ID: 1006187325

View in Genome Browser
Species Human (GRCh38)
Location 6:32188860-32188882
Sequence CTGAGAACAAGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1151
Summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 1036}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006187325 Original CRISPR CTGAGAACAAGGAGGGAGGA GGG Intronic
900358204 1:2274865-2274887 CTGAGAGCAAGAAGCCAGGAGGG - Intronic
900932791 1:5747507-5747529 CTGACAGCAGGAAGGGAGGAAGG + Intergenic
901017081 1:6238041-6238063 ATGAGATCAAGGAGGGAGTGAGG + Intergenic
901312025 1:8276699-8276721 CTGAGAACCAGGAGGGCGGGTGG - Intergenic
901406713 1:9052776-9052798 CAGAGGCCAAGGTGGGAGGATGG + Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901560328 1:10065236-10065258 ATGGGAACTAGGAGGAAGGAAGG + Intronic
901632934 1:10656729-10656751 CCGAGAACCTGGAGGGAGGAGGG + Exonic
901659755 1:10791347-10791369 CTGGGAAAAAGAAGGGAGGTGGG + Intronic
901737541 1:11321994-11322016 CTCAGCAGAAGGATGGAGGATGG - Intergenic
901746119 1:11374853-11374875 GGGAGGACAAGGAGGGAGCAGGG + Intergenic
901764846 1:11493191-11493213 CTGAGAACCAGGAGGGCCAATGG + Intronic
901836379 1:11926383-11926405 CCGAGAAGAAGGAGGAAGCAGGG - Exonic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901946849 1:12711214-12711236 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
902606295 1:17571178-17571200 CTGCCAACCTGGAGGGAGGAAGG + Intronic
902689464 1:18101221-18101243 GGGAGAAGAAGGAGGGAGGGAGG - Intergenic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903190030 1:21651216-21651238 CTGAGAGCCAGGATGCAGGAAGG + Intronic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903340690 1:22652566-22652588 CTGAGAACAGGGAAAGAGCAGGG + Intergenic
904655572 1:32043750-32043772 CCGAGAACAAAATGGGAGGACGG - Exonic
904911355 1:33936674-33936696 CTGGCAATAAGGAGGGAGGGAGG + Intronic
904935659 1:34127966-34127988 CTGAGAAGAGGGTGGGACGATGG - Intronic
905513584 1:38543887-38543909 CTGAGAACCAGGAGAGCTGACGG - Intergenic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905658993 1:39706224-39706246 CTGAAAAAAAGAAGGAAGGAAGG - Intronic
905734327 1:40315554-40315576 CTGAGACCAGGGCGGGAGGGAGG - Intronic
906418117 1:45638698-45638720 GTGAGGTCAAGGTGGGAGGATGG + Intronic
906672149 1:47664209-47664231 CTGAGAAGAAGCAGGGAGGATGG + Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906735975 1:48128574-48128596 CTGAGAAATTGGAGGGAGCAAGG + Intergenic
907524186 1:55044504-55044526 GTGACATCCAGGAGGGAGGAGGG - Intronic
907630760 1:56079646-56079668 CTTAAAATAAGGAGTGAGGAGGG - Intergenic
907653857 1:56322364-56322386 CTGAGAACTAGGAGAGTGAATGG + Intergenic
908734173 1:67258358-67258380 ATGAGAAAATGGAGGGAGAAAGG + Intronic
908921740 1:69202715-69202737 ATAAAAACAAGGAGGAAGGAAGG + Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
909882581 1:80898719-80898741 ATGAGAAAAAGGAAAGAGGAGGG - Intergenic
910011352 1:82467165-82467187 GAGAGAAAAAGGAGGGAGCAGGG - Intergenic
910021791 1:82599669-82599691 ATGAGGACAAGAAGGAAGGAAGG - Intergenic
910240319 1:85079517-85079539 TTGAGAAGTTGGAGGGAGGATGG + Intronic
910410385 1:86937251-86937273 CTGGAAGGAAGGAGGGAGGAAGG - Intronic
910552174 1:88487789-88487811 CAATGAAGAAGGAGGGAGGAAGG + Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911170609 1:94767413-94767435 TGGAAAAAAAGGAGGGAGGAGGG - Intergenic
911290246 1:96048822-96048844 TTGAGAACAAGGAGGGCTGTTGG + Intergenic
911496323 1:98636210-98636232 CTGAGAGTAAGAAGGGAGGCTGG + Intergenic
911514114 1:98846248-98846270 GGGAGTGCAAGGAGGGAGGAGGG - Intergenic
912185916 1:107275533-107275555 CTGAGAACCAGGAGAGCTGATGG + Intronic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912555550 1:110513641-110513663 CAGAGAAAAAGGAGAGAGGCGGG - Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
914044889 1:144083105-144083127 CTTACAATAGGGAGGGAGGAAGG - Intergenic
914133221 1:144877581-144877603 CTTACAATAGGGAGGGAGGAAGG + Intergenic
914224295 1:145707592-145707614 CAGAGAACAAGGAGGGGAGAGGG + Intronic
914345717 1:146796901-146796923 TTGAGAATAAGGCGGGAGGCGGG - Intergenic
914506184 1:148291092-148291114 CTGAGAACCAGGAGAGATGATGG + Intergenic
914777627 1:150752598-150752620 TGGAGAGCAAGGTGGGAGGAGGG - Intronic
915222025 1:154382550-154382572 GGGAGTACAAGGGGGGAGGATGG - Intergenic
915583492 1:156830433-156830455 CTGGGCACAAGGGTGGAGGAGGG - Intronic
915725501 1:158014208-158014230 GAGAGAAAAAGGAGGGAGGAGGG + Intronic
915923953 1:160002000-160002022 CTGAGAACCAGGAGAGCCGATGG - Intergenic
916265788 1:162888626-162888648 GGGAGGACAAGGAGGGAGGCAGG + Intergenic
916702183 1:167308537-167308559 GTGAGACCAGGGAAGGAGGAAGG - Intronic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
917231689 1:172844750-172844772 GAGAGAAGAGGGAGGGAGGAAGG + Intergenic
917312099 1:173689205-173689227 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
917962917 1:180158577-180158599 CTGTCAGCAAGGAGGAAGGAAGG + Intronic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918743216 1:188163600-188163622 CTCAGGACAAGGATGGAGTATGG - Intergenic
918989043 1:191674236-191674258 ATTAGAGCAGGGAGGGAGGAAGG - Intergenic
919338973 1:196279001-196279023 CTGAGAACCAGGAAGCAGGTCGG + Intronic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
920079842 1:203364847-203364869 CTTTGAACAAGAAGGGAGGGAGG - Intergenic
921132501 1:212231972-212231994 CCCAGAGCAAGGAGGGAGGCAGG - Intergenic
921397927 1:214688694-214688716 CTGAGAACCAGGAGAGTTGATGG + Intergenic
922191536 1:223323174-223323196 GTGACAAAAAGGAAGGAGGAAGG + Intronic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922894585 1:229090206-229090228 CAGACACCAAGGAGGAAGGAGGG - Intergenic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923073995 1:230592825-230592847 CTGAGAACCAGGAGAGCTGAGGG + Intergenic
923094227 1:230761832-230761854 CTGGGAACAGGAAGGGAGGTTGG - Intronic
923449927 1:234106920-234106942 ATGACAAGAAGGATGGAGGATGG - Intronic
923523764 1:234756873-234756895 GTGAGACCAAGGAGAGGGGAAGG + Intergenic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
923869306 1:237973694-237973716 CAAAGAACAAGGAGAAAGGAAGG - Intergenic
924058352 1:240145357-240145379 CGGAGATGGAGGAGGGAGGATGG - Intronic
924196009 1:241607534-241607556 CAGAGAGCAAGAAGGAAGGAAGG + Intronic
924451512 1:244182921-244182943 CTGAGAAATAGGAGTGAGGATGG + Intergenic
924519500 1:244794088-244794110 TTGGGAAGAAGGAGGGAAGAGGG - Intergenic
924703801 1:246481504-246481526 CTGAGAACCAGGAGGATTGATGG - Intronic
924937864 1:248787526-248787548 CTGACATCAATGAGGCAGGAGGG - Intergenic
1062931731 10:1357340-1357362 CTGAGAAAAATGAGGGAGGTTGG + Intronic
1063243418 10:4194139-4194161 GGGAGGCCAAGGAGGGAGGACGG - Intergenic
1063926089 10:10979140-10979162 CCAAGAACAAGGAAAGAGGAAGG + Intergenic
1064011181 10:11737784-11737806 GTGAGCAGAGGGAGGGAGGATGG - Intergenic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1064241940 10:13638601-13638623 CTGAGAACCAGGAGAGCTGATGG + Intronic
1064369801 10:14741367-14741389 CTGAGAGCAAGAAGAGAGGAGGG + Intronic
1064371108 10:14752184-14752206 CTGAGCACAAACAGGAAGGATGG - Intronic
1064382518 10:14859101-14859123 CTGAAAACAAGGGGGAAGAAGGG - Intronic
1064453506 10:15465443-15465465 CTGGGAAGAAGCAGGGAGGCAGG - Intergenic
1064631820 10:17322265-17322287 AAGAAAAGAAGGAGGGAGGAAGG + Intronic
1064635242 10:17358596-17358618 AGGAGGAGAAGGAGGGAGGAAGG + Intronic
1065094195 10:22264476-22264498 GGGAGACCAAGGAGGGAGGATGG + Intergenic
1065603237 10:27391197-27391219 TTGAGAACTATGAGGGAGTAAGG + Intergenic
1065747730 10:28857462-28857484 GTGAGATCAAGGAGGGAAGGTGG - Intronic
1065901837 10:30214912-30214934 CCCAGAGTAAGGAGGGAGGAGGG - Intergenic
1066521657 10:36226679-36226701 AGGAGAGCAAGGAGAGAGGAGGG - Intergenic
1066538902 10:36422637-36422659 GTGAGAAGAAAGAGGGAGAAAGG - Intergenic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1066957015 10:42182787-42182809 CTTACAATAGGGAGGGAGGAAGG - Intergenic
1067071559 10:43136623-43136645 CCGAGAACATGGAGGCATGAGGG + Intergenic
1067438122 10:46292972-46292994 CTGAGATGAAGGAGGGATGACGG + Intronic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1068419985 10:56779033-56779055 CTGAAATCATGGGGGGAGGAGGG - Intergenic
1068558240 10:58482140-58482162 GTGGAAAGAAGGAGGGAGGAAGG - Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1069191761 10:65500557-65500579 ATGAGAACATGGAGACAGGAAGG + Intergenic
1069362704 10:67661276-67661298 AAGAGAAAAAGGAGGGAGGGAGG + Intronic
1069642099 10:69962732-69962754 CTGAGAGGAGGGAGGGAGGTGGG - Intronic
1069647019 10:70007783-70007805 TGGAGAACATGCAGGGAGGAGGG + Intergenic
1069774041 10:70916588-70916610 ATGGGAACATGGAGGGAGCAAGG + Intergenic
1070208555 10:74289865-74289887 TGTAGAAAAAGGAGGGAGGATGG + Intronic
1070331044 10:75417570-75417592 CTCAGAGTGAGGAGGGAGGAAGG - Intergenic
1070341084 10:75499031-75499053 CTGGGAACCTGGAGGCAGGAGGG + Intronic
1070439930 10:76433260-76433282 CAGAAAACAAGGAGACAGGATGG - Intronic
1070629444 10:78074476-78074498 CTTATAAGAAGGAGGCAGGAGGG + Intergenic
1070660177 10:78300030-78300052 CAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1070795911 10:79216146-79216168 CTGAAAGCAAGAGGGGAGGAGGG - Intronic
1071132740 10:82414279-82414301 CTGAGAAGAGGGAGAGAGAAAGG + Intronic
1071568847 10:86685528-86685550 AGGAGAGCAAGGAGTGAGGAGGG - Intronic
1071583974 10:86801378-86801400 CAGAGACCAAGGTGGGTGGATGG - Intronic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1071810255 10:89172115-89172137 CTGAGAACATGGAAGGATCATGG - Intergenic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072682990 10:97520227-97520249 CTGAGACAAAGCAGGTAGGATGG - Intronic
