ID: 1006187658

View in Genome Browser
Species Human (GRCh38)
Location 6:32190042-32190064
Sequence GGGTGAACCCCCGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006187658_1006187668 -2 Left 1006187658 6:32190042-32190064 CCGGCTCCCCCGGGGGTTCACCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1006187668 6:32190063-32190085 CCCGGCACTGAAGGGAGACCTGG 0: 2
1: 0
2: 2
3: 10
4: 256
1006187658_1006187675 22 Left 1006187658 6:32190042-32190064 CCGGCTCCCCCGGGGGTTCACCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1006187675 6:32190087-32190109 ATACCGGCTGGGCCCCCCACAGG 0: 2
1: 0
2: 0
3: 5
4: 58
1006187658_1006187672 10 Left 1006187658 6:32190042-32190064 CCGGCTCCCCCGGGGGTTCACCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1006187672 6:32190075-32190097 GGGAGACCTGGGATACCGGCTGG 0: 2
1: 0
2: 0
3: 19
4: 152
1006187658_1006187671 6 Left 1006187658 6:32190042-32190064 CCGGCTCCCCCGGGGGTTCACCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1006187671 6:32190071-32190093 TGAAGGGAGACCTGGGATACCGG 0: 2
1: 0
2: 1
3: 14
4: 195
1006187658_1006187673 11 Left 1006187658 6:32190042-32190064 CCGGCTCCCCCGGGGGTTCACCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1006187673 6:32190076-32190098 GGAGACCTGGGATACCGGCTGGG 0: 2
1: 0
2: 0
3: 9
4: 122
1006187658_1006187670 -1 Left 1006187658 6:32190042-32190064 CCGGCTCCCCCGGGGGTTCACCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1006187670 6:32190064-32190086 CCGGCACTGAAGGGAGACCTGGG 0: 2
1: 0
2: 1
3: 6
4: 145
1006187658_1006187665 -10 Left 1006187658 6:32190042-32190064 CCGGCTCCCCCGGGGGTTCACCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1006187665 6:32190055-32190077 GGGTTCACCCCGGCACTGAAGGG 0: 2
1: 0
2: 0
3: 8
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006187658 Original CRISPR GGGTGAACCCCCGGGGGAGC CGG (reversed) Exonic
900226125 1:1534396-1534418 GGCTGAGCCCCCGGGGCAGCAGG + Exonic
900569439 1:3351163-3351185 GGGTGGACCCCGTGGGAAGCAGG - Intronic
900591669 1:3463001-3463023 GGGTGGACACCCGCGGGGGCAGG + Intronic
901934619 1:12618803-12618825 GGGGGAAGCCGCTGGGGAGCAGG + Intergenic
902007860 1:13246392-13246414 GGCAGAACCCAAGGGGGAGCGGG + Intergenic
902401517 1:16160218-16160240 GGGTGAAACCCCCAGGGATCAGG + Intergenic
903123055 1:21228922-21228944 GCGTGAACCCCGGGGGGCGGAGG - Intronic
905745863 1:40416825-40416847 AGGTGTAACCCCGGGGAAGCTGG - Exonic
906460371 1:46031584-46031606 GGGTGAGGCCCCTGGGGAGCTGG + Exonic
908835998 1:68230934-68230956 GGGAAAACGCCCGGGGGCGCCGG - Intronic
915213328 1:154325565-154325587 GGCCGAGGCCCCGGGGGAGCGGG + Intronic
918422331 1:184376784-184376806 GGGAGAACTCCTGGGGGAGAAGG - Intergenic
919921577 1:202169380-202169402 GGGTGATGCCCCCGGGAAGCAGG + Intergenic
921157202 1:212447801-212447823 GGGTGCAACCCCAGGGGAGGAGG + Intergenic
922766588 1:228159321-228159343 GTCTGAACCCCAGGGGGAGTGGG + Exonic
1065803377 10:29372694-29372716 GCGTGAACCCCAGGGGGCGGAGG + Intergenic
1071346357 10:84697796-84697818 AGGTGAACCCTGGGGTGAGCAGG + Intergenic
1071492967 10:86148825-86148847 CTGTGCACCCCTGGGGGAGCAGG - Intronic
1071579260 10:86755705-86755727 GCGTGAGCCCGCGGTGGAGCTGG + Intergenic
