ID: 1006182514

View in Genome Browser
Species Human (GRCh38)
Location 6:32162877-32162899
Sequence CCAGGCTGTGTGGGAGATAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006182514_1006182525 30 Left 1006182514 6:32162877-32162899 CCGGTATCTCCCACACAGCCTGG 0: 1
1: 0
2: 3
3: 26
4: 263
Right 1006182525 6:32162930-32162952 ATTGAACCTTGGCTCTCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 138
1006182514_1006182523 19 Left 1006182514 6:32162877-32162899 CCGGTATCTCCCACACAGCCTGG 0: 1
1: 0
2: 3
3: 26
4: 263
Right 1006182523 6:32162919-32162941 ATGAGACCTGCATTGAACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006182514 Original CRISPR CCAGGCTGTGTGGGAGATAC CGG (reversed) Exonic
900265663 1:1755879-1755901 CCACGCTGTGTGGGGGACCCTGG - Intronic
900707494 1:4089744-4089766 CCAGGCTCTGAGGGAGTTAGAGG - Intergenic
900978864 1:6035001-6035023 CCAGGGAGTGTGGGGGAGACGGG + Intronic
901684677 1:10937370-10937392 CCTGGCTGTGTGCGAGAGGCTGG - Intergenic
902557677 1:17256550-17256572 CCAGGCTCTGTGTGAGATGCTGG - Intronic
902955884 1:19923785-19923807 CCAGGCAGTGTGGGGGATGGCGG + Intergenic
902998455 1:20246764-20246786 CCAGGCATGGTGGGAGAGACGGG - Intergenic
903888196 1:26553444-26553466 CCAGGCTGTGCAGGTGATCCAGG - Exonic
904113522 1:28145236-28145258 CCAGGCTATATGTGAGAAACTGG + Intergenic
904909307 1:33922119-33922141 CCATGCTGAGTGTGAGATCCTGG + Intronic
904935776 1:34128599-34128621 CCAGGCTGTGTGGGTCCTTCAGG - Intronic
905479487 1:38251323-38251345 CCAGGCTCTGTGTGAGGGACAGG + Intergenic
905497792 1:38407957-38407979 CCATGCTGTTTTGGAGATAATGG - Intergenic
906697498 1:47833166-47833188 CCAGGCTCTGTGGGGGATGGTGG + Intronic
906698595 1:47841521-47841543 CCAGGCTCTCTGGGAGGTGCAGG + Intronic
907491238 1:54810200-54810222 CCAGGCTCTGTGGAAGGCACCGG - Intronic
907528013 1:55065157-55065179 CCAGGCTGTGTGCCAGGTACTGG - Intergenic
907965608 1:59325627-59325649 CCAGGCAATGTGTTAGATACTGG - Intronic
908134676 1:61118389-61118411 CCAGGCAGTGTGCTAGATACTGG + Intronic
908293747 1:62692750-62692772 CCAGGCAGTGTATTAGATACTGG - Intergenic
908319198 1:62964238-62964260 CCAGGAAGTGTGGGAAACACAGG - Intergenic
911193383 1:94970039-94970061 GCAGGCTGTGGGGGAAATGCAGG - Intergenic
913598638 1:120402620-120402642 CCAGGCTGATTGGGAACTACTGG + Intergenic
914088743 1:144476998-144477020 CCAGGCTGATTGGGAACTACTGG - Intergenic
914309869 1:146457205-146457227 CCAGGCTGATTGGGAACTACTGG + Intergenic
914592240 1:149115928-149115950 CCAGGCTGATTGGGAACTACTGG - Intergenic
915460844 1:156069902-156069924 CCAGACTGAGTGGGAGGCACTGG - Intronic
917703129 1:177601300-177601322 CCAGGCTGAGTGGAAGATGAAGG - Intergenic