1072797194 10:98365113-98365135 AAGAGAAAAAGGAGGGAGAAGGG + Intergenic
1073108334 10:101046216-101046238 CAGAGGCCAAGGTGGGAGGATGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073583316 10:104686687-104686709 TTGATGACAAGGAGGGAAGAGGG - Intronic
1073610096 10:104934691-104934713 CTGAGCATAAGGAGGCAGGCTGG - Intronic
1073790467 10:106934906-106934928 CTCAGAAAAGGGAGGGCGGAAGG + Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074869330 10:117564693-117564715 TGGAGAGAAAGGAGGGAGGAGGG + Intergenic
1075001030 10:118798029-118798051 TTGAGCACAGGGTGGGAGGAGGG - Intergenic
1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG + Intronic
1075514407 10:123097695-123097717 ATGGGAACAAGGAGGAAGTAAGG + Intergenic
1076201206 10:128559678-128559700 CTGAGAACAACTGGGGAGGACGG - Intergenic
1076680316 10:132168313-132168335 GTGAGAACCAAGAGAGAGGAGGG - Exonic
1076729040 10:132429283-132429305 CAGACATCAGGGAGGGAGGATGG - Intergenic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1077372677 11:2190827-2190849 CTTTTAACAAGGAGGAAGGAAGG + Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077555298 11:3223061-3223083 CTGAGATCAAGGTGGCAGCAGGG - Intergenic
1077555566 11:3224440-3224462 CTGGGAGGAAGGAGGGAGGGAGG - Intergenic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1077895706 11:6451628-6451650 GTGAGAACATGAAGGGATGAAGG + Intronic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1079002027 11:16765858-16765880 CTGAGAACAAGGAGAAAAGCAGG - Intergenic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080123471 11:28704044-28704066 CTGGAAAAAAGGAGGAAGGAAGG - Intergenic
1080257672 11:30309456-30309478 CTGAGAAAAAGAAAGAAGGAAGG - Intergenic
1080321971 11:31020674-31020696 GGGAGGCCAAGGAGGGAGGATGG - Intronic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1080822234 11:35818625-35818647 AAGAGAACCAGGAGGGAGGGAGG - Intergenic
1081428975 11:42955335-42955357 CTGAGGACAAGGATGCAGAAGGG + Intergenic
1081626441 11:44658808-44658830 CTGAGCAGAGGGAGGGAGGAGGG + Intergenic
1081633720 11:44706730-44706752 CTGAGATCAAGGTGTGAGCAGGG - Intergenic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1082007977 11:47430855-47430877 CTGAGAACCAGGAGAGCCGATGG - Intergenic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082114191 11:48309941-48309963 CTGAGAACTTGGATGGAGGTGGG - Intergenic
1083243822 11:61410098-61410120 CTGAAAAAAGGTAGGGAGGAGGG - Intronic
1083320910 11:61845895-61845917 CTGACAACAAGGAGGCAGTGAGG - Intronic
1083336499 11:61924762-61924784 CTCAGACGAAGAAGGGAGGAAGG + Intergenic
1083896761 11:65624010-65624032 CTGAGACCAGGTGGGGAGGAGGG + Intronic
1083975829 11:66119101-66119123 CAGAGGACAAGCAGGGAGTAGGG - Intronic
1084214421 11:67639820-67639842 GGGAGGACAAGGAGGGAGGAAGG - Intergenic
1084324016 11:68388663-68388685 CTGAGCACCTAGAGGGAGGAAGG - Intronic
1084601616 11:70149117-70149139 CCGAGAGCAATGGGGGAGGATGG + Intronic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084724767 11:70934366-70934388 CTGAGAAGCAGGAGGGAGGCCGG - Intronic
1084951389 11:72667924-72667946 CTGAGAAGAAGCATGGAGGAGGG + Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085197613 11:74682030-74682052 AGGAGAACAAGGCGGGAGGGAGG - Intergenic
1085278087 11:75312693-75312715 CTGACAAGAGGGAGGCAGGAGGG + Intronic
1085665633 11:78413575-78413597 CTGAGAAGAAGGTGGGAGAAAGG + Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1085854564 11:80161634-80161656 CTCACCACAGGGAGGGAGGAGGG - Intergenic
1086073622 11:82826121-82826143 CTGAGAGCAAGGCAGGAAGATGG - Intronic
1086472084 11:87124792-87124814 AGGGGAAAAAGGAGGGAGGAAGG - Intronic
1087076458 11:94130572-94130594 CTGGGAAGAAGGTGAGAGGATGG + Intronic
1087096197 11:94320911-94320933 CTGAGAACATGGTGAGATGATGG + Intergenic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087969767 11:104465288-104465310 CAGAAAATTAGGAGGGAGGAGGG - Intergenic
1088269833 11:108022675-108022697 CCCAGACCAAGGAGGGAGGGTGG - Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088416159 11:109591199-109591221 CTAAGAAGAAGAGGGGAGGATGG - Intergenic
1088547834 11:110979493-110979515 CTGTGAGCAAGAAAGGAGGAAGG - Intergenic
1089048613 11:115526238-115526260 CTGAGCACCAGCAGGGAAGAGGG - Intergenic
1089126203 11:116178226-116178248 CTGAGAACTAGGAGGGCTGATGG - Intergenic
1089169020 11:116499745-116499767 GTGCGCACAGGGAGGGAGGATGG - Intergenic
1089489731 11:118874956-118874978 GTGAGGCCAAGGTGGGAGGATGG + Intergenic
1089558844 11:119333236-119333258 CTGAGAGCAGGGAGAGAGAAAGG + Intergenic
1089778591 11:120856989-120857011 CTGGGAACATGGAGGGATAAGGG - Intronic
1090022674 11:123141524-123141546 CACAGCACAAGGAAGGAGGAAGG - Intronic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090399693 11:126441143-126441165 CTGAGACACAGGTGGGAGGAGGG - Intronic
1090641653 11:128734480-128734502 CTGAAACCACGGTGGGAGGAAGG + Intronic
1090776218 11:129968423-129968445 CTGAGGACAAAAACGGAGGAGGG + Intronic
1090911066 11:131120090-131120112 CTGATAACAAAAAGGTAGGAAGG - Intergenic
1091366096 11:135021977-135021999 TAGTGAACAAGGAGGGAGGCAGG + Intergenic
1091755867 12:3051153-3051175 CTGAAAGGAAGGAAGGAGGAAGG - Intergenic
1091791341 12:3273858-3273880 CTGAGATCGGGGAGGGAGCAAGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092941379 12:13410373-13410395 CAGAGACAAAGGAGGGAGGTGGG + Intergenic
1093111791 12:15161467-15161489 ATGGGAAGAAGGAGGAAGGAAGG - Intronic
1093166625 12:15811414-15811436 CTGGGAGCTAGGAGTGAGGAAGG - Intronic
1093790650 12:23245560-23245582 GTGAGAAATAGGAGGGAGAAAGG - Intergenic
1093850712 12:24034346-24034368 CTGAGAGGCAGGAGAGAGGAGGG - Intergenic
1094196194 12:27752215-27752237 CTGAGATGAATGAAGGAGGAGGG + Intronic
1094483298 12:30902371-30902393 TTGAGAAAAAGAAGAGAGGAAGG + Intergenic
1095111778 12:38302817-38302839 CTTAGAAAATGGAGGAAGGAAGG - Intergenic
1095385527 12:41645723-41645745 GAGAGAAGAGGGAGGGAGGAAGG + Intergenic
1095729181 12:45487553-45487575 CTGAGAACTTGGAGGGTTGATGG + Intergenic
1095921092 12:47532317-47532339 CTGTGAACCAGGTGGGTGGATGG + Intergenic
1096087198 12:48873686-48873708 CTAAGAATGAGGAGGGAGGCTGG + Intergenic
1096575982 12:52553097-52553119 CTCAGATGCAGGAGGGAGGAAGG + Exonic
1096799844 12:54103034-54103056 AAGAGACCAAGGCGGGAGGATGG - Intergenic
1097015365 12:55982436-55982458 CTGTGAACAGGGAGGAAGGCAGG + Intronic
1097119657 12:56721377-56721399 AGGAGAGCAAGGAGGGGGGAGGG + Exonic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1097342008 12:58449543-58449565 CTGAGAATAAGCAGGGATAAGGG + Intergenic
1098160655 12:67645983-67646005 CAGATAACAAGGAGGTAGGCAGG - Intergenic
1098460799 12:70731050-70731072 CAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098785973 12:74756290-74756312 CAGAGAAAAGGGTGGGAGGAGGG - Intergenic
1099202385 12:79691017-79691039 GGGAGAAGAAGGAGGGAGGGAGG + Exonic
1100317358 12:93457153-93457175 AGGAGAATAAGGTGGGAGGATGG + Intergenic
1100327008 12:93549492-93549514 GGGAGACCAAGTAGGGAGGATGG + Intergenic
1100403499 12:94252324-94252346 GGGAGGCCAAGGAGGGAGGACGG + Intronic
1100550726 12:95644329-95644351 AGGAGAAGAAGGAGGAAGGAAGG - Intergenic
1100908866 12:99335480-99335502 CTGGGAACCAGGTGGGAGCAGGG - Intronic
1101252801 12:102951787-102951809 ATGAGAAGAAGGAGGGGGAAGGG - Intronic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1101693559 12:107103401-107103423 CTGAGGGCAATGAGGGAGGGAGG - Intergenic
1101708526 12:107243314-107243336 TTGAGGACAAGGAGGCAGGAAGG + Intergenic
1101714629 12:107299983-107300005 ATGAGAACAAGGAGGAAGAGAGG + Intergenic
1101821228 12:108185714-108185736 CAGAGAACAGGGAGGAAGGCAGG - Intronic
1101825085 12:108213923-108213945 CTGGAAACAAGGTGGAAGGAGGG - Intronic
1102486418 12:113260753-113260775 CTGAGAAGAGGGAGGGTGGCAGG - Intronic
1102544570 12:113645482-113645504 CTGAATTCAAGAAGGGAGGAAGG + Intergenic
1103027713 12:117587309-117587331 CTTATAAGATGGAGGGAGGAGGG + Intronic
1103041354 12:117698130-117698152 CTGAAATCAAGGTGGGAGCAGGG - Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103220508 12:119240463-119240485 CTGAGAACCAGGAGGGCTGATGG - Intergenic
1103437900 12:120941122-120941144 GGGAGACCAAGGCGGGAGGATGG + Intergenic
1103597788 12:122034784-122034806 CCGGGAGAAAGGAGGGAGGATGG - Intronic
1104074528 12:125377416-125377438 TTGAGAACAAAGAGTGAGGTTGG + Intronic
1104202800 12:126608265-126608287 ATGAAAAGAAGGAGGGAGCATGG + Intergenic
1104531779 12:129578729-129578751 CTGAGAACCAAGAGTGATGAGGG + Intronic
1104557133 12:129811298-129811320 GGTAGAACAAGGAGGGAGGCAGG - Intronic
1104597991 12:130132961-130132983 CTTAGAAGAGGGAGGCAGGAGGG + Intergenic
1104704958 12:130937019-130937041 CTGAGAACCAGGAGAGACAATGG + Intergenic
1104733690 12:131122951-131122973 CTGACAACAAGGAGTGGGGTAGG - Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104911990 12:132244173-132244195 AAGAGCACAAGGTGGGAGGAGGG + Intronic
1105589642 13:21779465-21779487 CTGAGAAGAAGGAGAGAGATTGG - Intergenic
1105881944 13:24613342-24613364 TTGAGAACATGGCGGGAGGCTGG - Intergenic
1106125791 13:26899042-26899064 CTGAGACTAAGGATGGAGCATGG + Intergenic
1106323905 13:28669668-28669690 CTGAGAACAAGGATTCAGAAAGG - Intronic
1106682088 13:32018412-32018434 CTGAGAACGAGATGGGAGGAGGG + Intergenic
1107409283 13:40143556-40143578 GTGAGAAAAAGGAGGGAGAACGG + Intergenic
1107710688 13:43147532-43147554 GGGAGGCCAAGGAGGGAGGACGG + Intergenic
1107853885 13:44595942-44595964 CTGAGGACAAGGAGAGTGGCAGG + Intergenic
