGGGGAGGAGGGGGGG + Intergenic
1125530245 15:40408470-40408492 GATAGCGGGGGGAGTAGGGTAGG + Intronic
1127272306 15:57412810-57412832 CAGAAGGAGGGGAGTAGAGCTGG - Intronic
1128178673 15:65580811-65580833 TACAGGGGGTGGGGTAGAGTGGG - Intronic
1128714419 15:69896962-69896984 TTTAGGGTGGGGAGTGGAGGAGG - Intergenic
1130533325 15:84764501-84764523 TAGAGGGAGGGGAGCAGACGTGG + Intronic
1131208230 15:90470189-90470211 TACAGAGTGGTGAGTAGAGTGGG - Intronic
1131802907 15:96090147-96090169 TATGGGGAGGGAAATAGGGTTGG - Intergenic
1134138309 16:11695364-11695386 TAGAGTGAGTGGAATAGAGTTGG - Intronic
1138539574 16:57680039-57680061 TATAGGGAAGGGAGGGGAGGAGG - Intronic
1139380638 16:66528441-66528463 TAAAGGGAAGGGTGGAGAGTTGG - Intronic
1139693463 16:68656309-68656331 AATCGGGAGGGGAGTTGAGAAGG - Intronic
1140324818 16:73991379-73991401 TATGGGAAGGGGAGCAGGGTGGG + Intergenic
1141051041 16:80763938-80763960 AATAGGGAAGGGGGTAGAGAGGG + Intronic
1141173924 16:81707103-81707125 AAGAAGGAGGGGAGGAGAGTGGG - Intronic
1141431922 16:83974758-83974780 TATAGATAGGGGAGTGGTGTGGG + Intronic
1142313015 16:89324893-89324915 TATATGGAGGGGAGTTTATTGGG - Intronic
1143289819 17:5820285-5820307 GATAGAGAGGGGAGCAGGGTGGG - Intronic
1143901609 17:10178672-10178694 GGGAGGGAGGGGAGTTGAGTTGG - Intronic
1144302383 17:13933929-13933951 TGTTGGGAGGGGAGTTGGGTGGG + Intergenic
1144307389 17:13981423-13981445 CATGGGGTGGGGAGTGGAGTGGG + Intergenic
1144328514 17:14204460-14204482 AATAAGGAGGGGAGGAGAGAGGG - Intronic
1145404099 17:22570714-22570736 TAGATGGAGGGGAGTAAAGAGGG + Intergenic
1145722799 17:27089045-27089067 TAGATGGAGGGGAGTAAAGAGGG - Intergenic
1146000938 17:29129946-29129968 AAGAGGGAGGGGAGGAGTGTAGG - Intronic
1147888226 17:43698710-43698732 GATAGGGAGGGGACAAGAGAGGG + Intergenic
1148049206 17:44760863-44760885 TTAAGGGAGGGGAGCAGAGGGGG + Intronic
1148588962 17:48801208-48801230 AATGGGGAGGGGAGTGGAGAAGG + Intronic
1149095727 17:52838195-52838217 TATATGAAGGGGAGTATATTAGG + Intergenic
1149512360 17:57254521-57254543 TATAATGAGGGGATTAGATTAGG + Intergenic
1149691250 17:58578644-58578666 TATGTGGAGGTGAGTTGAGTGGG - Intronic
1150351727 17:64450412-64450434 GATAGGAAGGGGAGAAGAATTGG - Intronic
1151069572 17:71193254-71193276 TATTGGGAAGGCAGTAGAGATGG - Intergenic
1152458389 17:80428815-80428837 AAGAGGGAGGAGAGTGGAGTGGG + Intronic
1152622679 17:81373055-81373077 AATGGGGAGGGGAGGAGAGATGG - Intergenic
1152703585 17:81831887-81831909 GATAGGGAGGGGAGTCGCATTGG + Intronic
1152869904 17:82747789-82747811 TATAAGAAGAGGAATAGAGTAGG - Intronic
1203214071 17_KI270730v1_random:106335-106357 TGAACGGAGGGGAGTGGAGTGGG + Intergenic
1153625554 18:7019331-7019353 AAGAGGGAGGGCAGGAGAGTGGG - Intronic
1156509946 18:37627905-37627927 CACAGAGTGGGGAGTAGAGTGGG + Intergenic
1156907345 18:42369773-42369795 TATAGGGAGGGAAGAAGAAGGGG + Intergenic