920070324 1:203297779-203297801 CTAGGCTGGGTGGGAGATCTAGG + Intergenic
920535282 1:206733135-206733157 CCAGGCTGTTGTGGAGAAACAGG - Exonic
922203261 1:223424852-223424874 CCAGGCTGAGTGTGAGCTCCAGG - Intergenic
923253152 1:232195596-232195618 CCAGGCTGTGGTGGAGAATCTGG + Intergenic
923556762 1:235007165-235007187 CCAGGCTCTGTGCTAGACACAGG + Intergenic
1064061063 10:12137553-12137575 CCCAGCCCTGTGGGAGATACAGG - Intronic
1065360651 10:24886242-24886264 CAAAGCTGTCTGGGAGGTACAGG - Intronic
1065702837 10:28442341-28442363 CCAGGCTGAGCGGGAGCTCCAGG + Intergenic
1068120938 10:52781315-52781337 TCAGGCAGTGTGAAAGATACAGG - Intergenic
1068142270 10:53023795-53023817 GCCGGCTGTGTGGGAGACAAGGG - Intergenic
1070121057 10:73577827-73577849 ATAGTCTGTGTGGGAGATATGGG - Intronic
1070159285 10:73855981-73856003 CCAGGCTGGGCTGGAGATCCTGG + Intronic
1070511607 10:77166381-77166403 ACAGGCTTTGTGGTGGATACTGG + Intronic
1070806539 10:79274243-79274265 CCAGGGTGAGTGGGAGAGACGGG - Intronic
1070830855 10:79417354-79417376 CCTGGCTGTGTGGGAGCCACAGG - Intronic
1071107754 10:82118016-82118038 TCAGGCTGTGTTGGTGCTACCGG - Intronic
1071513764 10:86283386-86283408 CCAGGCAGTGGGCTAGATACTGG - Intronic
1071619828 10:87109040-87109062 CCAGGCTGTTTTGGGTATACTGG + Intronic
1074289300 10:112126486-112126508 CCAGGTTGAGTGGGAAAAACAGG + Intergenic
1074703161 10:116109921-116109943 CCTGCCTGTGGAGGAGATACTGG - Intronic
1075321440 10:121494488-121494510 CCTACCTGTGTGGGAGATAGGGG - Intronic
1076169593 10:128308265-128308287 TCAGGCTGTGTGGTGGAGACGGG + Intergenic
1076613908 10:131743797-131743819 CAGGGCTGTCTGGGAGATGCTGG - Intergenic
1076812474 10:132895490-132895512 CCAGGCTGTGTGTGCTATACTGG + Intronic
1077452256 11:2655466-2655488 CCAGGCTCTGCAGGAGGTACCGG - Intronic
1077592017 11:3499578-3499600 CCAGGCTGTGTGGGATCTTTTGG + Intergenic
1081702056 11:45158377-45158399 CCAGCCTGTCTGGGAGCTGCAGG - Intronic
1081997793 11:47376387-47376409 CCAGGCTGTGTGAGAGGCATAGG - Intronic
1084043456 11:66555753-66555775 CCAGGCTGTGTGGGCACTGCTGG + Intronic
1085019413 11:73195870-73195892 CCAGGGTGTGTGGGAGCCCCTGG - Intergenic
1085660640 11:78363364-78363386 CCAGGCAGTGTGGTAGGTATGGG - Intronic
1085665945 11:78416552-78416574 CCAGGCTGTGGGAGTGATCCCGG + Intronic
1085803012 11:79608789-79608811 CCAAGCTCCGTGGCAGATACTGG - Intergenic
1087202628 11:95361279-95361301 CCAAGCTGAGTGGGAGATGATGG - Intergenic
1088378996 11:109172789-109172811 ATAGACTGTGAGGGAGATACAGG - Intergenic
1088878807 11:113957732-113957754 CCAGCCTTTGTGGTAGAAACTGG - Intergenic
1088887328 11:114018093-114018115 CCAGGCTGTGTTGGAGAGTCAGG + Intergenic
