ID: 1006185357

View in Genome Browser
Species Human (GRCh38)
Location 6:32178551-32178573
Sequence GCCCCGCCCCGCTCGCGATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006185357_1006185361 9 Left 1006185357 6:32178551-32178573 CCAAATCGCGAGCGGGGCGGGGC 0: 2
1: 0
2: 0
3: 6
4: 48
Right 1006185361 6:32178583-32178605 CTTCGAATGTAATATATGTTTGG 0: 2
1: 0
2: 1
3: 7
4: 152
1006185357_1006185363 21 Left 1006185357 6:32178551-32178573 CCAAATCGCGAGCGGGGCGGGGC 0: 2
1: 0
2: 0
3: 6
4: 48
Right 1006185363 6:32178595-32178617 TATATGTTTGGAGACTGCTCGGG 0: 2
1: 0
2: 0
3: 5
4: 142
1006185357_1006185362 20 Left 1006185357 6:32178551-32178573 CCAAATCGCGAGCGGGGCGGGGC 0: 2
1: 0
2: 0
3: 6
4: 48
Right 1006185362 6:32178594-32178616 ATATATGTTTGGAGACTGCTCGG 0: 2
1: 0
2: 0
3: 16
4: 177
1006185357_1006185364 30 Left 1006185357 6:32178551-32178573 CCAAATCGCGAGCGGGGCGGGGC 0: 2
1: 0
2: 0
3: 6
4: 48
Right 1006185364 6:32178604-32178626 GGAGACTGCTCGGGAAGCTGTGG 0: 2
1: 1
2: 5
3: 38
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006185357 Original CRISPR GCCCCGCCCCGCTCGCGATT TGG (reversed) Exonic