1107940457 13:45377490-45377512 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107940595 13:45377886-45377908 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941070 13:45380116-45380138 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941184 13:45380429-45380451 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941572 13:45381812-45381834 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941714 13:45382208-45382230 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107996251 13:45864158-45864180 CTGGCAACAAGGAGGGTGGTGGG + Intergenic
1108053045 13:46464221-46464243 CTGAGAGCCAGGGGGGAAGAGGG - Intergenic
1108267439 13:48726361-48726383 CTGAGAACCAGGAGAAATGATGG - Intergenic
1108507177 13:51122944-51122966 CTGAAAACAATGGGGGAGAAAGG + Intergenic
1108543538 13:51467573-51467595 CTGAGAACCAGGAGAGCAGATGG - Intergenic
1108687613 13:52834527-52834549 CTGAGAACGAAGTGGGAGTAGGG + Intergenic
1108959884 13:56213489-56213511 CTGAGAAAAAGGAGAGTTGATGG - Intergenic
1109214489 13:59572427-59572449 CAGAGACTAAGGAGGGAGGGTGG + Intergenic
1109679607 13:65733009-65733031 CTGAAAACAAGGAAGCAGGGAGG + Intergenic
1109707202 13:66111950-66111972 GTGACAACAAGGAGGGTAGATGG - Intergenic
1110473356 13:75885538-75885560 CAGAGGCCAAGGAGGGTGGACGG - Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1111622848 13:90746712-90746734 AGGAGAAGGAGGAGGGAGGAGGG - Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1113222776 13:108124244-108124266 CTGACAAAGAGGAGGGAAGATGG - Intergenic
1113303874 13:109054961-109054983 AGGAGGAAAAGGAGGGAGGAAGG - Intronic
1113536886 13:111075206-111075228 GTGAGGACAAGGCAGGAGGATGG - Intergenic
1113644091 13:111980121-111980143 CTGAGAACAGGGACAGAGAAGGG + Intergenic
1113664572 13:112132265-112132287 TTAAAAACAAGGAAGGAGGAGGG - Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1113713069 13:112483620-112483642 CTGAGAAGAGGGAGAGAGGCTGG + Intergenic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1113840359 13:113355834-113355856 CTGAGTACAAGGAGGCCGGCTGG + Intronic
1113974473 13:114216249-114216271 CTGAAAACAAGCCGGGAGGAGGG - Intergenic
1114042988 14:18695986-18696008 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1114047279 14:18886426-18886448 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1114116936 14:19632971-19632993 CTGAGAAGAAGGAGCGAGCTGGG - Intergenic
1115060812 14:29187624-29187646 CTGATAACAATGAAGTAGGAAGG + Intergenic
1115465699 14:33711998-33712020 CTGAGAACAAACGGAGAGGAAGG - Intronic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1116371373 14:44137482-44137504 CTGAGAACTAGGAGAGTTGATGG + Intergenic
1116416874 14:44688627-44688649 CTGAAAAAATGGAGGGAGTATGG + Intergenic
1116707432 14:48319915-48319937 CTGAGAACAAGGAGAACTGATGG + Intergenic
1116995159 14:51315811-51315833 CAGAGGACAAGGTTGGAGGAAGG - Intergenic
1117339429 14:54780958-54780980 CTAAGAAGAAAGGGGGAGGATGG - Intronic
1117349646 14:54868976-54868998 GGGAGACCAAGGTGGGAGGATGG - Intronic
1117433874 14:55698031-55698053 CTGAGAACCAGGAGAGCTGATGG + Intronic
1117803515 14:59467485-59467507 CTGAGAAAGATGAGGAAGGAAGG - Intronic
1118042358 14:61930930-61930952 CTAAGAGCAAGGTGTGAGGAGGG - Intergenic
1118187452 14:63550336-63550358 GGGAGACCAAGGAGGGAGGATGG + Intergenic
1118331927 14:64821935-64821957 CTGAGTACAGGGAGGGAGTGGGG + Intronic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118482343 14:66179835-66179857 GTGAGTACAAAGAGGGAAGATGG - Intergenic
1118738929 14:68724182-68724204 TTGACAACCAGGAGGGAGGATGG - Intronic
1118758526 14:68863326-68863348 CTGGGAAGAAGCAGGGGGGAAGG + Intergenic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1119071103 14:71585136-71585158 ATGAGAAAAGGGAGGGAGGGAGG + Intronic
1119084790 14:71729982-71730004 CTGAGACCAAGGTTGGGGGAGGG - Intronic
1119487476 14:75000344-75000366 GGGAGGACAAGGTGGGAGGATGG - Intergenic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119571323 14:75676015-75676037 CTGAGAACCAGGAGTGTCGAGGG + Intronic
1120015980 14:79473883-79473905 CGGAGAAGAAGGTGGGAGAAGGG + Intronic
1120451886 14:84678949-84678971 CAGAGAGCAAGGATGGAGGGAGG - Intergenic
1120706588 14:87752233-87752255 CTGAGAACAGGGAGAGCTGATGG + Intergenic
1120780504 14:88481835-88481857 CTGATATCAAGGGGTGAGGAGGG - Intronic
1120970804 14:90205358-90205380 ATGAGAAAAAGCAGGGAGGTGGG + Intergenic
1121001369 14:90454152-90454174 CTGGTACCCAGGAGGGAGGAGGG - Intergenic
1121045767 14:90786342-90786364 GTGAGAACAAAGTGGGAGCAAGG + Intronic
1121208015 14:92185683-92185705 GTGAGAAAAAGAAGGGAGGGAGG + Intergenic
1121892210 14:97604837-97604859 CTGAGAAACAGGAGGTAGCAGGG + Intergenic
1121902447 14:97706332-97706354 CTGGGAAAAAGCAGGGAGGCTGG + Intergenic
1123181891 14:106479231-106479253 GTGAGAGAAAAGAGGGAGGAAGG - Intergenic
1202936096 14_KI270725v1_random:88989-89011 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1202945014 14_KI270726v1_random:17498-17520 GTGAGAGAAAAGAGGGAGGAAGG + Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123983757 15:25625912-25625934 CTGAAGACAAGGAGGGTGGCTGG + Intergenic
1123994542 15:25709551-25709573 CCGAGCCCAGGGAGGGAGGATGG + Intronic
1124024181 15:25949320-25949342 CTGAGAACCAGGAGAGCTGATGG - Intergenic
1124064623 15:26330080-26330102 CTGAGAACCAGGGGAGCGGATGG + Intergenic
1124322403 15:28725070-28725092 CTGAGAACCAGGAGAGCTGATGG + Intronic
1124346386 15:28924167-28924189 TTGAGAACAAGGAGGGGAGAGGG - Intronic
1124657656 15:31522332-31522354 CTGAGAACCAGGAGTGCTGAGGG - Intronic
1124810066 15:32927496-32927518 GGGAGACCAAGGTGGGAGGATGG - Intronic
1125685088 15:41559203-41559225 CCGCGAGCGAGGAGGGAGGAGGG - Exonic
1125724795 15:41862717-41862739 CTGGGCACAAGTGGGGAGGAGGG - Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1126506657 15:49412714-49412736 ATTAGAAAAATGAGGGAGGATGG + Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126789586 15:52209009-52209031 CAGAGGACGAGGAGAGAGGATGG + Intronic
1126905121 15:53356657-53356679 CTGAGAACCAGGAGTGCTGAGGG - Intergenic
1126919953 15:53510162-53510184 CTGAAAAAAAGAAGGAAGGAAGG - Intergenic
1127368106 15:58310138-58310160 CTGAGAACAAGGTGCCAGCAGGG - Intronic
1127449524 15:59103270-59103292 CTCAGAAGAGGGAGGGTGGAAGG - Intergenic
1127488108 15:59437955-59437977 GTGGGAACGAGGAGGGAGGAGGG + Intronic
1127733319 15:61819699-61819721 CTGAGAGGAAGGATGGAGAAGGG - Intergenic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128502959 15:68241605-68241627 GAGAGACCAAGGAGGGAGGTGGG + Intronic
1129091251 15:73153087-73153109 CTGAGAACCAGGAGTGCTGAGGG + Intronic
1129264424 15:74386303-74386325 AGGGCAACAAGGAGGGAGGAAGG + Intergenic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1129835988 15:78706041-78706063 CTGAGAAGAAGATGGAAGGAAGG + Intronic
1129916956 15:79282688-79282710 CTGCGAGGAAGGAGGAAGGAGGG - Intergenic
1130541187 15:84821853-84821875 TTGAGCAGTAGGAGGGAGGAAGG + Intronic
1131846584 15:96495352-96495374 CAGAGAAGGAGGAGGGTGGAAGG + Intergenic
1132456818 16:28710-28732 ATGAGGACAAGGAGGAACGAGGG + Intergenic
1133396708 16:5453125-5453147 GTGAGAAAAAGGAGGAAGGTAGG - Intergenic
1133487444 16:6233790-6233812 CAGAGAACATGGAGGACGGATGG - Intronic
1133634300 16:7651429-7651451 CTGCGACCAAGGAGGTTGGACGG - Intronic
1133662551 16:7933286-7933308 CGGAGTCCAAGCAGGGAGGAGGG - Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133816043 16:9198324-9198346 GGGAGACCAAGGAGGGAGGATGG - Intergenic
1134333555 16:13272465-13272487 CTGAGGTCGAGGTGGGAGGATGG - Intergenic
1134501898 16:14775872-14775894 CAGAGGCCAAGGAGGGTGGATGG - Intronic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134578663 16:15353022-15353044 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1134723925 16:16404523-16404545 CAGAGGCCAAGGAGGGTGGATGG - Intergenic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134823177 16:17263129-17263151 CTGATAACAAGGAAAGAGAAGGG - Intronic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134943505 16:18307347-18307369 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1135122729 16:19780408-19780430 GAGAGGCCAAGGAGGGAGGATGG - Intronic
1135572888 16:23562899-23562921 CTGAAAACAATGAGGGAAAACGG - Intronic
1135591858 16:23710874-23710896 ATGGGCCCAAGGAGGGAGGAGGG + Intronic
1135948587 16:26889837-26889859 CTCAGAAAGAGGAGGGTGGAAGG - Intergenic
1136173509 16:28502509-28502531 CTGGGCACATGGAGGAAGGATGG - Intronic
1136249867 16:28997358-28997380 TGGAGGACAAGGTGGGAGGATGG + Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137567281 16:49541135-49541157 CCTAGAACAGGTAGGGAGGAAGG + Intronic
1138103639 16:54274801-54274823 GGGAGACCAAGGAGGGAGGCAGG - Intergenic
1138636976 16:58347770-58347792 GGGAGAACAAGGAGGCAGGAGGG + Intronic
1138723317 16:59107822-59107844 ATGATCACAAGGAGGGAGAATGG + Intergenic
1138984603 16:62313164-62313186 CTATGAACGAGGTGGGAGGAAGG - Intergenic
1139168091 16:64594903-64594925 CTGAAAACAAGGAGGGTTGGTGG - Intergenic
1139294550 16:65888845-65888867 GAGAGAACAGGGAGTGAGGATGG + Intergenic
1139339465 16:66258609-66258631 CTTAGAAGAAGAAGGCAGGAAGG + Intergenic
1139988269 16:70918366-70918388 TTGAGAATAAGGCGGGAGGCGGG + Exonic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140114220 16:72027532-72027554 CTGGGACCAAGGATGGTGGAAGG + Intronic
1141137332 16:81474768-81474790 CTGGCACCAAGGAGGCAGGAAGG - Intronic
1141263675 16:82476238-82476260 AGGAGGAGAAGGAGGGAGGAGGG - Intergenic
1141269194 16:82523379-82523401 CTTATAAAAGGGAGGGAGGAGGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141920579 16:87132991-87133013 CTGGGACCAAGGAGGGAGAAGGG - Intronic
1141988375 16:87594569-87594591 GTGACAACAGGGAGGCAGGAGGG + Intergenic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142028047 16:87824868-87824890 GAGAGAACAGGGAGGGAAGAGGG - Intergenic