1093414964 12:18909248-18909270 CCAGGGTGTCTGAGAGACACAGG + Intergenic
1094216822 12:27951385-27951407 CCAGGCTGTATGTGAACTACAGG + Intergenic
1094799534 12:34016820-34016842 CCAGACTCTGATGGAGATACAGG - Intergenic
1095112321 12:38311086-38311108 CCAGACTCTGATGGAGATACAGG - Intergenic
1096228629 12:49885070-49885092 CCAGACTGTGGTGGAGATGCGGG + Intronic
1096411083 12:51377531-51377553 TCAGGGTGGGTGGCAGATACCGG - Intronic
1096489489 12:52006132-52006154 CCAGGCTGAGTGGGAGTTCAGGG - Intergenic
1097186079 12:57197198-57197220 CCAGGCTGTGTGGGACTGCCCGG + Intronic
1097424349 12:59424293-59424315 CCAGGAGCTGTGGGAGACACGGG - Intergenic
1098055036 12:66496253-66496275 TCAGGCTCTGTGGAAGATAGGGG + Intronic
1100792734 12:98148547-98148569 CCAGGCAGTGAGGCAGGTACTGG + Intergenic
1101685706 12:107018042-107018064 CAAGGCTGTGTCTGAGGTACTGG - Intronic
1101826876 12:108227234-108227256 GCAGGCTGTGTGGGATGGACTGG - Intronic
1103100744 12:118172940-118172962 ACAGGCAGTGTGCAAGATACAGG + Intronic
1103458953 12:121088862-121088884 CCAGGCACTGTGTGAGATATGGG + Intergenic
1103723233 12:122985767-122985789 CCAGTCTGAGTGGGAGGTTCTGG + Exonic
1104714741 12:131008843-131008865 CCAGGCTGTGAGGGACTCACGGG + Intronic
1106177161 13:27341398-27341420 CCAGGGTGTGGGGGAGATTCTGG - Intergenic
1107825183 13:44322998-44323020 ACAGGCTGGGAGGTAGATACTGG - Intergenic
1111619951 13:90712456-90712478 CCAGGCCTTGTGGTAGGTACTGG + Intergenic
1113443235 13:110346057-110346079 CCAGGTTGTGAGGGTGATAGAGG - Intronic
1113594987 13:111524877-111524899 CCAGGCTCTGTGGGAAATACTGG - Intergenic
1116095698 14:40364291-40364313 CCAGGCTTAGGTGGAGATACGGG + Intergenic
1122160834 14:99782585-99782607 CAAGCCTGTGAGGGAGATAGGGG + Intronic
1122255389 14:100472406-100472428 CCAGGTGGTGTGGTAGAAACAGG - Intronic
1122345495 14:101056172-101056194 CCAGGCTGTGCAGAAGATGCAGG + Intergenic
1125903146 15:43367773-43367795 CAAGTCTGTGTGTGAGATTCAGG + Intronic
1128569029 15:68719945-68719967 CCAGTCTTTGTGGAAGAGACTGG + Intronic
1129394120 15:75235048-75235070 CCAGGCTGTGGGGCAGGCACAGG - Intergenic
1130894952 15:88162816-88162838 AAAGGCTGGGTGGGAGGTACTGG - Intronic
1131310532 15:91286472-91286494 CAAGGCTGTGTGGGAGGCAATGG + Intronic
1131656047 15:94460345-94460367 CAAGACTATGTGGGAGATACAGG + Intronic
1132522536 16:398080-398102 CCAGATTCTGTGGGACATACAGG + Intronic
1133214938 16:4286339-4286361 CCAGGCTGGTTGGGAGCTGCTGG + Intergenic
1134589986 16:15444643-15444665 CCAGGCTGGGTGGGAGGAGCTGG + Intronic
1134628429 16:15739527-15739549 CCAGGCTCTGTGTTAGATGCAGG - Intronic
1134669989 16:16047738-16047760 CCAGGCTGTGTCAGTGCTACTGG - Intronic
1135086611 16:19479586-19479608 CCTGGCTGAGTGGGACATACAGG + Intronic