1075122181 10:119672344-119672366 AGATGTACCCCCGCGGGAGCTGG - Exonic
1076588677 10:131568863-131568885 GGCTGAATCCCCGGGGGGGTGGG + Intergenic
1076894613 10:133303827-133303849 TGGTGAGCCCCTGGGGCAGCTGG - Intronic
1077250054 11:1556992-1557014 GGGGGAGCGCGCGGGGGAGCCGG + Exonic
1077412894 11:2411614-2411636 TGGTGAGCCCCCGGGGGCCCTGG - Exonic
1080012481 11:27472529-27472551 GCGTGAGCCGCCGGAGGAGCGGG - Exonic
1081570399 11:44287076-44287098 GGAAGAACCCACGGGGAAGCTGG - Intronic
1081677799 11:44981053-44981075 GGGTGTGCTCCTGGGGGAGCTGG + Intergenic
1081812708 11:45922567-45922589 GGGTGACCCCCCCGGGGTCCTGG - Intronic
1083729009 11:64643104-64643126 GGGGGAGCGCCCGGGGGAGGGGG + Intronic
1084120889 11:67068359-67068381 GGCTGAACCCCAGGGAGAGGAGG + Intronic
1084416515 11:69035805-69035827 GGGTGAAGCCCCGGGAGAGGGGG - Intergenic
1088860199 11:113791659-113791681 GGGTCCAGCCCCGAGGGAGCTGG + Intergenic
1089361151 11:117887582-117887604 TGGTGGACCCCCTGTGGAGCAGG - Intergenic
1089479119 11:118791071-118791093 GGCTGGACAGCCGGGGGAGCCGG - Intronic
1089590896 11:119540176-119540198 GTGTGAACCCCCTGAGGAGAAGG - Intergenic
1094323913 12:29215926-29215948 GGGTGAACCCTAGGAGGAGAAGG - Intronic
1095966813 12:47873442-47873464 GCGTGAACCCCAGGGGGCGGAGG - Intronic
1096935212 12:55266837-55266859 GCGTGAACCCCAGGGGGCGGAGG - Intergenic
1099989444 12:89708155-89708177 GGGTGACCCTCCCGGGGCGCGGG + Intronic
1102510119 12:113409519-113409541 GGGTAAGACCCCAGGGGAGCAGG + Intronic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG + Intronic
1104215221 12:126727332-126727354 GGCTGTGCCCACGGGGGAGCAGG + Intergenic
1105013684 12:132773172-132773194 GCGTGACCCCCCGGGGGCACAGG + Exonic
1105070949 12:133234293-133234315 CTGTGCACCCCCGGCGGAGCTGG - Exonic
1107717519 13:43215710-43215732 GGGTGAACAACCAGGGGTGCTGG + Intronic
1111174181 13:84571755-84571777 GGTTGAAACCAAGGGGGAGCAGG - Intergenic
1114670432 14:24408113-24408135 TGCTGACCCCCCGGGGGATCTGG + Exonic
1114843554 14:26294104-26294126 AGGTGTATCCCCAGGGGAGCTGG - Intergenic
1117920241 14:60721539-60721561 GGGTGACTCACCGGGGGTGCGGG + Intronic
1120780564 14:88482197-88482219 GGGTGCACCCCTGGGCAAGCTGG + Intronic
1122060246 14:99132288-99132310 CGGTCTAACCCCGGGGGAGCTGG + Intergenic
1122628747 14:103097861-103097883 CCGTGAACCCCAGGGGAAGCTGG + Intergenic
1122740342 14:103868407-103868429 GGGTGAGCCCCCAGGTGAGGGGG - Intergenic
1122790098 14:104180668-104180690 GGGTGCCCCCCAGAGGGAGCAGG - Intronic
1123635420 15:22303022-22303044 GGGGGATCTCCCTGGGGAGCAGG + Intergenic
1126738086 15:51751711-51751733 GGGTGAGCGCCCCGGGGGGCGGG + Exonic
1129707359 15:77802393-77802415 GGGGGAACACCCGGGGGCACAGG - Intronic
1130074461 15:80676724-80676746 AGGTGAAGCCTCGGGGTAGCAGG - Intergenic
1133295261 16:4748840-4748862 GGGTGAACCCCAGGGGAAGCTGG - Exonic
1135376759 16:21953759-21953781 CCGTGAAACCCAGGGGGAGCGGG + Intronic
1135421217 16:22306945-22306967 GGGTGAACCCCAGGGAGTGGAGG - Intronic
1136091481 16:27923310-27923332 GGATGATCCTCCTGGGGAGCAGG - Intronic
1137718599 16:50613815-50613837 GGGGGAAGCCCCGGGAGAGAAGG - Intronic