1158603856 18:58877756-58877778 TGTTGGAAGGGGAGTGGAGTGGG + Intronic
1159726541 18:71967670-71967692 TATAGGATGGGGAGTGGGGTGGG - Intergenic
1159745475 18:72229240-72229262 AACAAGGAGGGAAGTAGAGTAGG - Intergenic
1160561489 18:79760669-79760691 TATAAGGAGGGGAGGAGACAGGG - Intergenic
1161635879 19:5388663-5388685 GATGGGGAGGGGAGGGGAGTCGG + Intergenic
1162777800 19:12990311-12990333 TGTAGGGAGGGGAGGGGAGCTGG - Intergenic
1164491604 19:28720324-28720346 GATATGGAGGGGTCTAGAGTGGG - Intergenic
1164491611 19:28720347-28720369 GATATGGAGGGGTCTAGAGTGGG - Intergenic
1164491624 19:28720394-28720416 GATATGGAGGGGTCTAGAGTGGG - Intergenic
1164491631 19:28720417-28720439 GATATGGAGGGGTCTAGAGTGGG - Intergenic
1164491660 19:28720533-28720555 GATATGGAGGGGTCTAGAGTGGG - Intergenic
1164491692 19:28720673-28720695 GATATGGAGGGGTCTAGAGTGGG - Intergenic
1165395789 19:35563006-35563028 TGGAGGGAGGGGAGGAGAGAGGG - Intronic
1165577946 19:36837834-36837856 TAGAAGGAGGGGAGAAGAATGGG - Intronic
1167633921 19:50642442-50642464 CATAGAGAGGGGAGCAGAGCTGG - Intronic
1167939215 19:52932814-52932836 TTTAGCGAGGGGAGTGTAGTAGG + Intronic
925286621 2:2720635-2720657 CATGGGGAGGTAAGTAGAGTGGG + Intergenic
925749884 2:7078529-7078551 CCCAGGGAGGGGAGGAGAGTAGG - Intergenic
928256643 2:29728673-29728695 TAAAGGGAGTGGGGTAGGGTGGG + Intronic
929413448 2:41723115-41723137 TAGAGGGAGGAGTGTAGAATTGG + Intergenic
930085767 2:47496008-47496030 TATGGGGATGGGAGTAGGGGTGG + Intronic
931485266 2:62684303-62684325 TGGAGGGATGGGGGTAGAGTGGG + Intronic
932262923 2:70342155-70342177 TTTAGGGAGTGCAGTAGAGATGG + Intergenic
932890857 2:75596431-75596453 TCTCGGGAGGGGAGTGGAGCTGG + Intergenic
939258976 2:139782520-139782542 TTGAGGGTGGGGAGTAGAGCTGG - Intergenic
940491711 2:154370204-154370226 TATAGGTAGAAAAGTAGAGTGGG + Intronic
940744548 2:157553183-157553205 TGTAGGGAGGGGATTGGAGGAGG - Intronic
941037283 2:160582162-160582184 TTTAAGAAGGGGAGTGGAGTGGG + Intergenic
941087428 2:161134274-161134296 TGTAGGGAGAGGGGTAGTGTAGG - Intergenic
941271405 2:163433482-163433504 GAAAGGGAGGGGAGGAGAGAAGG + Intergenic
942393985 2:175526874-175526896 TACAAGGAGGGGAGGAGAGAAGG - Intergenic
944594614 2:201249781-201249803 TGTGGGGAGGGGAGAAGTGTAGG - Intronic
945155646 2:206834609-206834631 TATAGATATGAGAGTAGAGTAGG - Intergenic
946079970 2:217109468-217109490 TAGAAGGAGGGGAGTGGAGGTGG + Intergenic
1171316468 20:24200003-24200025 TAGAGGGATGGGAGGAGGGTAGG + Intergenic
1173445835 20:43117256-43117278 TAAAGGGAGGGGTGAAGAATTGG + Intronic
1174712558 20:52722762-52722784 TATAGGGAGGTGAGAAGATAGGG + Intergenic
1177588974 21:23136922-23136944 TATAGGGATAAAAGTAGAGTAGG - Intergenic
1178235358 21:30835323-30835345 TATAGGAAGGGAAGAAGAATGGG - Intergenic
1178241106 21:30901583-30901605 TGCAGGGAGGGGTGTAGAATGGG + Intergenic
1179321258 21:40293267-40293289 TAAAGGGAGGTGAGTCGTGTGGG + Intronic