1135183425 16:20294341-20294363 CCAGGCTGTCTGGGAGAGCCAGG + Intergenic
1135206688 16:20491036-20491058 CCAGTCTTTGTGAAAGATACAGG - Intergenic
1135212197 16:20532596-20532618 CCAGTCTTTGTGAAAGATACAGG + Intergenic
1137595452 16:49720536-49720558 CCTGGCTGTGTTTGAGAGACTGG + Intronic
1137918774 16:52464008-52464030 CCAGGCTTTGAGGGGGAAACTGG + Exonic
1138617297 16:58179469-58179491 CCAGCCTGGGTGAGAGATAGAGG + Intronic
1139514716 16:67446303-67446325 CCAGGCTGGGTGGGAGCTGGGGG - Intronic
1139662881 16:68433725-68433747 CCAGGCTGTGTGGGGTCTGCTGG + Intronic
1142061768 16:88035014-88035036 CCAAGCTGTGTGGCACATATGGG + Intronic
1142478407 17:203484-203506 CTAGGCTATGTGGGAGAGCCTGG - Intergenic
1143618010 17:8064867-8064889 CCAGGCTGTGGAGGGGATCCAGG - Intergenic
1144579063 17:16447792-16447814 CCAGGCTGAGTGTGTGTTACAGG - Intronic
1146065197 17:29629323-29629345 CCTGGCTGTGGTTGAGATACTGG + Exonic
1146685253 17:34837203-34837225 CCAGGCTATGTGTTGGATACTGG - Intergenic
1147408689 17:40233070-40233092 CCAGGCTGTGGCAGAGATTCAGG + Intronic
1147547480 17:41413751-41413773 CCAGGCTTTGTGCAAGACACTGG + Intergenic
1148861978 17:50609281-50609303 CCAGGATGTGGGGGAGACACTGG + Intronic
1150207861 17:63422399-63422421 GCTGGCTGTGTGGGTGACACTGG - Exonic
1150890358 17:69141868-69141890 CCAGGCTGTGTAAGAGCTGCTGG - Exonic
1152905959 17:82971097-82971119 CGTGGCTGTGTGGGAGGTGCTGG - Intronic
1153517191 18:5914895-5914917 CTAGGCTCTATGTGAGATACAGG - Intergenic
1153553855 18:6290164-6290186 CCAGGCACTTTGGGAGATCCAGG - Intronic
1158550472 18:58431348-58431370 CCAGACTGAGTGGGAGTTAGGGG - Intergenic
1159057955 18:63485086-63485108 CCAGGCTGTGATGGAGAACCTGG + Intronic
1160558567 18:79741689-79741711 TCAGCCTGCGTGGGAGACACAGG + Intronic
1160817723 19:1043766-1043788 CCGGGAGGTGTGGGAGATGCTGG + Exonic
1161241795 19:3227066-3227088 TCCGTCTGTGTGTGAGATACAGG + Intronic
1162028464 19:7907225-7907247 CCAGCCTGTGTGGGGCATGCAGG + Intronic
1163633276 19:18427600-18427622 CCAGGATGTGTGGCAGGTCCCGG - Intronic
1164831132 19:31321679-31321701 CCAGACTGTGTGTGAGACAGAGG + Intronic
1166144382 19:40824119-40824141 CCAGGCTGTGTGGGAAAGGTAGG + Intronic
1166728464 19:45043612-45043634 CCAGGCCATGTGAGAGATGCAGG + Intronic
1166918538 19:46212800-46212822 CCAGGCTTTGTGTCAGACACTGG - Intergenic
1167449375 19:49557908-49557930 CCAGGCTGTGTGGAGGACATGGG + Intronic
1167556158 19:50197221-50197243 CCAGGCTCTGTTGTAGACACTGG + Intronic
925896506 2:8476421-8476443 CCAGACACTGTGGGAGTTACTGG + Intergenic
927505248 2:23609148-23609170 CCAGGCAGTGTGCTAGATGCTGG + Intronic
928694775 2:33838449-33838471 TTAGGCTGTGTGGTAGATACAGG - Intergenic