1142290962 16:89193387-89193409 CTGCGAAGGAGGTGGGAGGAGGG - Intronic
1142660570 17:1426300-1426322 CTGAGCACAAGTGTGGAGGAAGG + Intronic
1142734193 17:1884497-1884519 CTTAGATCAAGATGGGAGGAGGG - Intronic
1143462624 17:7114008-7114030 CTGTGAACAGGGACTGAGGAGGG - Intronic
1143623793 17:8096530-8096552 CTGAGAACAGGGAGGATGGAAGG + Exonic
1144082113 17:11772921-11772943 CTGTGAACAAGGCAAGAGGAAGG - Intronic
1144198817 17:12920646-12920668 GTGAGAGCCAGGAGGTAGGATGG + Intronic
1144442164 17:15293275-15293297 CTGAGAAGATGGAAGAAGGAAGG - Intergenic
1145242372 17:21247530-21247552 CCGAGGCCCAGGAGGGAGGAAGG + Intronic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1146299418 17:31676608-31676630 ATGGGAGGAAGGAGGGAGGAGGG + Intergenic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1146475272 17:33157669-33157691 CTCAGACCAAGGTGGGAGCAGGG - Intronic
1146556594 17:33830337-33830359 TTGACAAAAAGGAGGGAGAAAGG - Intronic
1146769229 17:35553335-35553357 CTGAGAACAAGGATGTATCAGGG + Exonic
1146922275 17:36721631-36721653 CTGAAAACAGGCAGGGAGGCAGG + Intergenic
1146954736 17:36930953-36930975 GAGAGAAAAAGGAGGGAGGAAGG - Intergenic
1147159029 17:38560017-38560039 GAGAGAACAAGGATGGGGGAGGG + Intronic
1148113674 17:45162169-45162191 CTGAGAGGAAGGAGGGAGGCAGG + Intronic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148482617 17:47970079-47970101 CTGGGGACAAGGAGGCTGGAAGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148867814 17:50638167-50638189 CTCAGAACAAGGGAGGAGGTGGG + Intronic
1149580622 17:57748119-57748141 CTCAGAACCAGAGGGGAGGACGG + Intergenic
1149604680 17:57916385-57916407 CTGGGATCAAAGTGGGAGGAGGG - Intronic
1150140330 17:62723087-62723109 CTGAGAACAGTGAGGGAGCGAGG + Intronic
1150203738 17:63384309-63384331 GGGAGGCCAAGGAGGGAGGACGG - Intronic
1150206841 17:63415442-63415464 CTGAGAAGAAGAAGGGAGTGGGG + Intronic
1150209979 17:63436521-63436543 CTGACAAGAAGGTGGGTGGAGGG - Intronic
1150239641 17:63621834-63621856 CCGAGAACCCGGAGGGCGGAAGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1151344098 17:73491180-73491202 CTGAGAGCAAGGACAGATGAAGG - Intronic
1151425358 17:74027710-74027732 CTGAGATGAGGGAGGAAGGAGGG + Intergenic
1152005122 17:77675814-77675836 CTCAGATGGAGGAGGGAGGAAGG - Intergenic
1152045285 17:77930975-77930997 CTGAGAACTGGGGGAGAGGAAGG + Intergenic
1152104756 17:78322571-78322593 CTGAGACCAGGGATGGAGGCAGG - Intergenic
1152174507 17:78778712-78778734 CAGAGGCCAAGGCGGGAGGATGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152960706 18:78945-78967 ATGAGGACAAGGAGGAATGAGGG + Intergenic
1153107003 18:1539141-1539163 GTTAGAACAAGAAGGTAGGAAGG + Intergenic
1153305885 18:3630360-3630382 CTGAGAACCAGGAGAGCTGATGG - Intronic
1153631520 18:7075283-7075305 CTGTGAACAAGAAAAGAGGAGGG + Intronic
1154325866 18:13389930-13389952 CTGTGAGCAAGTGGGGAGGAAGG - Intronic
1155156701 18:23163551-23163573 CTGAGAGAAAGGATGGAAGAGGG + Intronic
1155529794 18:26755248-26755270 CTGAGATCAAGGTGGCAGCAGGG - Intergenic
1155658325 18:28217887-28217909 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1155817169 18:30327190-30327212 CTGAGAACCAGGAGAGAGAGTGG - Intergenic
1156009912 18:32484900-32484922 CTGAGAAGGAGGAGGAAGAAAGG + Intergenic
1156070753 18:33204938-33204960 CAGGAAACAAGGAGGGAGAAAGG + Intronic
1156120242 18:33834292-33834314 CTGAGATCCAGGAGGTTGGAGGG - Intergenic
1156161555 18:34365153-34365175 GTCAGAATCAGGAGGGAGGAGGG + Intergenic
1156398886 18:36723134-36723156 CAGAGACCCAGGAGAGAGGAAGG - Intronic
1156620373 18:38844596-38844618 CTGAGATCAAGGTGGCAGCAAGG - Intergenic
1156921033 18:42522583-42522605 CTCAGAAGAAGGAGGCAGGAAGG + Intergenic
1157349436 18:46871433-46871455 CTCAGAACAGGGAGGGAGGGAGG + Intronic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158388405 18:57021132-57021154 CTGAGAATAAGGTGGTGGGAAGG + Intronic
1159120951 18:64169955-64169977 CTGAGAACCAGGAGAGCTGATGG + Intergenic
1159184686 18:64953661-64953683 ATGTGAACAATGAGGCAGGAGGG - Intergenic
1159268156 18:66111474-66111496 CTCAAAACAAGAAGGAAGGAGGG + Intergenic
1159653121 18:71000631-71000653 ATGAGAACAGAGAGGGAGGGAGG + Intergenic
1159705650 18:71683275-71683297 CTGAGAACAAGCAGAGACAATGG + Intergenic
1159802034 18:72913028-72913050 TTGAGAATAATGAGGGATGAAGG + Intergenic
1159896679 18:74003161-74003183 CTGAGATCAAGGTGTGAGCAGGG - Intergenic
1159958378 18:74535925-74535947 AGGAGACCAAGGTGGGAGGATGG + Intronic
1159969257 18:74628817-74628839 TGAAGGACAAGGAGGGAGGATGG - Intronic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160968197 19:1755791-1755813 CTGGGAGGGAGGAGGGAGGAGGG - Intronic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161260803 19:3336831-3336853 CACAGAGCAAGGAGGGAGCAGGG + Intergenic
1161454187 19:4361961-4361983 CTGCCACCCAGGAGGGAGGATGG + Intronic
1161495846 19:4585110-4585132 CAAAGAACAGGGAGCGAGGAAGG - Intergenic
1161498035 19:4598089-4598111 CTGAGAAGAAGGGGCGAGGCGGG + Intergenic
1161927640 19:7313034-7313056 CCGGGAACAGGGAGGAAGGAAGG - Intergenic
1162268323 19:9594356-9594378 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
1162414030 19:10523607-10523629 CTTAGAACAAGTAAGGAGCAGGG - Intergenic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162519810 19:11173221-11173243 CTGAGAAAAGGGAGGGATTAGGG - Intronic
1163159462 19:15456307-15456329 CTGAAGACAAGGTTGGAGGATGG - Intronic
1163204904 19:15795212-15795234 CAGAGAAGAAGGAAGGGGGAGGG - Intergenic
1163436524 19:17299168-17299190 GGGAGGCCAAGGAGGGAGGATGG + Intronic
1163504253 19:17695488-17695510 CAAAGAAAAAGGAGGGAGGGAGG + Intergenic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1163817317 19:19474826-19474848 CTGAGAACAACAAGTGAAGACGG - Intronic
1164092143 19:21966254-21966276 CTAAAAAGAAGGAGGAAGGATGG - Intronic
1164438676 19:28254599-28254621 CTGAGAACCAGGGGGGCCGATGG + Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1164521188 19:28981622-28981644 CTAACAGCCAGGAGGGAGGAAGG + Intergenic
1164530558 19:29045138-29045160 CTGAGAACTAGGAGAGCAGATGG - Intergenic
1164670614 19:30070151-30070173 CTGAGGCCAAGCTGGGAGGAGGG - Intergenic
1164698303 19:30263092-30263114 CCGAGAAGGAGGTGGGAGGAGGG + Intronic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1165127838 19:33613254-33613276 CTGAGGACAGGGACGGGGGACGG + Intergenic
1165240928 19:34466652-34466674 AGGAGACCAAGGTGGGAGGATGG + Intronic
1165293297 19:34906096-34906118 CAGAGAAGATGCAGGGAGGAAGG + Intergenic
1165730463 19:38141582-38141604 CTGAAACGAAGGAGGGAGGGAGG - Intronic
1165810642 19:38609792-38609814 GGGAAAACAGGGAGGGAGGATGG - Intronic
1165938603 19:39403840-39403862 CGGGGAAAAAGGGGGGAGGAGGG - Intergenic
1166000787 19:39876252-39876274 CGGAGGCCAAGGCGGGAGGATGG + Intronic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
1166474608 19:43112158-43112180 AGGAGAGCAAGGTGGGAGGACGG - Intronic
1166623130 19:44322946-44322968 CAGAGACAAAGGAGGGAGGTGGG - Intergenic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1166882786 19:45939615-45939637 CCAAGCACAGGGAGGGAGGAAGG + Exonic
1167086104 19:47310734-47310756 GGGAGACCAAGGTGGGAGGATGG - Intronic
1167100915 19:47403787-47403809 CAGAGAACAAGGAGAGAGACAGG + Intronic
1167697880 19:51025667-51025689 CTGGGAACAAGGAGGGACATGGG + Intronic
1167771971 19:51526299-51526321 CAGAGCACTAGGAGGGAGCATGG + Intronic
1167795052 19:51703555-51703577 TGGAGACCAAGGCGGGAGGATGG + Intergenic
1168011796 19:53538870-53538892 CTGAGAACAAGGGCCGCGGAGGG + Intronic
1168013831 19:53555499-53555521 CTGAGAACAAGGGCCGCGGAAGG + Intronic
1168293486 19:55368441-55368463 CTGGGGACAAGGTGGGAGGCAGG - Intronic
1168476550 19:56679841-56679863 CTGAGATCAAGGGGGAAGGGAGG + Intergenic
1168592866 19:57651624-57651646 CTGAGAGCAAGGAAGGGAGAAGG - Intergenic
1202684447 1_KI270712v1_random:36509-36531 CTTACAATAGGGAGGGAGGAAGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925141324 2:1551441-1551463 CTGAGCACACGGAGGGCGGTGGG - Intergenic
926339599 2:11894252-11894274 CTGATAAGAGGGAGGCAGGATGG - Intergenic
926429152 2:12768089-12768111 GAGAGCAAAAGGAGGGAGGAAGG + Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926799462 2:16646915-16646937 CTGAGAACCAGGAGAGCTGATGG - Intronic
927688612 2:25191189-25191211 CTGAGGACAAGGTCGGAGGTTGG + Intergenic
927692299 2:25216543-25216565 TGGAGGACGAGGAGGGAGGATGG + Intergenic
928115494 2:28542889-28542911 CTGAGTAGAAGGATGAAGGAAGG - Intronic
928309337 2:30196655-30196677 CTTAGAAGAGGGAGGCAGGAAGG + Intergenic
928858862 2:35831607-35831629 CTGAGAACAAGAAGTGTTGAGGG + Intergenic
929081885 2:38129537-38129559 CTGAGAGAAAGGGAGGAGGAAGG - Intergenic
929092095 2:38228936-38228958 GGGAGAAGAAGGAGGGAGGGAGG + Intergenic
929420881 2:41788488-41788510 CTTAGAAAAAGGAGAGAGAAGGG - Intergenic
929562212 2:42963021-42963043 TGGAGGACAGGGAGGGAGGAGGG - Intergenic
929825977 2:45310071-45310093 CTGAGAAGACTCAGGGAGGATGG - Intergenic
929910952 2:46089178-46089200 ATAAGAATGAGGAGGGAGGAAGG - Intronic
930171305 2:48254484-48254506 CTGAGAATAAGGAGGGGGAGAGG + Intergenic
930366499 2:50446350-50446372 GTGAAAAGAGGGAGGGAGGAAGG - Intronic
931314195 2:61111687-61111709 CTGAGTACAAAGGGGGACGAAGG - Intronic
931370395 2:61657360-61657382 GGGAGACCAAGGTGGGAGGATGG + Intergenic
931830587 2:66046988-66047010 CTGGGATCCAGTAGGGAGGAAGG + Intergenic
931969283 2:67567810-67567832 CTGAGAGCAAGAGGGGATGAGGG - Intergenic
932073691 2:68644351-68644373 CTGAAAAGAAGGAGGGGGGCAGG - Intronic
932612267 2:73208604-73208626 CAGAGAACCAGGTGGGAGTAGGG + Exonic