1181010527 22:20037751-20037773 TACAGGGACTGGAGTAGTGTTGG + Intronic
1181620521 22:24087982-24088004 GATAGGGAGGGGAGAGGTGTTGG + Intronic
1182129154 22:27838229-27838251 TATGGGGAGGGGAGTTGACTGGG - Intergenic
1183696994 22:39429089-39429111 CACAGGCAGGGGAGGAGAGTGGG - Intronic
1183772367 22:39938154-39938176 TGAAGGGAGGGAAGTAGAGAAGG - Intronic
1184817255 22:46881649-46881671 TCTTGGGAGGGGACTAGAGCTGG + Intronic
949111096 3:261304-261326 TAGAGGGAGGGAAGAAGAGAGGG + Intronic
949313987 3:2731288-2731310 TAAAGGGAAGGGAGAAGACTAGG - Intronic
950167200 3:10810401-10810423 TATAGGGAAGGGTGAAGAATTGG + Intergenic
951028401 3:17853920-17853942 TTGGGGGAGGGGAGTAGAGATGG - Intronic
951578513 3:24137857-24137879 TATGGGGATGGCAGTAGAGATGG + Intronic
952271460 3:31836540-31836562 TATTGGCAGGGGGGTAGAGGAGG - Intronic
952848449 3:37708445-37708467 TAAAGGGAGGGTTGGAGAGTGGG + Intronic
954378503 3:50207095-50207117 TATTTGGAGGGGAGTGGTGTGGG + Intronic
954456130 3:50600791-50600813 GCTAGTGGGGGGAGTAGAGTCGG - Intergenic
954608984 3:51934294-51934316 GATAGGAAGGGGAGCAGAGGAGG + Intronic
954938992 3:54353709-54353731 TTTAGGGAAGGCAGTAGATTAGG + Intronic
955973118 3:64455795-64455817 CAGAGGGAGGGAACTAGAGTAGG + Intergenic
956594333 3:70949500-70949522 CATGGAGTGGGGAGTAGAGTGGG + Intergenic
956822091 3:72963277-72963299 TATAAGGAGAGGAGTAGGCTGGG + Intronic
956991505 3:74771724-74771746 GATGGGGAAGGGAGGAGAGTGGG + Intergenic
958520249 3:95176426-95176448 GACAGGGAGGGGAGAAGAGAAGG - Intergenic
958634196 3:96722026-96722048 AAGAGGGAGGGGAGGGGAGTGGG + Intergenic
959483480 3:106901249-106901271 TATAAGGAGGGGATTAGATAAGG - Intergenic
959586934 3:108033719-108033741 TTCAGGGAGGGGAGTAATGTGGG + Intergenic
959868745 3:111302483-111302505 TATATGAAGGGGAGTATATTAGG + Intronic
959990005 3:112621077-112621099 TATAGGGAGGGGGGAAGAATTGG - Intronic
961328412 3:126125120-126125142 TGTAGGTGGGGGAGTAGAGGCGG - Intronic
963378456 3:144499285-144499307 TATAGAGAGGAAATTAGAGTTGG + Intergenic
964365046 3:155941564-155941586 TTTCTGGAGGGGAGTAGTGTGGG - Exonic
965305955 3:167063308-167063330 TATAGGAAGGGAAGTTGTGTGGG - Intergenic
966005550 3:175007415-175007437 TTCAGGCATGGGAGTAGAGTTGG + Intronic
966113608 3:176433352-176433374 TAAAGGGAGGTGGATAGAGTGGG - Intergenic
967921201 3:194615796-194615818 TACAGGGGAGGGAGGAGAGTAGG - Intronic
968067890 3:195768965-195768987 GGCAGGGAGGGGTGTAGAGTCGG - Intronic
970450764 4:16164956-16164978 AAGAGGGAGGAGAGGAGAGTTGG - Intronic
971197998 4:24487485-24487507 TAAAGGGAGGGGAATGGAGACGG - Intergenic
971480996 4:27114867-27114889 TATGTGGAGGGGAGAAGAGAGGG - Intergenic
971956685 4:33429676-33429698 TTTGGGGTGGGGAGTAGGGTGGG - Intergenic
972032636 4:34480461-34480483 TCTGGGGAGGGGAGTAAATTGGG - Intergenic
972302110 4:37794136-37794158 GATGGGCAGGGGAGTAGGGTAGG + Intergenic
972906101 4:43749318-43749340 TATATGGAGGGGAGCAGATAGGG - Intergenic