929050613 2:37833693-37833715 CCAGGATGTGTGGGAGGGGCAGG + Intergenic
929413749 2:41726443-41726465 CCAGGCTCTGTGGTAGAAACCGG + Intergenic
930379529 2:50610600-50610622 CCAGGCTCTGTGCTAGACACTGG - Intronic
930708561 2:54528497-54528519 CCAGGCACTGTGGGAAATGCCGG + Intronic
932303925 2:70688023-70688045 GCAGGCTGCATGTGAGATACAGG - Exonic
932400996 2:71481223-71481245 ACAGCCTGTGTGAGAGAAACAGG - Intronic
932598345 2:73107943-73107965 CCAGGCTGTCTGTGGGCTACGGG + Intronic
933635035 2:84699420-84699442 CCAGACTGTGTGAGAGAAAGAGG + Intronic
934769588 2:96899367-96899389 CCAGGCTCTGTGCCAGGTACTGG - Intronic
935147482 2:100405718-100405740 TTAGGCTGATTGGGAGATACTGG - Intronic
937440038 2:121907690-121907712 CCAGGCTGTGTGAGGTAAACGGG + Intergenic
938247681 2:129791744-129791766 CCAGTCTTTGTGGGAGTTTCTGG - Intergenic
939917656 2:148066997-148067019 CCATGCTCTGTGGTAGGTACTGG - Intronic
944221616 2:197310033-197310055 CCAGGCTGTGTGCGTGGTGCGGG - Intronic
946385323 2:219380962-219380984 CCAGGGTGTGTAGGAGACACAGG + Intronic
947638984 2:231695548-231695570 CCAGGCTCTGTGGCTCATACCGG - Intergenic
948074286 2:235153614-235153636 CCAGGCTGTGTAGGAAAAAGTGG + Intergenic
1169113922 20:3050421-3050443 CCAGGCTTTGTGGGATAGACAGG + Intergenic
1169193436 20:3671511-3671533 CCAGGCAGTGAGGGGGACACTGG + Intronic
1172493594 20:35361380-35361402 CAAGGCTATGTGGGAGAAGCTGG - Intronic
1172619478 20:36309536-36309558 CCAGGATCTGTGGGAGTTACAGG + Intronic
1176018308 20:62949701-62949723 CCAGGCTGACTGGTGGATACTGG - Intergenic
1176067654 20:63207027-63207049 CCTGGCTGTGCGGGAGACAAAGG - Intronic
1176127407 20:63482202-63482224 ACAGGCTGTGTGGCAGAGCCTGG + Intergenic
1176158418 20:63635576-63635598 GCAGGCTGTGGGGGAGCAACTGG + Intergenic
1179092843 21:38283907-38283929 CCAGGCAGAGTCAGAGATACAGG - Intronic
1179292363 21:40029818-40029840 TCAGGCAGTGAGGGAGATATAGG - Intronic
1179661587 21:42879320-42879342 CCAGGCGGTGCGGGAGAAGCGGG + Intronic
1179942471 21:44649013-44649035 CCTGTCTGTGAGGGAGATGCGGG + Intronic
1183591645 22:38782611-38782633 CCAGGCTGTGTGGGCCCTGCCGG + Intronic
949781832 3:7698300-7698322 CCATGCTGTGTGGCACATATTGG + Intronic
950627704 3:14260356-14260378 GCAGGCTCTGTGGGTGATATAGG - Intergenic
952137643 3:30441258-30441280 CCAGGCTCTGTGCTAGATAATGG + Intergenic
953000316 3:38926520-38926542 CCAGGCTCTATGGAAGATACAGG - Intronic
953156519 3:40380115-40380137 CCAGGCACTGTGCTAGATACTGG - Intergenic
953495147 3:43379544-43379566 CCAGGCTCTGTGGGACAGCCAGG + Intronic
953739491 3:45524999-45525021 CAAGGCTTTGTGAGAGACACAGG - Intronic
954420965 3:50418814-50418836 CCCAGCTGTGAGGGAGAAACAGG - Intronic
