ID: 1006183960

View in Genome Browser
Species Human (GRCh38)
Location 6:32169959-32169981
Sequence CGTCGCTTCACCTCGGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 29}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006183960_1006183971 30 Left 1006183960 6:32169959-32169981 CCCTCACCCGAGGTGAAGCGACG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1006183971 6:32170012-32170034 GGACATGACTATGGGGACAATGG 0: 1
1: 0
2: 2
3: 12
4: 196
1006183960_1006183968 21 Left 1006183960 6:32169959-32169981 CCCTCACCCGAGGTGAAGCGACG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1006183968 6:32170003-32170025 TTGGTAGGAGGACATGACTATGG 0: 1
1: 0
2: 1
3: 6
4: 104
1006183960_1006183967 9 Left 1006183960 6:32169959-32169981 CCCTCACCCGAGGTGAAGCGACG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1006183967 6:32169991-32170013 GCAGTAGAAGTCTTGGTAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 120
1006183960_1006183965 2 Left 1006183960 6:32169959-32169981 CCCTCACCCGAGGTGAAGCGACG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1006183965 6:32169984-32170006 CCTTCTTGCAGTAGAAGTCTTGG 0: 1
1: 0
2: 0
3: 4
4: 131
1006183960_1006183966 6 Left 1006183960 6:32169959-32169981 CCCTCACCCGAGGTGAAGCGACG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1006183966 6:32169988-32170010 CTTGCAGTAGAAGTCTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 143
1006183960_1006183970 23 Left 1006183960 6:32169959-32169981 CCCTCACCCGAGGTGAAGCGACG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1006183970 6:32170005-32170027 GGTAGGAGGACATGACTATGGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1006183960_1006183969 22 Left 1006183960 6:32169959-32169981 CCCTCACCCGAGGTGAAGCGACG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1006183969 6:32170004-32170026 TGGTAGGAGGACATGACTATGGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006183960 Original CRISPR CGTCGCTTCACCTCGGGTGA GGG (reversed) Exonic
915338956 1:155166048-155166070 CATCCCATCACCTCGGGTGAAGG - Intergenic
916183653 1:162110172-162110194 TGTCGGTTCCCCTCCGGTGAGGG + Intronic
924661359 1:246021176-246021198 CCTTTCTTCACCTCGGGTGAAGG + Intronic
1090245013 11:125209993-125210015 CCTTGCTTCACCTCCAGTGATGG - Intronic
1107154128 13:37146483-37146505 CATAGCTTCACCTTGGGTCAAGG + Intergenic
1114530285 14:23391205-23391227 AATCCCTTCACCTCGGGTTATGG + Intronic
1122908927 14:104816774-104816796 GGTCGCCTCACCTGGGCTGAGGG - Intergenic
1123003888 14:105312181-105312203 GGTCCCTCCACCTAGGGTGAAGG - Exonic
1132689659 16:1176835-1176857 CGTCTCTTCACCCCAGGGGACGG + Intronic
1134380897 16:13724981-13725003 AGTCACTTCACTTAGGGTGATGG - Intergenic
1135557219 16:23447092-23447114 AGTGGCTTCAACTGGGGTGATGG - Intronic
1145859385 17:28195135-28195157 CGTGGCTGCACCTGGGGGGAGGG + Exonic
1147015658 17:37489785-37489807 CGTCCCCCCACCTCGGGAGAGGG + Intergenic
1160910182 19:1470520-1470542 CGTTGCTTGACCCCGGGCGAGGG + Exonic
1161720212 19:5898115-5898137 GGTCCCTTCACCTCCCGTGAAGG - Intronic
1162201506 19:9023984-9024006 CCTCACTTCAGCCCGGGTGACGG + Intergenic
1164942941 19:32265699-32265721 AGTCGCTTGAACTCGGGAGACGG + Intergenic
931447012 2:62335273-62335295 TGTGGCTTCCCCTCTGGTGAAGG + Intergenic
1182779495 22:32856383-32856405 GGTGGCTTCATCTGGGGTGAAGG + Intronic
1183036465 22:35144384-35144406 GGTCGCATCACCTAGGGTCAGGG - Intergenic
953401860 3:42629977-42629999 CAGAGCTTCACCTTGGGTGAAGG + Intronic
963252970 3:143119620-143119642 CGTCGCTGCGCCTCGGGGGCTGG - Exonic
976493361 4:85697839-85697861 CCTCCCTTCACCTCTGGTCAAGG - Intronic
981485486 4:145281585-145281607 CATTGCTTCTCCTCGGGTGAAGG - Intergenic
986767280 5:10939446-10939468 CCTGGCTTCACCTTGAGTGATGG - Intergenic
995379094 5:111512384-111512406 CCTTGCTTCACCTCAGGTAAAGG - Exonic
1002196579 5:177504614-177504636 CGTCGCTGCCACTCGGGTGAGGG - Exonic
1003265140 6:4559159-4559181 CTTCGTTTCATCTCTGGTGATGG - Intergenic
1004461628 6:15842073-15842095 CCTCGCTCCACCTCTGGGGAGGG - Intergenic
1004690557 6:17988708-17988730 CGTAGCATCACCTCGGTTGGAGG - Intergenic
1006183960 6:32169959-32169981 CGTCGCTTCACCTCGGGTGAGGG - Exonic
1008564133 6:52750804-52750826 AGTCGCTTCCACTTGGGTGAAGG + Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060147857 9:121267971-121267993 CCTCGCTTCACCTCGCAGGAAGG - Intronic