933276797 2:80292470-80292492 CTCTGAACGAGGAGGGATGAAGG + Intronic
933487423 2:82940193-82940215 CTGAGAAGAGGGAGAGAGAAAGG + Intergenic
933707671 2:85304023-85304045 CTCAGCGCAAGGAGGGAGCAGGG - Intronic
934247271 2:90318337-90318359 CTTACAATAGGGAGGGAGGAAGG + Intergenic
934262054 2:91484266-91484288 CTTACAATAGGGAGGGAGGAAGG - Intergenic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
934606599 2:95699830-95699852 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
934710305 2:96509889-96509911 GGGAGAACCAGGAGGGAGGAAGG - Intergenic
935048069 2:99499393-99499415 CCCAGAACTAAGAGGGAGGAAGG + Intergenic
935328073 2:101955894-101955916 CTGAGAACCAGGAGCATGGAGGG + Intergenic
935341674 2:102064677-102064699 CTGAGAGCAAGGAGGCAGCTAGG - Intronic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
935836620 2:107062146-107062168 ATGAGAACAAGATGGGAGGATGG - Intergenic
936540003 2:113341958-113341980 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
936580814 2:113698939-113698961 CTGAGAACCAGGAGTGGTGAGGG + Intergenic
937067627 2:119029884-119029906 ATGAGAACAGGGGGAGAGGAGGG - Intergenic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
937220428 2:120340159-120340181 ATGAGAACCAAAAGGGAGGAAGG - Intergenic
937239395 2:120450600-120450622 CTGTGAACCAGGTGGGAGGGAGG - Intergenic
937260318 2:120581443-120581465 CTGATATCAAGGGGCGAGGAAGG - Intergenic
937277202 2:120692670-120692692 CAGAGAAGAAGGAGGGGTGAGGG - Intergenic
937328706 2:121008216-121008238 CTGAGAACCAGGAGAGCTGATGG - Intergenic
937854532 2:126662883-126662905 TGGAGAGCAAGGAGGGAGCAGGG - Intronic
937873964 2:126806297-126806319 CTGAGAAAGAGGAGCCAGGAGGG - Intergenic
938220786 2:129565634-129565656 CTGGGAACAGGGAGTGTGGAGGG - Intergenic
938424658 2:131174972-131174994 CTGAGAAGAAGGAGAGAGCTGGG + Intronic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
939009774 2:136832342-136832364 CTGAGAACCAGGGGGGTGGATGG + Intronic
939879815 2:147617668-147617690 CTGAGAACAATGTTTGAGGAAGG - Intergenic
939980649 2:148776775-148776797 GTGAGGACAAAGTGGGAGGATGG + Intronic
939985445 2:148825524-148825546 CTGAGAACGAGGAGAGCTGATGG - Intergenic
940029003 2:149240794-149240816 CTGAGAACAAAGCTGTAGGAGGG - Intergenic
940088295 2:149886479-149886501 CGGAGGCCAAGGAGGGTGGATGG + Intergenic
940545350 2:155076533-155076555 CTGAAAACTAGGAGTAAGGAAGG + Intergenic
940717968 2:157249346-157249368 CTCAAAACATTGAGGGAGGAAGG - Intergenic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
941063902 2:160879228-160879250 CTGAGCTCAAGGTGGGAGAAGGG - Intergenic
941082503 2:161078189-161078211 CTGAGATCAAGGCGTGAGCAAGG + Intergenic
941455054 2:165705236-165705258 CTTAGAGAAAGGAGGGAGAATGG - Intergenic
941714956 2:168754182-168754204 ATGAGAACAAGGAAGTTGGAAGG + Intronic
941965566 2:171297090-171297112 GGGAGGACAAGGTGGGAGGATGG + Intergenic
942455587 2:176136284-176136306 CAGAGAAAGAGAAGGGAGGAAGG + Intergenic
942475963 2:176321130-176321152 CTGAAAACAAGGAAGAAGGGAGG - Intronic
943330083 2:186548703-186548725 CTGAGAACCAGGAGAGTTGATGG - Intergenic
944513493 2:200487626-200487648 GGGAGACCAAGGTGGGAGGATGG + Intergenic
944711460 2:202338502-202338524 CAAAGAAAAAGGAGGGAGGGAGG - Intergenic
945899832 2:215525227-215525249 CTTATAACAAAGAGGGAAGAGGG + Intergenic
946066882 2:216995686-216995708 CTAAGAACAGGCAGGGAGGCAGG - Intergenic
946176965 2:217928099-217928121 CTGCCAACCAGGAGGGAGGCAGG + Intronic
946700269 2:222405348-222405370 CTGAGAACCAGGAAGGCTGATGG - Intergenic
947907578 2:233776604-233776626 GTGAGACCAAGGAGGAAGAAGGG - Intronic
947989391 2:234474781-234474803 CTTAGAACAAGAAGAGGGGAGGG - Intergenic
948155416 2:235777460-235777482 CTGATAACGAGGAGGCAGGTGGG - Intronic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948660078 2:239501640-239501662 CTAAGGACAAGGAGACAGGATGG + Intergenic
948674479 2:239588940-239588962 CTGAGACTCAGGTGGGAGGAGGG - Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
948730343 2:239959611-239959633 CTTAAAACAAGGAAGGAGGCAGG + Exonic
1169055940 20:2621064-2621086 CTTATAAGAAGGAGGGAGGCCGG + Intronic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169178340 20:3539534-3539556 CTGAGCATAAGCAGGGAGGTGGG + Intronic
1169219915 20:3816168-3816190 CTGAGAACAGTGAGGCAGGAAGG - Intergenic
1169474796 20:5921625-5921647 CTGAGAACATGTTGGGTGGATGG + Intronic
1170075419 20:12413540-12413562 TTGAGAACAATGAAGGAGAATGG - Intergenic
1170142513 20:13139090-13139112 AGGAGGAGAAGGAGGGAGGATGG - Intronic
1170498303 20:16948392-16948414 CTGAGATCAAGGTGGTGGGAGGG - Intergenic
1170674840 20:18469385-18469407 CTGAGAACCAGGAGTGCTGAGGG - Intronic
1170705272 20:18738739-18738761 CTGCCAGCAGGGAGGGAGGAAGG + Intronic
1170804569 20:19618321-19618343 CTGAGATCAAGGTGTCAGGAGGG + Intronic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171169576 20:23003440-23003462 CTAATCACATGGAGGGAGGATGG - Intergenic
1171177165 20:23061209-23061231 CTGAGAACAAGCCTGCAGGATGG + Intergenic
1171796596 20:29571312-29571334 AAGAGACCAAGGCGGGAGGATGG + Intergenic
1171851645 20:30312854-30312876 AAGAGACCAAGGCGGGAGGATGG - Intergenic
1172169008 20:32917591-32917613 CTGGGAAGCAGGAGGGATGATGG + Intronic
1172171741 20:32939626-32939648 GAGAGAGAAAGGAGGGAGGAAGG - Intronic
1172301998 20:33856887-33856909 CTGTTAACAAGGAAGAAGGAGGG + Intergenic
1172876973 20:38170317-38170339 CTGAGAGCCAGGTGGGTGGAGGG - Intergenic
1173012422 20:39194388-39194410 CAGAGAGTTAGGAGGGAGGAGGG - Intergenic
1173197432 20:40927505-40927527 CTGAGAACAAATAGAGAGGGAGG + Intergenic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174808248 20:53623460-53623482 CTGAGGAGAAGGACGGAGGGTGG + Intergenic
1174819127 20:53712204-53712226 CTGAAAACAGGGAGAGAGGGAGG - Intergenic
1174975528 20:55328853-55328875 CTGAGAAGATGGAGGGAGGGAGG - Intergenic
1175209305 20:57339841-57339863 GGGAGACCAAGGCGGGAGGATGG - Intronic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175374711 20:58516050-58516072 AAGAGAACCAGGAAGGAGGAGGG + Intergenic
1175415745 20:58799764-58799786 GGGAGGCCAAGGAGGGAGGATGG + Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1176087381 20:63304248-63304270 CTGCGCACCTGGAGGGAGGAAGG - Intronic
1176663959 21:9667012-9667034 CTGAGAACCTGGAGGGCTGATGG + Intergenic
1177416646 21:20801711-20801733 TTGGGAACAGGGAGGTAGGAGGG + Intergenic
1177944172 21:27446532-27446554 CTGAGAACCAAGAGAGACGATGG + Intergenic
1178381637 21:32114701-32114723 CAGAGAGCAAGGAGGAAGGTGGG + Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178634732 21:34292223-34292245 CTGAGAACCAGGAGAGCTGATGG - Intergenic
1178809402 21:35867621-35867643 TTGAGAAGAAGCAGGGAGGTGGG + Intronic
1179116703 21:38499832-38499854 ATGGGAGGAAGGAGGGAGGAAGG + Intronic
1179189115 21:39108293-39108315 ATGAGAAACAGGATGGAGGAGGG + Intergenic
1179343839 21:40537786-40537808 CTGAGATCAAGGAGTCAGCAGGG - Intronic
1179457728 21:41510639-41510661 CTGAGAACCAGGAGTGCTGAGGG + Intronic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1180280444 22:10688669-10688691 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1180465812 22:15609081-15609103 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1180587666 22:16907206-16907228 CTTACAACAGGGAGGGAGGAAGG + Intergenic
1181884748 22:26011398-26011420 ATGAGAACATGAAGGGAGGAGGG + Intronic
1182076073 22:27496284-27496306 GGGAGACCAAGGTGGGAGGACGG + Intergenic
1182333849 22:29570221-29570243 CAGAGAACAAGAAGTGAGGTAGG + Intronic
1182411351 22:30189636-30189658 CTCAGGGCAAGGAGGGAGCAAGG - Intergenic
1182458828 22:30470124-30470146 CTGAGAACAGGGATGGAAGGAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182648738 22:31832982-31833004 CTGAGAAGAAAGCTGGAGGAAGG - Intronic
1182700146 22:32230215-32230237 CTGACACACAGGAGGGAGGAAGG - Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1182807320 22:33084417-33084439 GGGAGACCAAGGTGGGAGGATGG + Intergenic
1183012705 22:34960165-34960187 CTCAGAACAATGATGGATGAAGG + Intergenic
1183272668 22:36871822-36871844 CTGGGCACCAGGAGGAAGGAAGG + Intronic
1183687468 22:39369477-39369499 CAGAGGACCAGCAGGGAGGAAGG - Intronic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183924164 22:41193847-41193869 CTCAAAAAAGGGAGGGAGGAAGG + Intergenic
1184252942 22:43271206-43271228 CTATGAGCAAGGAGGGAGCAGGG - Intronic
1184642457 22:45879640-45879662 ATGATAGCAAGGAGGGAGGGAGG - Intergenic
1184897626 22:47420759-47420781 TTGAGAACAAGGACCCAGGAGGG - Intergenic
1185028534 22:48429472-48429494 GGGAGAAAGAGGAGGGAGGAAGG + Intergenic
949883090 3:8676749-8676771 CTGAGATCCAGGTGGGAAGAGGG - Intronic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950099259 3:10347083-10347105 CTGAGACCAAGGGGGGAAGCAGG - Intronic
950320427 3:12047387-12047409 CTGAGAAGAAGGAAGGATGATGG + Intronic
950552448 3:13674997-13675019 CTGAGTGCAAGGAGTGAGGGAGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951046182 3:18041069-18041091 GAGAGGACAAGGAGGGAAGAGGG - Intronic
951200184 3:19867950-19867972 CTGAGAGTAAGAAAGGAGGAGGG - Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951723178 3:25723926-25723948 CTTACAACAAGGAGCAAGGATGG - Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952767284 3:36965260-36965282 GGGAGGACAAGGAGGGAGGATGG + Intergenic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953374652 3:42418582-42418604 ATAAGAAAAAGGAGGGAGGAGGG + Intergenic
953651197 3:44806526-44806548 CTGAGAATGAGGAGAGAGAAAGG + Intronic
954479853 3:50788751-50788773 CTGAGGGCAAGGAGGGTGGCAGG + Intronic
954839618 3:53498938-53498960 CTGAGAACGAGGAGGGAGCTCGG + Intronic