954609015 3:51934423-51934445 CTAGGCAGTGTGGCAGAGACAGG + Intronic
954752572 3:52821887-52821909 CCAGGCTCTGGGCGAGAGACAGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
954988715 3:54819318-54819340 CCAGGCTCTGTGCGAGGAACAGG - Intronic
955423683 3:58765387-58765409 CCAGGCTGTGTGGGGATTTCAGG + Intronic
956514453 3:70031372-70031394 CCAGGGTTTGGGGGAGATAGGGG + Intergenic
958462113 3:94412177-94412199 CCAGGCAGTGTGACAGATCCAGG - Intergenic
959624978 3:108439418-108439440 CCAGGTTCTGTGGGAGATATGGG + Intronic
960554611 3:119013612-119013634 CCAGGCACTGTGGTAGATTCTGG + Intronic
961291336 3:125849266-125849288 CCAGGCTGTGTGGGATCTTTTGG - Intergenic
961895835 3:130167082-130167104 CCAGGCTGTGTGGGATCTTTTGG + Intergenic
962409328 3:135127698-135127720 ACAGGGTGTGTGGGAGAGAGCGG - Intronic
965330906 3:167373321-167373343 GCAGGGTGTGAGGGAGTTACTGG + Intronic
968580568 4:1390491-1390513 CCAGGCTGTGTTGGAACTCCTGG + Intergenic
968703506 4:2067502-2067524 CCTGGCTGTGTGGCAGGTGCTGG + Exonic
969005959 4:4020226-4020248 CCAGGCTGTGTGGGATCTTTTGG + Intergenic
969236713 4:5870541-5870563 CCAGGCTGTGTCCAAGATGCCGG - Intronic
969439165 4:7207334-7207356 CCAGGCTGTGTGGGCGGGAGGGG - Intronic
969806990 4:9617064-9617086 CCAGGCTGTGTGGGATCTTTTGG - Intergenic
969867888 4:10087190-10087212 GCAGGGTGTGAAGGAGATACTGG - Intronic
970053707 4:11947547-11947569 CCAGGCTGTGATGGTGTTACAGG + Intergenic
973024521 4:45250843-45250865 CCTGGGTGTCTGGGACATACTGG - Intergenic
975655146 4:76633813-76633835 CCAGGCAGTCTGGGAGCTCCAGG + Intronic
976052882 4:81030014-81030036 CAAGGGTGTGTGGAAGATCCCGG - Intergenic
976638925 4:87316841-87316863 CCAAGCTTTGTGTCAGATACTGG + Intronic
978444740 4:108769763-108769785 CCAGGCTGGGTGGCAGAGCCTGG - Intergenic
979034676 4:115700161-115700183 CCAGCCTGAGTGACAGATACGGG - Intergenic
980335040 4:131461290-131461312 CCAAGCTTTGTGCCAGATACTGG - Intergenic
981776557 4:148374842-148374864 TCAGTCTTTTTGGGAGATACAGG - Intronic
984504783 4:180603171-180603193 ACAGGCACTGTTGGAGATACAGG + Intergenic
986483665 5:8214087-8214109 TGAGGCTGTGAGGGAGACACTGG + Intergenic
992776397 5:80092926-80092948 CCAGGCACTGTGCTAGATACTGG + Intergenic
995243447 5:109911322-109911344 CCAGGCTCTGTGCTAGCTACTGG + Intergenic
995243671 5:109913566-109913588 ACAGGCATTGTGGGAGATAGAGG - Intergenic
998169926 5:139866656-139866678 CCAGGCAGTGATGGAGAAACAGG - Intronic
998170135 5:139867977-139867999 CCAGGCTGGGTGTGAGATAAGGG - Intronic
999495387 5:152091443-152091465 CCAGGCAGTGTGGGAGCAAGAGG + Intergenic
1001919317 5:175587962-175587984 CCATGCTGTGTGGGAGCTACTGG - Intergenic
1002043806 5:176531234-176531256 CCAAGCTGTGAGGCAGGTACAGG + Intronic