1140250394 16:73289748-73289770 TGGTGAGCCCCCAGGGGAGCAGG + Intergenic
1141429312 16:83962983-83963005 GGATGCACCCCAGGAGGAGCAGG - Intronic
1144477647 17:15602708-15602730 GCGTGAACCCCAGGGGGCGGAGG - Intronic
1144679324 17:17182490-17182512 AGATGAACCCCAGAGGGAGCTGG + Intronic
1144780513 17:17806046-17806068 GGGTGAGCCCCTTGGGGGGCTGG - Intronic
1145916555 17:28577302-28577324 GGGTATACCCCCGAGGGGGCTGG + Intronic
1145949044 17:28801368-28801390 GTGTGAACCCCGGGGGGCGGAGG + Intronic
1146256071 17:31392073-31392095 GGGTGACCCGGCGGGGGAGCTGG - Intronic
1146574678 17:33980671-33980693 GGGCAAACCCCATGGGGAGCTGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147684213 17:42276984-42277006 GGGTGAACCTACGGGGGACGGGG + Intergenic
1148559488 17:48597685-48597707 GGGTGGGCGCCCAGGGGAGCCGG + Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1152447261 17:80353071-80353093 GGCGGAGCCCCTGGGGGAGCAGG + Intronic
1152668989 17:81590216-81590238 GGGTGAAACCATGGAGGAGCTGG - Intronic
1152791708 17:82283634-82283656 GGGTGGACACCCTGGGGAGGAGG - Intergenic
1154082127 18:11267875-11267897 AGATGAACCCCCAGGGGAGAGGG + Intergenic
1158729890 18:60011110-60011132 GGGTGACGCCCCGGCGGCGCGGG + Intergenic
1159920326 18:74221692-74221714 GGGAGAGCCCCGGGAGGAGCTGG - Intergenic
1161068097 19:2248163-2248185 GGGTGAACCCCGGGGGCTGGAGG - Exonic
1161068116 19:2248205-2248227 GGGTGAACCCCAGGGGCTGGTGG - Exonic
1161397570 19:4052604-4052626 GGGGGAACCCCAGGGCGGGCGGG + Intronic
1163455512 19:17403888-17403910 GGGGGAACTCCCGGGGGCGGTGG - Intronic
1163655183 19:18541775-18541797 GGGACAACCCCCGGCGGAGGAGG - Exonic
1164948714 19:32318087-32318109 GCGTGAACCCCAGGGGGCGGAGG + Intergenic
1166839827 19:45690246-45690268 GCGTGAACCCCAGGGGGCGGAGG + Intronic
1167562111 19:50232101-50232123 GGGGGAACCCCACGGAGAGCTGG + Intronic
1168172020 19:54595558-54595580 TGGTGAGGCCCCGGGGGAGAGGG + Intronic
926479721 2:13377350-13377372 GGGGGATCTCCCTGGGGAGCAGG + Intergenic
932798976 2:74722694-74722716 GGGTAAACCCCCAGAGGAGAAGG - Intergenic
936531004 2:113277256-113277278 GCGGGAACCCCCTGGGGCGCCGG - Intronic
938246368 2:129780551-129780573 AGGCGAACCCCTGGGGGTGCGGG - Intergenic
938554989 2:132416352-132416374 AGGTGCAGCCCCGGGGAAGCTGG - Intergenic
948516053 2:238504607-238504629 GGGTGGAGCCCCGAGGGGGCTGG + Intergenic
948869018 2:240789094-240789116 GGGTGACCTTCCAGGGGAGCAGG + Intronic
948875191 2:240822735-240822757 GGCTGAACCCAAGGGGAAGCTGG + Intergenic
1169951554 20:11049725-11049747 GGGTGAACCCAGGTGGAAGCTGG + Intergenic
1175185907 20:57179517-57179539 ACGTGAAGCCCCGGGGGAGGGGG + Intronic
1179795176 21:43778298-43778320 GGTTGAAGCCTGGGGGGAGCGGG + Intergenic
1180245300 21:46543429-46543451 GTGTGCACGCCCGGGGGAGGAGG - Intronic
1181026521 22:20130801-20130823 GGGTGCTTCCCCAGGGGAGCAGG + Intronic
1182014195 22:27025475-27025497 GGGTGACCGGCCAGGGGAGCAGG + Intergenic
1184004782 22:41699963-41699985 GGGTGAGGTCCCGGGGGATCCGG - Intronic
1184892560 22:47388914-47388936 TGGTGAGCCCCCAGGGCAGCAGG + Intergenic
1185366492 22:50439276-50439298 GGGTGACACCCTGGGGAAGCAGG + Intronic
1185380525 22:50505629-50505651 GGGAGAACCCCTGGGAGGGCAGG + Intronic