954845890 3:53555652-53555674 CTGATAACAAGTTGGGAGGAGGG - Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955231209 3:57100567-57100589 GAGAGAACAGGGAGGTAGGAAGG - Intronic
955391685 3:58526659-58526681 GTGAGAACATGGAGGGGGGTTGG + Intronic
956407410 3:68942377-68942399 CTGAGAACCAGGAGTGCTGAAGG - Intergenic
956661364 3:71601577-71601599 CTGACTGCAATGAGGGAGGAAGG + Intergenic
957337704 3:78853185-78853207 GGGAGAAGAAGGAAGGAGGATGG + Intronic
957502487 3:81075175-81075197 CTGATAACAAGGAGGGATGATGG - Intergenic
958761840 3:98318780-98318802 CTGAGAACCAGGAGTGCTGAGGG + Intergenic
958832094 3:99101571-99101593 CTGAGAACAAGGAGAGTTGAAGG + Intergenic
958915887 3:100049663-100049685 CTGAGAAGGAGGAGGAAGAAGGG - Intronic
959430672 3:106251422-106251444 CTGAGAACTTGGGGGTAGGAAGG + Intergenic
959519336 3:107307455-107307477 CTGAGAAACAGGAGGGCAGAAGG + Intergenic
959681813 3:109105141-109105163 GGGAGGCCAAGGAGGGAGGATGG + Intronic
959766469 3:110036227-110036249 CTGAGAACAAGCAGAGAAAAAGG - Intergenic
960993213 3:123325060-123325082 CTGCCAAGAGGGAGGGAGGAAGG + Intronic
961000334 3:123369935-123369957 CTGCTAACAAGGGGGTAGGAAGG + Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961340114 3:126212250-126212272 GAGAGAAGAAGGAGGGAGGAAGG + Intergenic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961581603 3:127887857-127887879 CTGAGAACCAGGAGGGCAGATGG + Intergenic
962215126 3:133514474-133514496 CTGAGAACAAGGAGACCCGATGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962480450 3:135793699-135793721 GTGAGAACAGGGAAGGAAGAAGG - Intergenic
962769691 3:138600905-138600927 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962769701 3:138600930-138600952 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962883536 3:139601524-139601546 GTGAAAACAAGGAGGCAGGTAGG - Intronic
963353923 3:144186459-144186481 CTGAGAAGAAGGTGGGAAGTGGG - Intergenic
965079539 3:164019675-164019697 GTGAGAAGGAGGAGGGAAGAGGG + Intergenic
965377487 3:167943402-167943424 CTGAGAACCAGGAGAGCTGATGG + Intergenic
965391316 3:168107903-168107925 CTGAAAACTAGGAGAGATGATGG + Intergenic
965664451 3:171077626-171077648 CTGAGAACCAGGAGAGCTGATGG - Intronic
966392429 3:179466476-179466498 AGAAGAACAAGGAGGGAGGTAGG - Intergenic
967019104 3:185506910-185506932 GTGAGAAGGAGGAGGAAGGATGG + Exonic
967331747 3:188296918-188296940 CTGAGAACAAGGGAGTGGGAGGG + Intronic
967337459 3:188360465-188360487 ATGAGAAGAAAGAGAGAGGAGGG - Intronic
967439038 3:189485645-189485667 CTAAGAAAGAGGAGGGAGGGTGG - Intergenic
967498866 3:190174740-190174762 GAGAGAAGAAGGAGGGAGGGAGG - Intergenic
967833676 3:193943253-193943275 CTGAAAACAGGGTAGGAGGAGGG - Intergenic
967863864 3:194174452-194174474 GGGAGGCCAAGGAGGGAGGATGG + Intergenic
967931948 3:194696318-194696340 ATGAGTTCAAGGAGGGAGGGTGG + Intergenic
968591242 4:1460635-1460657 AACAAAACAAGGAGGGAGGAGGG - Intergenic
969371906 4:6736983-6737005 GGGAGGCCAAGGAGGGAGGATGG - Intergenic
969449785 4:7266405-7266427 CTGAAAGAAAGAAGGGAGGAGGG - Intronic
969659210 4:8516538-8516560 CGGAGGTCAAGGTGGGAGGATGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
971358178 4:25913526-25913548 CAGGGAACAGGGAGAGAGGATGG + Intronic
972160873 4:36225674-36225696 TTGAGAGGAAGGAGGCAGGAGGG + Intronic
972340631 4:38149560-38149582 CTGAGAGCAAGGAGGGGTGGGGG - Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972396820 4:38664649-38664671 CGGAGAGCAAGCAAGGAGGAGGG + Intronic
972617529 4:40714532-40714554 GTGAGCATAAGGTGGGAGGAGGG + Intergenic
974099594 4:57402234-57402256 CTGAGAACCAGGAGAGCTGATGG + Intergenic
974411245 4:61543344-61543366 GTGAGAAGAAGAAGGGAGAAAGG + Intronic
974686553 4:65239102-65239124 CTAAGAACCAGGAGGGTTGATGG + Intergenic
974790489 4:66682186-66682208 GGGAGAGCAAGGTGGGAGGAGGG - Intergenic
975264824 4:72350960-72350982 CTGAGAGCCTGGAGAGAGGAAGG - Intronic
975437541 4:74370813-74370835 CAGAGAACAAGGAATGAGGTGGG - Intronic
975702937 4:77083891-77083913 CTGGAAACAAGGAGGGTGGGGGG + Intergenic
975920188 4:79377729-79377751 AAGAAAACAAGGAGAGAGGAAGG - Intergenic
976206278 4:82626204-82626226 TTGAGAACAAGTGGGGAGGAGGG + Intergenic
976490889 4:85668770-85668792 CAGAGAACAATGAGGGATCATGG + Intronic
976809178 4:89082041-89082063 CTTATAAGAAGGAGGCAGGAAGG + Intronic
976827996 4:89281665-89281687 CTGAGAACAAGGTGTCAGCAGGG - Intronic
977066551 4:92323700-92323722 CAGAGAAGAAGAAAGGAGGAAGG - Intronic
977080376 4:92519766-92519788 CTGAGAATAAGGAGAGCTGATGG + Intronic
977574611 4:98663014-98663036 CTGAGAGGAAGGCGGCAGGAGGG - Intergenic
978459929 4:108940463-108940485 CTGAGAACTAGGGTGGAGTAGGG - Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978875731 4:113638388-113638410 CTGCGAACAATGAGAGAGGTAGG + Intronic
981105433 4:140875414-140875436 TGGAGACCAAGGTGGGAGGATGG - Intronic
981253617 4:142634025-142634047 CAGATAAAAAGGAGGGAGGTGGG + Intronic
981697766 4:147575804-147575826 CTGAGAACCAGGAGAGCTGATGG - Intergenic
981950482 4:150400612-150400634 GGGAGGACAAGGAGGGAGGATGG + Intronic
982207342 4:153006470-153006492 CTGAGAAAAATGAGGCTGGAAGG + Intergenic
982660434 4:158200262-158200284 GAGAAAGCAAGGAGGGAGGAGGG - Intergenic
983089107 4:163483451-163483473 TTGAGAAGAAGGAGTGAGGAAGG + Intergenic
983204922 4:164902126-164902148 CTGGGAGCCAGGAGGGAGCAAGG - Intergenic
984466508 4:180106458-180106480 GGGAGGCCAAGGAGGGAGGATGG - Intergenic
984863112 4:184257299-184257321 TTGAGAAAAAGGAGGAAGGAAGG + Intergenic
985051359 4:185995518-185995540 CTGAGAACCAGGAGAGCGGATGG + Intergenic
985370677 4:189282514-189282536 CTGAGAACCAGGAGAGATGATGG + Intergenic
985409415 4:189667692-189667714 CTGAGAACCTGGAGGGCTGATGG + Intergenic
985514805 5:336047-336069 CTAAGAACTAGGATGGAGAATGG + Intronic
985719380 5:1481311-1481333 CGGAGAGCATGGAGGGAGGGAGG - Intronic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
985851636 5:2392670-2392692 AAGAGAGGAAGGAGGGAGGAAGG - Intergenic
986210337 5:5665640-5665662 CAGACAGCAAGGAGGGAGGAAGG + Intergenic
986651886 5:9972147-9972169 CTGAGAACCAGGAGAGACCACGG + Intergenic
987293622 5:16530992-16531014 GGGAGAATAAGGAAGGAGGAAGG + Intronic
988699966 5:33663431-33663453 AAGAAAAAAAGGAGGGAGGAAGG + Intronic
988838374 5:35057166-35057188 CTGAGAAAAATGAGGGGAGATGG - Exonic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989668214 5:43881925-43881947 CTGACAAAAAGGAAGGAGCAAGG + Intergenic
989995050 5:50819386-50819408 CTGAGACCTTGTAGGGAGGAGGG - Intronic
990759546 5:59113077-59113099 AAGAGAACAAGGAGGGAAGAAGG - Intronic
990874096 5:60464860-60464882 CGGAGGTCAAGGTGGGAGGATGG + Intronic
992318749 5:75588819-75588841 CTTATAAGAAGGAGGCAGGAGGG - Intronic
992325091 5:75652544-75652566 CTGAGACTGAGGTGGGAGGATGG - Intronic
993054604 5:82967933-82967955 CAAAGACCAAGGAGGGAGGTGGG + Intergenic
993283560 5:85959947-85959969 GAGAGAAAAAGGAGGGAGGGTGG - Intergenic
993340547 5:86719968-86719990 CTGAGAAAATGTAGGAAGGAGGG + Intergenic
993392036 5:87330689-87330711 CTGAGAGCAAGAAGGGTGAAGGG + Intronic
993503053 5:88683567-88683589 CCGAGATCAAGAAAGGAGGAGGG - Intergenic
993895945 5:93534637-93534659 ATGAGAAAAAAGAGGTAGGAAGG + Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
994927450 5:106135861-106135883 GAAGGAACAAGGAGGGAGGAAGG - Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995635852 5:114189294-114189316 CTGAGAACAAGGAGAGCTGATGG + Intergenic
995868378 5:116717371-116717393 CTAAGAACAGGAAGGAAGGAAGG - Intergenic
996589577 5:125131857-125131879 CTGAGAACCAGGAGTGCTGATGG + Intergenic
996589610 5:125132053-125132075 CTGAGAACCAGGAGTGCTGATGG + Intergenic
996589618 5:125132102-125132124 CTGGGAACAAGGAGTGCTGATGG + Intergenic
996633161 5:125661611-125661633 ATGAGAACAGGGAGGGAGAAAGG - Intergenic
996646909 5:125827920-125827942 CTGAGAACCAGGAGAGATGATGG + Intergenic
998060297 5:139113854-139113876 CTTAGACCAAGTAGGGATGATGG - Intronic
998658083 5:144204984-144205006 CCGTGAACGAGGAGGGGGGAGGG + Intronic
998911778 5:146967752-146967774 CTGCAAACCGGGAGGGAGGAGGG - Intronic
999132987 5:149298964-149298986 CTGATAACATGGAGTGAGGAGGG + Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000912996 5:167044935-167044957 CAGAGAAAATGGAGGGAGCAAGG + Intergenic
1001170081 5:169410960-169410982 CTGAAAACAAGAGTGGAGGAAGG - Intergenic
1001237212 5:170040298-170040320 ATGAGAACAAGGACAAAGGAAGG - Intronic
1001410767 5:171509681-171509703 CCGAGAACAAGGGAGGAGAAGGG - Intergenic
1001734043 5:173984227-173984249 TTGAGACTAAGAAGGGAGGATGG + Intronic
1001922154 5:175609217-175609239 CTGAGTTCTAGGAGGGAAGATGG + Intergenic
1002184702 5:177448744-177448766 CGGAGAAAATGGAGGGAGGGAGG - Intronic
1002335111 5:178472050-178472072 GGGAGCTCAAGGAGGGAGGATGG + Intronic
1002764631 6:228295-228317 CAGAGCACGAGGAGGGAGGGAGG + Intergenic
1002824791 6:763118-763140 CTGAGAACCAGGAGAGCCGATGG - Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003347051 6:5279685-5279707 CTGAGAACCAGGAGAGTGGATGG + Intronic
1003775330 6:9354306-9354328 CAGAGACAAAGGAGGGAGGCAGG + Intergenic
1003849088 6:10203450-10203472 CTGAGAACCAGGAGTGCTGATGG - Intronic
1003907369 6:10714408-10714430 CGGAGGCCAAGGTGGGAGGATGG - Intergenic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1004226535 6:13789818-13789840 TGGAGAAGAGGGAGGGAGGAGGG + Exonic
1004308523 6:14522991-14523013 CTGAGAACCAGGAGTGCTGAGGG + Intergenic
1004351279 6:14892382-14892404 CAGAGAACAATGAGTAAGGATGG - Intergenic
1004391276 6:15211662-15211684 CCGAGAAAAAGGAGGAATGAAGG + Intergenic
1004468758 6:15909508-15909530 CTGAGCACCTGGAGGGAGGAAGG + Intergenic
1004744834 6:18499441-18499463 CTGAGAAGGAGGAGGGAAGGTGG + Intergenic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1004886512 6:20056440-20056462 TTGAGAATAAAGAGGGAGCATGG + Intergenic