1003015814 6:2466738-2466760 CCAGGCTGGTTGGGAGGTAGAGG + Intergenic
1005885848 6:30097127-30097149 CCATGTTGTGTGGGAGAAGCTGG + Intergenic
1006094006 6:31644584-31644606 CCAGGCTGTGTGCCAGAATCTGG + Exonic
1006182514 6:32162877-32162899 CCAGGCTGTGTGGGAGATACCGG - Exonic
1006193583 6:32223752-32223774 CCAGGCCGTGTGAGGGATGCTGG - Intronic
1006487548 6:34356082-34356104 CCTGGCTGTGTCTGTGATACTGG + Intronic
1006678418 6:35779766-35779788 GAGGGCTGTGTGGGAGAGACGGG + Intergenic
1007615998 6:43180084-43180106 CCAGTGTGTGGGGGAGATTCTGG + Exonic
1007765892 6:44159486-44159508 CCAGGCTGAGGGTGAGGTACAGG - Intronic
1011228038 6:85129220-85129242 CCAGGCTGTGTCGGAGACTGAGG + Intergenic
1011786355 6:90849846-90849868 CCAGGCTGTGGTGGAGACACAGG - Intergenic
1014950865 6:127553915-127553937 CCAGGCACTATGTGAGATACTGG + Intronic
1015386656 6:132632459-132632481 CCAGGCTCTGTGGCAGGGACGGG + Intergenic
1015928852 6:138336429-138336451 CCAGGCTGTGAGGGAGTGGCTGG + Exonic
1016696459 6:147001833-147001855 CGTGGCTGTGTGAGAGAAACTGG - Intergenic
1017801072 6:157897035-157897057 CATGGCTGAGTGGGAGAGACAGG + Intronic
1018536700 6:164827822-164827844 CCAGGCTAACTGGGAGCTACTGG + Intergenic
1019478459 7:1255261-1255283 CAAGGCTGTGTGGCAGGTGCTGG + Intergenic
1021793475 7:24229288-24229310 CCAGCCTGTGTGGCTGTTACAGG - Intergenic
1022237187 7:28473545-28473567 CCAGGCAGTGTGTCAGATATGGG - Intronic
1022254708 7:28644261-28644283 CAAGGCTGAGTGTGAGACACAGG - Intronic
1022283644 7:28934705-28934727 CCAGGCAGTGTGAGAGCAACTGG + Intergenic
1023177056 7:37445745-37445767 GGAGGCTGTGTGGCAGATGCAGG - Intronic
1023601452 7:41885460-41885482 CCAGGTTGAGAGGGAGAGACAGG + Intergenic
1030165032 7:106545482-106545504 GCAGTCTGTGTGAGAGATAGTGG + Intergenic
1034423606 7:151001664-151001686 CCAGGGTGTGTGGGGGAGAGTGG - Intronic
1034440773 7:151084893-151084915 CCAGGCATTGTGCAAGATACTGG + Intergenic
1034709952 7:153182633-153182655 CCAGGCCATGTGGGAGATGGAGG + Intergenic
1034860093 7:154587434-154587456 GCAGGCTGTGTGGGATGCACAGG - Intronic
1035051002 7:155999049-155999071 CCAGGCTGAGTGGGAGGCACCGG + Intergenic
1035757826 8:2047293-2047315 CCAGGCTGGGTGAGGGACACTGG + Intronic
1036370107 8:8155407-8155429 CCAGGCTGTGTGGGATCTTTTGG - Intergenic
1036880785 8:12510224-12510246 CCAGGCTGTGTGGGATCTTTTGG + Intergenic
1038256139 8:25953081-25953103 CCAGGCTGTGTTAGAGCTATTGG - Intronic
1038728498 8:30103929-30103951 GCAGGCTGTGTGGAGGGTACAGG - Intronic
1039097587 8:33903372-33903394 CCAGGGTGTGTACGAGACACAGG - Intergenic
1041728027 8:61036367-61036389 CCAGGCTCTGTGGCAGCTGCAGG + Intergenic