974168658 4:58237531-58237553 TCCAGAGAGGGGAGGAGAGTAGG + Intergenic
975223630 4:71843465-71843487 TATAGGGAGGCCAGGAGAATAGG + Intergenic
975355400 4:73396776-73396798 CATAGGGAGGGGAGGATATTGGG - Intergenic
977049159 4:92104729-92104751 CATATGGTGGGGAGTAGGGTTGG + Intergenic
977708423 4:100097118-100097140 TGTGGGGAGGGGAGAAGAGCAGG + Intergenic
977989620 4:103425152-103425174 AAGAGGGAGGGGAGAAGAGGAGG + Intergenic
978243752 4:106548704-106548726 GAGAGGGAGGAGAGTAGAGGGGG - Intergenic
978243762 4:106548737-106548759 GAGAGGGAGGGGAGTGGAGGGGG - Intergenic
978331111 4:107613049-107613071 TATAGGAAGGCAAGTAGACTGGG - Intronic
978452193 4:108846633-108846655 AGGAGGGAGGGGAGTATAGTGGG - Intronic
978701642 4:111653644-111653666 AATAGGGAAGGGAGGAGAGGGGG + Intergenic
982147433 4:152411317-152411339 TATAGAATGGGGAGGAGAGTTGG + Exonic
983248089 4:165311769-165311791 TAAAGGGAGGGGGATAGAGAGGG - Intronic
983568057 4:169175394-169175416 TGTAGGGATGGGAGAAGAATTGG - Intronic
983923294 4:173370530-173370552 TAAAGGGATGGGAGTGGTGTGGG - Intronic
985280598 4:188282748-188282770 GAGCGGGAGGGGAGTAGAGCCGG - Intergenic
986647082 5:9928031-9928053 TAGAAGAAGGGGAGTAGAGGGGG - Intergenic
986772603 5:10987680-10987702 GGTGGGGAGGGGAATAGAGTGGG - Intronic
987334731 5:16888816-16888838 GATAGGAAGGGCATTAGAGTGGG - Intronic
987709290 5:21488145-21488167 TATAGGGAGGGGTGATGAGTTGG + Intergenic
988750322 5:34186012-34186034 TATAGGGAGGGGTGATGAGTTGG - Intergenic
989068368 5:37485034-37485056 TATAGGGAGGGGTGATGAGTTGG + Intronic
989197315 5:38728174-38728196 TATAGGGAGTGGAGTGGAAGGGG + Intergenic
989973938 5:50559420-50559442 TAGAGAGTGGGGAGGAGAGTGGG - Intergenic
990715640 5:58633375-58633397 TATAGGAAGGAAAGTAGAGGGGG + Intronic
990902929 5:60772636-60772658 GAGAGGGAGGAGAGTGGAGTTGG - Intronic
991306865 5:65186192-65186214 AATATGGAGGGGTATAGAGTTGG - Intronic
991738584 5:69649214-69649236 TATAGGGAGGGGTGATGAGTTGG - Intergenic
991759613 5:69907208-69907230 TATAGGGAGGGGTGATGAGTTGG + Intergenic
991787722 5:70210904-70210926 TATAGGGAGGGGTGATGAGTTGG - Intergenic
991790159 5:70228954-70228976 TATAGGGAGGGGTGATGAGTTGG - Intergenic
991814907 5:70504048-70504070 TATAGGGAGGGGTGATGAGTTGG - Intergenic
991818043 5:70525329-70525351 TATAGGGAGGGGTGATGAGTTGG - Intergenic
991838842 5:70782274-70782296 TATAGGGAGGGGTGATGAGTTGG + Intergenic
991880167 5:71211271-71211293 TATAGGGAGGGGTGATGAGTTGG - Intergenic
991882607 5:71229297-71229319 TATAGGGAGGGGTGATGAGTTGG - Intergenic
993150399 5:84154276-84154298 TATAGGGAGGGGCAAAGAATTGG + Intronic
994421413 5:99529475-99529497 TATAGGGAGGGGTGATGAGTTGG + Intergenic
994485632 5:100384835-100384857 TATAGGGAGGAGTGATGAGTTGG - Intergenic
994871234 5:105352078-105352100 TATAGGAACAGGAGCAGAGTGGG + Intergenic
997037679 5:130212851-130212873 TATATGAAGGGGAGTATATTAGG + Intergenic