1004973216 6:20935362-20935384 ATGAGAAGAATGAGGGAGTAAGG - Intronic
1005140090 6:22621866-22621888 CTGAGAATGAGGTGGGTGGAGGG - Intergenic
1005190493 6:23216312-23216334 CTGAGATCAAGGAGCCAGCATGG + Intergenic
1005429719 6:25742418-25742440 GAGAGGTCAAGGAGGGAGGATGG + Intergenic
1005480427 6:26250075-26250097 CCTAAAACAAGGAGGGTGGAGGG - Intergenic
1005687559 6:28269552-28269574 CTGAGAACCAGGAGAGCTGATGG + Intronic
1006169117 6:32082952-32082974 ATGAGAGCAAAGAGGGAAGATGG - Intronic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006682774 6:35809059-35809081 CTGGGAACAGGGAGGGGGCAGGG + Intronic
1006822305 6:36907041-36907063 AGGAAAAGAAGGAGGGAGGAAGG - Intronic
1007170762 6:39861741-39861763 CTGAAAACTGGGAGGGTGGAGGG - Intronic
1007327827 6:41075287-41075309 GGGAGAACAAGAAGGGAGGATGG - Intronic
1007407547 6:41643663-41643685 GAGAGAGAAAGGAGGGAGGAAGG + Intronic
1007655517 6:43449046-43449068 CTTAGAGCAAGAAGGGAGCAGGG + Intronic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1008572756 6:52830749-52830771 TGGAGATCAAGGAGTGAGGACGG + Intergenic
1008579704 6:52895715-52895737 TGGAGATCAAGGAGTGAGGACGG + Intronic
1008922051 6:56852186-56852208 AAAAGAGCAAGGAGGGAGGAAGG + Intronic
1009834050 6:68974526-68974548 AAGAGACTAAGGAGGGAGGATGG + Intronic
1009947302 6:70354709-70354731 CTAAGAACAGGGAAGGAGGTGGG - Intergenic
1011378993 6:86722181-86722203 CTGAGTACAAGAAGAGAGGGTGG - Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011695741 6:89911207-89911229 GAGAGAAAAAGGAGGGAGGGAGG - Intergenic
1012658798 6:101859895-101859917 CTAAGAAAAAGGGGTGAGGAGGG + Intronic
1012842016 6:104341455-104341477 CTGAGAACCAGGAGAGCTGATGG + Intergenic
1012868381 6:104644814-104644836 CTGAGGACACGGAGGTAGCAAGG - Intergenic
1012943153 6:105438513-105438535 GTGAGAGGGAGGAGGGAGGAAGG - Intergenic
1013486889 6:110605875-110605897 CAGAGGACAAGGCTGGAGGAAGG + Intergenic
1013993587 6:116281086-116281108 CTTATAAGAAGGAGGCAGGAGGG + Intronic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1014177924 6:118350296-118350318 CAGAGAAGAAGCAGGGAGCAGGG + Intergenic
1014388053 6:120825561-120825583 GTGAGGCCAAGGCGGGAGGATGG - Intergenic
1014608872 6:123515673-123515695 CTGGGAGCAAGGTGAGAGGAAGG + Intronic
1014638266 6:123876624-123876646 CTGAAAACAAGGAGCATGGAGGG + Intronic
1014720955 6:124917829-124917851 TTGAGAACTAAAAGGGAGGAAGG - Intergenic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015025939 6:128532550-128532572 CTGACAACAGGGATGTAGGATGG - Intergenic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1015414264 6:132930885-132930907 CTGAGCAGCAGGAGGGAGGGTGG + Intergenic
1015475321 6:133653896-133653918 CTGAAAAAAAGGTAGGAGGAAGG - Intergenic
1015742992 6:136478341-136478363 CGGAGGCCAAGGTGGGAGGATGG + Intronic
1015795619 6:137008202-137008224 GGGAGGCCAAGGAGGGAGGATGG - Intronic
1016093160 6:140003542-140003564 CTGAGAACCAGGAGAGTGGATGG - Intergenic
1016369622 6:143359009-143359031 CGGAGAAAAAGGGGAGAGGAAGG + Intergenic
1016426320 6:143939467-143939489 CTGAGAACAAAGAGGGGATATGG + Intergenic
1016439327 6:144067286-144067308 GTGAGAGCGAGGAGGGAGGAGGG + Intergenic
1016547362 6:145239128-145239150 CAGAAAAGAAGGAGGGAGGTAGG - Intergenic
1016624933 6:146155957-146155979 CTGAGAACAAGAATGGATGCCGG + Intronic
1016773322 6:147876217-147876239 CTCAGAACCAGCAGGGAAGAAGG - Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017230708 6:152070307-152070329 CTGGGAACAAGGACAGAGGGAGG - Intronic
1017667994 6:156740012-156740034 CTGAGAACAAGGAGTGTCAAGGG + Intergenic
1018291455 6:162296100-162296122 AAGAGAACAAGGAGGGGAGAGGG + Intronic
1018322908 6:162632493-162632515 ATGAGAAGGAGGAGGGAGGGAGG + Intronic
1018472785 6:164111465-164111487 CTGCTAAAAAGGAGGGAGGGAGG + Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018751444 6:166810073-166810095 CTGAAGACAAGGTGGCAGGATGG + Intronic
1018969271 6:168514860-168514882 CTTAGACAAAGGAGGGAGGATGG + Intronic
1019078848 6:169413596-169413618 CAGAGGCCAAGGTGGGAGGATGG + Intergenic
1019104356 6:169656571-169656593 CTGAGAACGAGGAGGCCGGGAGG + Intronic
1019214358 6:170433757-170433779 CTCATAACAGGGAGGCAGGAGGG + Intergenic
1019289803 7:244943-244965 CTGAGAACAGCGTGGGAGGACGG + Intronic
1019508221 7:1404112-1404134 CTGGGAACACGGAGAGGGGAGGG - Intergenic
1019557207 7:1638527-1638549 CTGAGAGGAGGGAGGGAGGGAGG + Intergenic
1020442012 7:8227352-8227374 CAGAGAAGATGGAGAGAGGAAGG + Intronic
1021457168 7:20842175-20842197 GAGAGACCAAGGCGGGAGGATGG - Intergenic
1022474684 7:30702089-30702111 CTGAGCAGAAGCAGGGAGCAAGG + Intronic
1022673573 7:32478097-32478119 GGGAGACCAAGGCGGGAGGATGG + Intergenic
1023380763 7:39605597-39605619 CTGAGAACCAGGAGAGCTGATGG - Intronic
1023483761 7:40662493-40662515 CAGTGAACAAGGAGGGAGAGAGG - Intronic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024171330 7:46791039-46791061 ATGAGTACAAGGAGGGTGAAGGG + Intergenic
1024591152 7:50885713-50885735 ATAAGAACAAGGGGGGAGAAAGG + Intergenic
1025943647 7:66090511-66090533 GGGAGACCAAGGTGGGAGGATGG - Intronic
1026033512 7:66815473-66815495 GGGAGGTCAAGGAGGGAGGATGG - Intergenic
1026112096 7:67466440-67466462 GAGAGAAGAAGGAGGGAGGGAGG - Intergenic
1026203628 7:68236555-68236577 CTGAGATGCAGGAGAGAGGAGGG + Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1026509161 7:71013682-71013704 CAGACAGAAAGGAGGGAGGAAGG + Intergenic
1026600257 7:71771735-71771757 CTGAGAACCAGGAGAGCTGATGG - Intergenic
1026646441 7:72174744-72174766 GTGACAACATGGAGGAAGGAAGG + Intronic
1026874771 7:73872894-73872916 GAGAGAGAAAGGAGGGAGGAAGG - Intergenic
1027344241 7:77240897-77240919 CAGAGATCAAGGAGAGATGAGGG - Intronic
1027392562 7:77720002-77720024 TGGAGGACAAGGTGGGAGGATGG - Intronic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028127582 7:87131384-87131406 CTGAGAACCAGGAGAGCAGATGG - Intergenic
1028600903 7:92599467-92599489 CTGAGACTGAGGTGGGAGGATGG - Intergenic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1029285212 7:99461035-99461057 CTGAGAACAAGGAATCAGAAGGG + Intronic
1029747699 7:102525567-102525589 ATGAGAACCAGGAGCCAGGATGG + Intergenic
1029765650 7:102624657-102624679 ATGAGAACCAGGAGCCAGGATGG + Intronic
1029782282 7:102747491-102747513 AAAAGAATAAGGAGGGAGGAAGG + Intergenic
1030235994 7:107262715-107262737 CTGAGAATAAGGAGGAGGGAAGG - Intronic
1031356105 7:120789045-120789067 ATGAGAAGAAGGAGAGAGGGAGG + Intronic
1032069011 7:128792297-128792319 CTGAGAGCAGGGAGAAAGGAGGG - Exonic
1032473080 7:132192420-132192442 ATGAGATAAAGGAGGGAGGGAGG + Intronic
1032529279 7:132606757-132606779 CTGAGAAAAATTAGGGAGGAGGG + Intronic
1032862899 7:135898448-135898470 CTGAGAACAAGGGGAGCAGATGG + Intergenic
1033097995 7:138447678-138447700 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
1033172441 7:139095956-139095978 CTGAGAAAAAGGAGAGTAGATGG + Intronic
1033453679 7:141483398-141483420 CTGAGAAGAAGCAGAGAGAAAGG - Intergenic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034334696 7:150313570-150313592 CTGAAATCAAGAAGGGAGGGGGG + Intronic
1034516568 7:151585522-151585544 CTGAGAACAGGGAGGGAGAATGG - Intronic
1034563322 7:151895114-151895136 GGGCGAACAAGCAGGGAGGACGG - Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034686048 7:152972398-152972420 CTGAGAGCATAGAGGCAGGAAGG + Intergenic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035318846 7:158015295-158015317 CAGAGAACAAGTGGGGAAGAGGG - Intronic
1036104868 8:5828511-5828533 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
1036675954 8:10833445-10833467 AGGAGAAAAAGGAGGGAGGAAGG + Intronic
1036783210 8:11664778-11664800 CTCAGAAGAAAGAGGGAGGTAGG - Intergenic
1037090792 8:14915533-14915555 CTGACAAAGAGGAGGGAAGATGG - Intronic
1037170693 8:15887886-15887908 CAGAGAAAATGGAGGGAGGGAGG + Intergenic
1037277717 8:17199659-17199681 AGAAGAAGAAGGAGGGAGGAGGG - Intronic
1037767692 8:21782155-21782177 GTGAGAACCAGGAGAGAGAAGGG - Intronic
1037769604 8:21790620-21790642 GGGAGAAGATGGAGGGAGGAAGG - Intronic
1037776502 8:21839037-21839059 CCCAGAGCAAGGAGGGAGGATGG + Intergenic
1038011326 8:23478478-23478500 CCCAGAACAATGTGGGAGGAAGG + Intergenic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038140015 8:24834158-24834180 CTGAGAACCAGGACTGTGGATGG - Intergenic
1038905463 8:31897254-31897276 CTGAGTTCCAGAAGGGAGGAGGG - Intronic
1039261857 8:35780455-35780477 CCGAGGAAAAGGATGGAGGAAGG + Intronic
1039360389 8:36870423-36870445 CTGAGAGTAAAAAGGGAGGAAGG - Intronic
1039396670 8:37231672-37231694 GTGAGAGAAAGGAGAGAGGAAGG + Intergenic
1039547145 8:38418396-38418418 CCTAGAGCAAGGAGGGGGGACGG + Intronic
1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG + Intergenic
1040304592 8:46205454-46205476 AAGAAAACAAGGAGGCAGGATGG + Intergenic
1040690958 8:49937865-49937887 CTCAGAAGGAGGAGGGAGGAAGG - Intronic
1040800007 8:51329985-51330007 CTGAGAACCAGGAGTGCTGAGGG + Intronic
1041357486 8:57015505-57015527 TTGAGATTAAGGAGAGAGGAGGG + Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041666900 8:60454605-60454627 ATGAGAAAAAGGGTGGAGGATGG + Intergenic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1041799504 8:61783966-61783988 CTGAGAACCAGGAAGGCTGAGGG + Intergenic
1041993884 8:64029483-64029505 CAGAGAACAAGGGAGCAGGAAGG + Intergenic
1042109835 8:65368858-65368880 CAGAGAACAGGGAGGGGGGAGGG + Intergenic
1042821572 8:72935706-72935728 CTAAGAACAATGAGTGCGGAAGG + Intronic
1043188198 8:77182451-77182473 CTGAGAACCAGGAGAGATGGTGG + Intergenic
