ID: 1006189159

View in Genome Browser
Species Human (GRCh38)
Location 6:32197023-32197045
Sequence GTGGACGCTCGCACAGAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006189159_1006189165 10 Left 1006189159 6:32197023-32197045 CCGTCCTCTGTGCGAGCGTCCAC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1006189165 6:32197056-32197078 CTGCTACGGAGCAGAAGCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 146
1006189159_1006189163 8 Left 1006189159 6:32197023-32197045 CCGTCCTCTGTGCGAGCGTCCAC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1006189163 6:32197054-32197076 GTCTGCTACGGAGCAGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 138
1006189159_1006189162 -4 Left 1006189159 6:32197023-32197045 CCGTCCTCTGTGCGAGCGTCCAC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1006189162 6:32197042-32197064 CCACTGCAGTTTGTCTGCTACGG 0: 1
1: 0
2: 0
3: 11
4: 121
1006189159_1006189164 9 Left 1006189159 6:32197023-32197045 CCGTCCTCTGTGCGAGCGTCCAC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1006189164 6:32197055-32197077 TCTGCTACGGAGCAGAAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 99
1006189159_1006189166 19 Left 1006189159 6:32197023-32197045 CCGTCCTCTGTGCGAGCGTCCAC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1006189166 6:32197065-32197087 AGCAGAAGCTGGGGAGACAGAGG 0: 1
1: 0
2: 5
3: 106
4: 969
1006189159_1006189167 20 Left 1006189159 6:32197023-32197045 CCGTCCTCTGTGCGAGCGTCCAC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1006189167 6:32197066-32197088 GCAGAAGCTGGGGAGACAGAGGG 0: 2
1: 1
2: 6
3: 89
4: 895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006189159 Original CRISPR GTGGACGCTCGCACAGAGGA CGG (reversed) Exonic
900218422 1:1494586-1494608 GTGGGCGCTGGCAGAGGGGACGG + Intronic
900225761 1:1533009-1533031 GTGGGCGCTTGCAGAGGGGACGG + Intronic
900523476 1:3117196-3117218 GGGGACGCTCTCATAGAGGCCGG - Intronic
900623442 1:3597617-3597639 TTGGACGCAGGCACAGGGGATGG + Intronic
908166316 1:61462855-61462877 CTGGAGGCTCCCACAGAAGATGG + Intergenic
918235289 1:182574454-182574476 GTGGACCACCCCACAGAGGAGGG - Exonic
1062951507 10:1507219-1507241 GTTGACGCTGCTACAGAGGAAGG + Intronic
1063313345 10:4977784-4977806 GTGGATGGTGACACAGAGGATGG + Exonic
1063314608 10:4989932-4989954 GTGGATGGTGACACAGAGGATGG - Exonic
1067685797 10:48465461-48465483 GTGGACGCTCACACCCCGGAAGG - Intronic
1070919988 10:80178536-80178558 GTGGATGGTCGCAGTGAGGAAGG - Intronic
1071598226 10:86943123-86943145 GTGGACGCGCACAAAGCGGAGGG - Exonic
1078182085 11:9020343-9020365 GTGGAAGCTTGCAACGAGGAAGG + Intergenic
1078271407 11:9798397-9798419 GTGGATGCTGGGACAGAAGAAGG + Intronic
1084422009 11:69065234-69065256 CTGGACGGTCACACAGAGGAGGG - Intronic
1084561790 11:69909700-69909722 GTGCACGCTGGCTCAGAGAAGGG - Intergenic
1089140810 11:116282364-116282386 GAGGAGGCACGGACAGAGGAAGG - Intergenic
1090627768 11:128620926-128620948 CTGGAGCCTCGCAGAGAGGAGGG - Intergenic
1091847878 12:3671260-3671282 GTGGTCTCTCCCAGAGAGGAAGG - Intronic
1093046639 12:14454104-14454126 GTGGACTCTTGTACACAGGAAGG + Intronic
1093898831 12:24606747-24606769 GTGGGAGCTGGCACAGATGAGGG + Intergenic
1097100951 12:56588962-56588984 GTGGACGCACCCTCAGAGCATGG + Exonic