997843315 5:137262470-137262492 GGTAGGGAAGTGAGTAGAGTTGG - Intronic
998463963 5:142328257-142328279 TGTGGCCAGGGGAGTAGAGTAGG + Intergenic
998601279 5:143587852-143587874 TCTAGGGAGGGGAATAAGGTTGG + Intergenic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
999111642 5:149126567-149126589 TTCAGGGAGGTCAGTAGAGTTGG + Intergenic
999802374 5:155049917-155049939 TATAGGGAGGAGAGCACAGGTGG + Intergenic
1000448870 5:161359518-161359540 TATAAGGATGGCAGTAGAATAGG + Intronic
1002117593 5:176975929-176975951 TTTAGGGTGGGGTGTAGGGTTGG - Intronic
1002961392 6:1918139-1918161 GATAGAGAGGGGAGAAGAGAAGG + Intronic
1003577131 6:7307515-7307537 TAGAGGGTAGGGAGTAGAGAAGG - Intronic
1004762056 6:18678114-18678136 TATAGGGAGAGGATATGAGTAGG - Intergenic
1004787223 6:18982698-18982720 TTTAGTGAGAGGAGTGGAGTAGG + Intergenic
1005035006 6:21547516-21547538 TCTAGGGTGGGGAGGAGAATTGG - Intergenic
1005548390 6:26892319-26892341 TATAGGGAGGGGTGATGAGTTGG - Intergenic
1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG + Exonic
1006297576 6:33176808-33176830 TGTAGGGAGGGGTGCAGAGAGGG - Intronic
1007307472 6:40918242-40918264 AATAGGAAGGGGAGGAGAGGAGG - Intergenic
1007655453 6:43448738-43448760 GATGGGGTGGGGAGCAGAGTGGG + Intronic
1007889714 6:45276475-45276497 TATGGGGAGGGGTGAAGAATTGG - Intronic
1009019149 6:57933428-57933450 TATAGGGAGGGGTGATGAGTTGG - Intergenic
1009951615 6:70403282-70403304 TATAGGCAGGGAAAGAGAGTAGG + Intergenic
1010469241 6:76206252-76206274 TATAGGTAGGAGAGAAAAGTGGG + Intergenic
1011276876 6:85641105-85641127 TAGAGGGAGGGAAGAAGAGAAGG - Intronic
1011433820 6:87316302-87316324 TATGAGGAGGGGACTAGAGCAGG - Intronic
1013836958 6:114343903-114343925 TTGAGGGAGGGGACTAGAGTTGG - Intergenic
1014226603 6:118855507-118855529 TAGAGGGAGGGGGGGAGAGTAGG - Intronic
1014571143 6:123009610-123009632 GATGGGGAGGGGAGTGGATTAGG - Intronic
1016527116 6:145014285-145014307 GAGAGTGAGGGGAGAAGAGTTGG + Intergenic
1017770061 6:157638100-157638122 TGGAGGCAGGGGAGTAGAGGAGG + Intronic
1017882918 6:158573902-158573924 GATGGGGAGGGGAGGAGAGTGGG + Intronic
1018828983 6:167427779-167427801 TATAGGGAGGGGTGAGGAGCTGG - Intergenic
1019093953 6:169563960-169563982 TATATGGAGGGGAGTTTATTAGG + Intronic
1019170437 6:170130546-170130568 TGCAGGGAGGGAAGTAGAGCAGG + Intergenic
1021179305 7:17487693-17487715 AATAGGGAAGGGAGAAGAGCAGG - Intergenic
1021717378 7:23471536-23471558 TAAAGGGGGAGGAGTGGAGTAGG + Intergenic
1022478767 7:30729329-30729351 TCTGGGGAGGGCAGAAGAGTGGG + Intronic
1022815744 7:33912534-33912556 TAGGGGGAGGGCAGTAGAATAGG + Intronic
1023087243 7:36583243-36583265 GTTAGGGAGGGGAGTAAATTAGG + Intronic
1026270214 7:68830077-68830099 TATATGGCGGGGAAGAGAGTGGG - Intergenic
1026896570 7:74013146-74013168 CATAGGGAGGGGCCTAGAGGCGG + Intergenic
1030980422 7:116179604-116179626 TAAAGTGAGGTGAGTAGGGTAGG - Intergenic