1043442964 8:80292586-80292608 CTGAGATCAAGGTGTCAGGAGGG + Intergenic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1043585477 8:81763821-81763843 CTGAGAAGCAGGAAGGAGGGTGG + Intergenic
1044354727 8:91207926-91207948 CTGAGAGCAAGGTGCCAGGAGGG + Intronic
1044763122 8:95543439-95543461 CAGAGAACAAGAAGGAAGGAAGG - Intergenic
1044926653 8:97214899-97214921 CTTAGAAAAAGGAGGGGGCAGGG - Intergenic
1045245647 8:100439722-100439744 CTGAGAACAAGGGGGAGTGATGG - Intergenic
1045755257 8:105534146-105534168 AAGAGAGAAAGGAGGGAGGAAGG - Intronic
1046145977 8:110158752-110158774 ATGAGAAAAAGAAGGAAGGAAGG - Intergenic
1046547799 8:115673557-115673579 CAGACAACATGGAAGGAGGAAGG + Intronic
1046876947 8:119265732-119265754 CTAAGAACATGGATGGAGGCTGG - Intergenic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1046997789 8:120543591-120543613 CTCAGGACAAGGAGGGATGTGGG + Intronic
1047291926 8:123539330-123539352 TTAGGAACAAGGAGGAAGGAAGG + Intronic
1047933340 8:129751694-129751716 CTGAGAACATGGAGGATGAATGG - Intronic
1048077582 8:131089627-131089649 CTGCGAACAGGGAGAGAGGTTGG - Intergenic
1048154825 8:131936627-131936649 CTGAGCCCAAGGAGGGAGTGTGG - Intronic
1048223089 8:132561352-132561374 CTTAGAACAGGGCAGGAGGAGGG - Intergenic
1048434921 8:134407259-134407281 AAGAGACCTAGGAGGGAGGAAGG - Intergenic
1049004647 8:139847108-139847130 CTGACAACAGGGAAGGAAGAAGG + Intronic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049370263 8:142261028-142261050 GAGAGAAAGAGGAGGGAGGAAGG + Intronic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1049592037 8:143466961-143466983 CTAAGGCCAAGGAGGGAAGAAGG + Intronic
1049701857 8:144018700-144018722 CTGAGAGCAAGGATGGAGCGGGG + Intronic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050119386 9:2292806-2292828 CTGAGAAGATGGAACGAGGAAGG - Intergenic
1050297650 9:4222116-4222138 TGGAGAAGAGGGAGGGAGGAAGG - Intronic
1050354237 9:4768315-4768337 CTGAGAACCAGGAGAGCTGATGG - Intergenic
1051189255 9:14493793-14493815 AGAAGAACAAGGAGGGAGGAAGG - Intergenic
1051301726 9:15658623-15658645 CTTATAACAGGGAGGCAGGAGGG + Intronic
1051328558 9:15999320-15999342 AAGAAAAGAAGGAGGGAGGAAGG + Intronic
1051589165 9:18758634-18758656 CTTAGAAGAGGGAGGCAGGAGGG - Intronic
1051688213 9:19680989-19681011 TTGAGAACAAGCTGGGATGAAGG - Intronic
1053038202 9:34845141-34845163 ATGAGAACAAAAAGAGAGGAAGG - Intergenic
1053416728 9:37951629-37951651 CTGAGCTCAGGGAGGGTGGATGG - Intronic
1053441624 9:38120965-38120987 AGGAGAAGGAGGAGGGAGGAGGG + Intergenic
1053590636 9:39510998-39511020 CTGAGAACGGGGAGGTAGAAGGG - Intergenic
1053789422 9:41676109-41676131 AAGAGACCAAGGTGGGAGGATGG - Intergenic
1053848496 9:42266387-42266409 CTGAGAACAGGGAGGTAGAAGGG - Intergenic
1054155717 9:61638653-61638675 AAGAGACCAAGGTGGGAGGATGG + Intergenic
1054177760 9:61887795-61887817 AAGAGACCAAGGTGGGAGGATGG - Intergenic
1054406563 9:64768036-64768058 CTTATAATAGGGAGGGAGGAAGG + Intergenic
1054440193 9:65253509-65253531 CTTATAATAGGGAGGGAGGAAGG + Intergenic
1054475487 9:65569654-65569676 AAGAGACCAAGGTGGGAGGATGG + Intergenic
1054490212 9:65768430-65768452 CTTATAATAGGGAGGGAGGAAGG - Intergenic
1054575668 9:66854291-66854313 CTGAGAACGGGGAGGTAGAAGGG + Intergenic
1054659771 9:67693030-67693052 AAGAGACCAAGGTGGGAGGATGG + Intergenic
1054738828 9:68783964-68783986 CAGAAAACGAGGGGGGAGGAGGG - Exonic
1054943647 9:70771483-70771505 GTGAGAACAAGGAAAGAAGAGGG - Intronic
1055450898 9:76430623-76430645 GGGAGACCAAGGAAGGAGGATGG - Intronic
1055788832 9:79899682-79899704 CTGAGAACAAGGTGTCAGCAGGG - Intergenic
1056178927 9:84062663-84062685 CTGGGAAAAAGGAGGCAGGCAGG + Intergenic
1056545143 9:87606773-87606795 AGGAGAAAAAGGAGGGAGGGAGG - Intronic
1056877063 9:90343646-90343668 CTAAGAACAAAGAGGCAGAAAGG - Intergenic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057299761 9:93871025-93871047 CAGAGAACCTGGCGGGAGGAAGG - Intergenic
1057319445 9:93998971-93998993 CTGAGAACCAGGAGAGTTGATGG + Intergenic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1057822342 9:98342341-98342363 CTGAGCACAAGGAACAAGGAAGG + Intronic
1058070149 9:100593705-100593727 TGGAGAACAAAGAGGGTGGAAGG - Intergenic
1058375902 9:104321154-104321176 CTGAGAACCAGGGGAGATGATGG - Intergenic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1059333948 9:113556847-113556869 CTGAGACCAAGGGAAGAGGAGGG - Intronic
1059461220 9:114431557-114431579 GTGAGAACAAGAGAGGAGGAAGG - Intronic
1059624952 9:116053472-116053494 CTGAGAATGAGGATGGAGAAAGG - Intergenic
1059988297 9:119840880-119840902 CAGAGAGCAAGGAGGAAGGTGGG + Intergenic
1060028058 9:120189882-120189904 TAGAGAACAAGGAGGTTGGATGG + Intergenic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060089658 9:120731746-120731768 ATGAGAACGAGGAGGCAGGCTGG + Intergenic
1060106274 9:120875584-120875606 CTGAGACCAGGGCAGGAGGATGG - Intronic
1060219674 9:121757730-121757752 CTGAGACCAAGCCGGGAGCAGGG + Intronic
1060454195 9:123775393-123775415 CTGAAAGGAAGGGGGGAGGAGGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060602443 9:124887145-124887167 CGCTGAACAAGGAGGCAGGAAGG + Intronic
1061371402 9:130199624-130199646 ATGACAGCATGGAGGGAGGATGG - Intronic
1061516756 9:131094625-131094647 CTGAGAAACTGGAGGGAGGCGGG - Intergenic
1061660411 9:132126416-132126438 ATGAGAACAAGAACGGGGGAGGG - Intergenic
1062080852 9:134622623-134622645 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080883 9:134622722-134622744 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080914 9:134622823-134622845 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062520387 9:136955246-136955268 GTGAGAAGCAGGAGGGAGAAAGG - Intronic
1062575862 9:137207386-137207408 CAGAGAACACGGTGGGAGTAGGG + Intronic
1062737390 9:138144802-138144824 ATGAGGACAAGGAGGAATGAGGG - Intergenic
1203654684 Un_KI270752v1:11783-11805 CTCAGAACAAGGAAGGGTGAAGG - Intergenic
1203662141 Un_KI270753v1:54740-54762 CTGAGAACCTGGAGGGCTGATGG - Intergenic
1185521580 X:743972-743994 CTGAGACCCAGGAGAGACGAGGG - Intergenic
1185610929 X:1393106-1393128 CGGAGAAAAAGGAGGGAGGCGGG - Intergenic
1185704715 X:2258117-2258139 CTGAGATCAAGGTGTGAGCAGGG - Intronic
1185713819 X:2325470-2325492 CTGACAAAGAGGAGGGAAGATGG - Intronic
1185776310 X:2805383-2805405 CTGAGATCAAGGTGTGAGCAGGG + Intronic
1185924403 X:4130669-4130691 CTGAGATGCAAGAGGGAGGAAGG - Intergenic
1186144614 X:6612418-6612440 CTGAGATCAAGGGGTGAGCACGG + Intergenic
1186150114 X:6665744-6665766 CTGAGAAAAAGGTGTGATGATGG - Intergenic
1186526078 X:10249519-10249541 CTTAGAAGAAAGAGGCAGGAGGG + Intergenic
1186536528 X:10355753-10355775 CTGACAACAAGGAGGCAGTGTGG + Intergenic
1186564138 X:10644364-10644386 CTGAGAGGAAGGAGGAATGAAGG - Intronic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187281850 X:17863357-17863379 CTAAGAAAATGGAGGGAAGAAGG + Intergenic
1187626070 X:21115253-21115275 GGGAGGCCAAGGAGGGAGGAAGG + Intergenic
1187724929 X:22192548-22192570 CGGAACAGAAGGAGGGAGGAAGG - Intronic
1188330644 X:28866971-28866993 CTGAGAATAAGAAGGAGGGATGG + Intronic
1188569416 X:31564162-31564184 CTGAGATCAAGGTGTCAGGAGGG - Intronic
1188753583 X:33933440-33933462 CTGATACCAAGGCTGGAGGAGGG - Intergenic
1189327760 X:40123256-40123278 GTGAGAACAAGGATTGAGAAGGG + Intronic
1189332980 X:40154419-40154441 AGGAGAACAAAGGGGGAGGAGGG - Intronic
1189481787 X:41397709-41397731 GGGAGACCAAGGTGGGAGGATGG - Intergenic
1189579640 X:42392480-42392502 CTGAGAACAAGGAGCGCTGAGGG + Intergenic
1189638008 X:43033093-43033115 CTGAGAATCAGGAGGGCTGATGG - Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190217558 X:48490050-48490072 CTGAGGAAAAGGAGGGAGCCGGG + Intergenic
1190397646 X:50000976-50000998 CTGAGAGTGAGGAGGAAGGAAGG - Intronic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191880824 X:65842443-65842465 CTGATAGGAAGGAGGAAGGAGGG - Intergenic
1192057069 X:67783920-67783942 CAGAGAGCAAGGAGGGAGAGTGG - Intergenic
1193217976 X:78887024-78887046 CTGAAAAAAAGGTGGGGGGAGGG + Intergenic
1193352183 X:80476432-80476454 CTGAGAACCAGTAGGGCTGATGG + Intergenic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1194100497 X:89697336-89697358 CTGAAAAGAGGGAGGGAGAAGGG + Intergenic
1194634896 X:96333326-96333348 CTGAGAACCAGGAGAGCTGATGG + Intergenic
1194728664 X:97428649-97428671 AAGAGAAGAAGGAGGGAAGAGGG - Intronic
1195141191 X:101961800-101961822 CAGAGAAGCAGGAGGAAGGAAGG + Intergenic
1195479857 X:105332015-105332037 GTGACAACAAGTAGGCAGGAAGG + Intronic
1195708574 X:107756612-107756634 CTGAGAGGAAGGAGGGAGGGAGG - Intronic
1196642230 X:118075484-118075506 CTAAGAAAAAAGAGAGAGGAAGG + Intronic
1196793216 X:119482622-119482644 CAGACAACTAGGAGAGAGGAGGG + Intergenic
1196834450 X:119801723-119801745 GAGAGAAGAGGGAGGGAGGAAGG - Intergenic
1196980935 X:121213034-121213056 CAGAGATAAAGGTGGGAGGAAGG - Intergenic
1197700742 X:129597745-129597767 GAAAGAAGAAGGAGGGAGGAAGG + Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1199461511 X:148090595-148090617 CTGAGAACAAGGAGAGCCAATGG - Intergenic
1199819056 X:151426666-151426688 ATGAGAATAAGGAGGGAGCCAGG + Intergenic
1199936175 X:152575770-152575792 CTGAGATCAAGGTGGCAGCAAGG + Intergenic
1200301788 X:154983840-154983862 CAGAGACAAATGAGGGAGGAAGG - Intronic
1200310701 X:155074007-155074029 CTGATAACTTGGTGGGAGGAGGG - Intronic
1200399542 X:156011013-156011035 ATGAGGACAAGGAGGAACGAGGG - Intergenic
1200453452 Y:3358398-3358420 CTGAAAAGAGGGAGGGAGAAGGG + Intergenic
1201194323 Y:11476740-11476762 CTTAAAATAGGGAGGGAGGAAGG + Intergenic
1201711882 Y:17001337-17001359 CAGACAAGTAGGAGGGAGGAAGG - Intergenic
1201728188 Y:17177467-17177489 CTGAGATCAAGGTGTGAGCAGGG - Intergenic