1043609398 8:82043688-82043710 CTATGCGTTGTGGGAGATACCGG - Intergenic
1045010635 8:97955839-97955861 CCAGGCACTGTGCTAGATACCGG + Intronic
1045853400 8:106731921-106731943 CCAGGCTATTTTGTAGATACAGG - Intronic
1046974744 8:120261905-120261927 CAAGGCTGAGAGGGAGATACTGG + Intronic
1047251211 8:123183090-123183112 CCAGGGTGTCTGGGGGACACGGG - Exonic
1048449811 8:134523423-134523445 CCAGGAGGCGTGGGAGACACTGG - Intronic
1049324763 8:142016148-142016170 CCTGGCTGTGTGGGAGGCAGTGG + Intergenic
1050424444 9:5499204-5499226 CCAAGCAGAGTGGGAAATACTGG + Intergenic
1056110568 9:83390460-83390482 AAAGGCAGTGTGGGAGATTCAGG + Intronic
1056235894 9:84593972-84593994 CCAGGCTGTGTGCTCGATATGGG + Intergenic
1056714111 9:89014162-89014184 CCAGGCTGGGTCAGAGGTACAGG + Intronic
1056843840 9:90020284-90020306 CCAGGCTGTTTGTGAAATATGGG - Intergenic
1056888442 9:90467058-90467080 CCAGGGTGTGTTGGAAATGCAGG + Intergenic
1058536736 9:105968537-105968559 CCAGGCACTGTGCTAGATACTGG - Intergenic
1060188861 9:121579708-121579730 CCAAGGTGTGTGGCAGAGACAGG - Intronic
1060879869 9:127110641-127110663 ACAGGTTGGGTTGGAGATACGGG - Intronic
1061294930 9:129671892-129671914 CCTGGCTGTTGGGGAGATTCTGG + Intronic
1061518547 9:131103848-131103870 CCAGGGTGTGTAGGACATAGGGG - Intronic
1061762952 9:132863122-132863144 CCAGCGTGTGTGGGAGGGACAGG + Intronic
1062412987 9:136434116-136434138 CCAGGCTGGGCGGGAGCTCCTGG + Exonic
1062575598 9:137205828-137205850 TCAGGATGTGTCGGAGAGACTGG + Exonic
1185854377 X:3520547-3520569 AGAGGCTGTGGGGGAGATGCTGG - Intergenic
1187426256 X:19180057-19180079 CCAGGTTGTGTGTTAGATGCTGG + Intergenic
1187593008 X:20739608-20739630 CCAGGTTCTGTGGGAGATACTGG - Intergenic
1188503376 X:30854175-30854197 CCAGGCTCTGGGGGAGAAAAGGG - Exonic
1189265549 X:39713363-39713385 CCAGGCAGTGTGCTAGACACAGG - Intergenic
1189280875 X:39819553-39819575 CAAGGCTGGGTGGGAGAGATGGG - Intergenic
1190442137 X:50485298-50485320 CCAGGCACTGTGGTAGATACTGG + Intergenic
1192860052 X:75058051-75058073 CCAGGCTGTGGGGGTGAGAAAGG + Intronic
1193808621 X:86024125-86024147 CCAGGCTGAGGGGTAGAGACAGG + Intronic
1194358131 X:92914008-92914030 CCAGGCAATGTGGAAGGTACTGG - Intergenic
1195923537 X:110003915-110003937 CCTGGCTCTGTTGGAGATCCTGG + Exonic
1196161342 X:112487127-112487149 CCATGCTGTTTGGGAGAATCTGG + Intergenic
1197218025 X:123884584-123884606 TCAGGCAATGTGGGAGATTCTGG + Intronic
1197621960 X:128760872-128760894 CCAAGCTGAGTGAGAGACACTGG - Intergenic
1199679461 X:150215252-150215274 CCAGGCTGTCAGGGAGATGCAGG - Intergenic
1199695766 X:150341797-150341819 CCAGGCTGTCAGGGAGATGCAGG + Intergenic
1200666316 Y:6029659-6029681 CCAGGCAATGTGGAAGGTACTGG - Intergenic