1031457752 7:122004355-122004377 AATGGGGAAGGGAGTGGAGTGGG + Intronic
1031620076 7:123925062-123925084 TGTGGGGAGGGGAGTAGAGGGGG - Intergenic
1032643901 7:133799761-133799783 TATAGGGTGGGTAGTGAAGTAGG + Intronic
1032800395 7:135313028-135313050 GATGGGGAGGTGAGTGGAGTGGG + Intergenic
1032890568 7:136190819-136190841 TATAGGAAGGGGAGTTTATTAGG + Intergenic
1033154580 7:138946022-138946044 AAGAGGGAGGGGAGGAGAGAAGG - Intronic
1033478708 7:141716519-141716541 GATGGGGAGGGGAGGAGAGAAGG - Intronic
1033809556 7:144995481-144995503 GCTAGGGAGAGGAGTAGAGTAGG - Intergenic
1034186317 7:149179769-149179791 TATGGGGAAGGGAGTGGAGGGGG + Exonic
1035474998 7:159136971-159136993 TCAAGGGAGGGGAGTGGAGAAGG + Intronic
1037755256 8:21706161-21706183 AAGAGGGAGGGGAGGAAAGTCGG + Intronic
1040716055 8:50253889-50253911 TAAAGCGAGGGGAGTAGGGAGGG + Intronic
1042952212 8:74212446-74212468 CATAAGGAGGGGAGAAGAATGGG - Intergenic
1044290648 8:90465036-90465058 TGCAGAGAGGGGAGAAGAGTTGG + Intergenic
1044520857 8:93197868-93197890 TAGAAAGAGGGGAGAAGAGTGGG - Intergenic
1044835401 8:96290605-96290627 TAAAGGGATGGGATTAGAGATGG - Intronic
1048499440 8:134962289-134962311 TATAGGAAGGGGAGTTTATTAGG - Intergenic
1049564103 8:143328998-143329020 TATAAGAAGGAGAGTAGAGGAGG - Intronic
1049693521 8:143972967-143972989 TTTAGGGAGGTGAGGAGAGGCGG + Intronic
1050592103 9:7171525-7171547 TAGAGGATGGGGAGTGGAGTAGG + Intergenic
1052786813 9:32836038-32836060 TATAGGGAGGAGCGCAGAGTGGG + Intergenic
1052826438 9:33179190-33179212 TATAGGGAGTGGTGAAGAATTGG + Intergenic
1052982019 9:34457209-34457231 TATAGTGAGGGGGGAAGAGAGGG - Intronic
1054710473 9:68505827-68505849 TATAGGGAGGGGAGCAGGGCTGG - Intronic
1055436483 9:76296906-76296928 TAGAAGGAGGGAAGCAGAGTAGG - Intronic
1056788520 9:89610473-89610495 TGCAGGGAGGGAAGTAGAATTGG - Intergenic
1057509179 9:95663517-95663539 TCTTGAGAGGGGAGCAGAGTTGG + Intergenic
1057713685 9:97470222-97470244 AAAGGGGAGGGGAGCAGAGTTGG + Intronic
1059055202 9:110972088-110972110 TACAGGGATGGAAGTAGAGATGG + Exonic
1060201506 9:121654255-121654277 TTTGGGGAGGGGAGTGGATTGGG + Intronic
1060458143 9:123820192-123820214 CATAGGGATGGGACTAAAGTTGG - Intronic
1061650454 9:132044136-132044158 AATAGGGAGGGGAGGAGGGAAGG + Intronic
1187495468 X:19791554-19791576 AAGAGGGAGGGGAGTAAAGTAGG + Intronic
1189925118 X:45945320-45945342 TATAGGGTGGGGTGTAGTGCAGG + Intergenic
1190511154 X:51175577-51175599 TAGGTGGAGGGGAGCAGAGTAGG - Intergenic
1192537231 X:71938554-71938576 TGAAGGGAGGCGAGTAGGGTTGG + Intergenic
1193428478 X:81370335-81370357 TAAAGGGAGGTGAGAAGACTTGG + Intergenic
1199317436 X:146396611-146396633 TATAGGGATTGGAGGAGAGGTGG + Intergenic
1199598186 X:149524610-149524632 TAGAGTGAGGGAAGTAGAATTGG - Intronic
1201272015 Y:12264643-12264665 TATAGGGAGGCTAGTAGATGAGG + Intergenic
1201427350 Y:13867036-13867058 AACAAGGAGGGGAGTAAAGTTGG + Intergenic