949396022 3:3615566-3615588 TGGTGGACCCCCGGGGGAGAGGG + Intergenic
959850213 3:111076890-111076912 GCTTGAACCCCAGGGGGAGGAGG + Intronic
961405014 3:126672463-126672485 GGGTGAACCCCGGGGGCTGGAGG + Intergenic
977569248 4:98612684-98612706 GGGGGAGCCCCGCGGGGAGCGGG - Intronic
979919368 4:126478847-126478869 GGGGGAACACACGGGTGAGCAGG - Intergenic
980825512 4:138067127-138067149 GCGTGAACCCCAGGGGGCGGAGG + Intergenic
982261071 4:153494891-153494913 GGGTGAACACCCGGCAGAGCAGG - Intronic
983842223 4:172471159-172471181 GAGTGAACCCATGGGGCAGCAGG + Intronic
984260872 4:177442471-177442493 GAGCGAACCCCCGAGAGAGCGGG - Exonic
984920289 4:184758055-184758077 GAGTGAACTCCTGGGGGAGGGGG - Intronic
985577686 5:681369-681391 GGGTGACCCCCTGGGGGCTCAGG - Intronic
985709554 5:1420637-1420659 GGGTGACCCCACGCAGGAGCAGG + Exonic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
995359774 5:111281973-111281995 GCGTGAACCCCAGGGGGCGGAGG + Intronic
996398563 5:123036305-123036327 GGGGGAGACCCTGGGGGAGCTGG - Intronic
997501238 5:134375714-134375736 GCGTGAACCCCAGGGGGCGGAGG + Intronic
999175703 5:149630383-149630405 GGGTGTACCACAGGGGAAGCAGG + Intronic
1003026623 6:2560622-2560644 GGGAGAACCCCTGGGTGAGGCGG + Intergenic
1006187658 6:32190042-32190064 GGGTGAACCCCCGGGGGAGCCGG - Exonic
1006942494 6:37762339-37762361 GGGTGCACCCGCGTGGGTGCAGG - Intergenic
1010178671 6:73058327-73058349 GCGTGAACCCCGGGGGGCGGAGG + Intronic
1017418469 6:154246859-154246881 TTGTTAACCCCCCGGGGAGCTGG + Intronic
1019573782 7:1726488-1726510 GCGTGAGGCCTCGGGGGAGCTGG - Intronic
1020585422 7:10059937-10059959 GCGTGAACCCCAGGGGGCGGAGG - Intergenic
1025087376 7:56034244-56034266 GGCTGAGCCCCCGGAGGAGGAGG - Intronic
1030941110 7:115650794-115650816 GCGTGAACCCCAGGGGGCGGAGG + Intergenic
1032787356 7:135211436-135211458 GCGTGAACCCGCGGAAGAGCAGG + Exonic
1034339127 7:150341053-150341075 GGGGGGAACCCCGTGGGAGCAGG - Exonic
1034461463 7:151200059-151200081 GGGTGGACCCCAGAGGGAGGAGG - Intronic
1035764940 8:2098433-2098455 GGGTGACCCCCCTTGGGTGCAGG + Intronic
1042533295 8:69835185-69835207 CGCTGAAGCCCCGAGGGAGCCGG + Intergenic
1044789988 8:95837492-95837514 GCGTGAACCCGCGGGGGCGGAGG - Intergenic
1045264453 8:100607314-100607336 GTGTGAACACCTGGGGCAGCTGG + Intronic
1049803122 8:144527277-144527299 GCGTGGAGTCCCGGGGGAGCGGG + Exonic
1050033979 9:1415605-1415627 TGGTGAAACCCAGTGGGAGCAGG + Intergenic
1050760096 9:9058530-9058552 GCGTGAACCCCAGGGGGCGGAGG - Intronic
1055423548 9:76169446-76169468 GGGAGAACCCACTGGGGATCAGG - Intronic
1058892483 9:109372743-109372765 GCCTCAACCCCCGGGGTAGCTGG - Intergenic
1059187417 9:112287421-112287443 GCTTGAACCCCCGGGGGCGGAGG - Intronic
1060177277 9:121506248-121506270 TGGTGAACACCTGGGGGATCAGG + Intergenic
1061169927 9:128946733-128946755 GGGTGAAGCAGCGGGGCAGCAGG + Exonic
1062338308 9:136082201-136082223 GGGTGAAGACCCTGGGGAGACGG - Intronic
1062656672 9:137607219-137607241 GGGGAAACCCCCGGGGGCCCCGG - Intronic
1192533660 X:71910868-71910890 GTGTGCAGCCCCGGGGGAGCCGG + Intergenic
1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG + Intergenic
1200909814 Y:8521615-8521637 GCGTGAACCCCAGGGGGCGGAGG - Intergenic