1099128845 12:78800826-78800848 GTGAACCCTCCCACACAGGAGGG + Intergenic
1112662241 13:101523337-101523359 GCGGACTCTCACAAAGAGGATGG - Intronic
1112998572 13:105604296-105604318 TTGTAAGCTCGCACAGTGGAAGG + Intergenic
1117534267 14:56688962-56688984 GAGGCCTCTTGCACAGAGGAGGG - Intronic
1121888796 14:97570268-97570290 GTGGAATCTCGCACAGAGGAGGG - Intergenic
1122040371 14:98983572-98983594 GTGGCCCCTCCCACAGAAGAGGG + Intergenic
1122729023 14:103781320-103781342 GTGGATGTTCCCAGAGAGGACGG + Intronic
1125578188 15:40768969-40768991 GGGGACGCTGTCACAGAGCAAGG + Intronic
1134128981 16:11635700-11635722 GGGGACACTGGCCCAGAGGAAGG - Intronic
1136004354 16:27318467-27318489 GTGGAGGGACTCACAGAGGACGG + Intronic
1139282645 16:65783907-65783929 GTGGAGGCCCGGAGAGAGGAAGG - Intergenic
1139312814 16:66041596-66041618 GTGGAAGATGGCACAGAGGGGGG + Intergenic
1140761261 16:78111091-78111113 GTGGACTCACACTCAGAGGAGGG - Intronic
1142313789 16:89330394-89330416 GTGGCCGCTCGCACACCGGGAGG + Intronic
1142717660 17:1755759-1755781 CTGGGCTCTGGCACAGAGGAAGG - Intergenic
1143153018 17:4818725-4818747 GTGGAGGCTGGCAGAGGGGAGGG - Intronic
1143584624 17:7844998-7845020 GAGGACGCTCCCACGGAGGCCGG + Exonic
1146425983 17:32739444-32739466 GAGAACACTCGGACAGAGGAAGG + Intronic
1151694174 17:75705656-75705678 GTGCCCGCCCGCACAGGGGAAGG - Intronic
1152344465 17:79742783-79742805 GGGGAGGCTGGCACAGAGGCTGG + Intergenic
1160520781 18:79506907-79506929 GTGGACACTCACACACAGTAAGG + Intronic
1161322362 19:3647118-3647140 GTGCAGGCACTCACAGAGGAGGG + Intronic
1161322371 19:3647152-3647174 GTGCAGGCACTCACAGAGGAGGG + Intronic
1164686122 19:30167814-30167836 GTGGATGCAGGCACAGATGAAGG + Intergenic
1164872808 19:31660447-31660469 CTGGATCCTAGCACAGAGGAAGG + Intergenic
1167040143 19:47019199-47019221 GTAGTACCTCGCACAGAGGACGG - Intergenic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167740920 19:51324564-51324586 GTGGACGGTGGCACTGAGGTTGG - Intronic
925541432 2:4971921-4971943 GTGGACCATAGCACAGAGGGCGG + Intergenic
926782631 2:16488272-16488294 GTGGAGGTCCGCACTGAGGAAGG + Intergenic
931889987 2:66661424-66661446 GTGAACACCCGCACAGAGGCAGG - Intergenic
933909945 2:86930629-86930651 GTGAACACTCTCACAGAGGTAGG + Intronic
934583448 2:95466683-95466705 GTGGCTGCTCCCACAGAGCAGGG + Intergenic
934596004 2:95610031-95610053 GTGGCTGCTCCCACAGAGCAGGG - Intergenic
934786775 2:97015447-97015469 GTGGCTGCTCCCACAGAGCAGGG + Intronic
935396557 2:102616072-102616094 GTGGAAGCTGACACAGAGGAAGG - Intergenic
936702746 2:115033492-115033514 GAGGACCTTGGCACAGAGGAAGG - Intronic
936909017 2:117571656-117571678 GTGAATGCTTGCACAGAGGAAGG - Intergenic
940041528 2:149366602-149366624 GTGGAGGTTGGCCCAGAGGAAGG + Intronic
948587615 2:239029029-239029051 GAGGGCCCTCGCACGGAGGAGGG - Intergenic
948790603 2:240374636-240374658 CTGGACGCTGGCCCCGAGGAGGG + Intergenic
948972758 2:241441927-241441949 CTGGAAGCTCACACAAAGGAGGG - Intronic
1171419420 20:25007982-25008004 GTCCACGCTAGCACAGAGGCTGG - Intronic
1172780401 20:37433335-37433357 GTGGATGTCAGCACAGAGGAAGG + Intergenic
1175919708 20:62444988-62445010 GTGGCTGCTGGCACTGAGGAAGG + Intergenic
1176196018 20:63836570-63836592 GTGGCCCCTGGCACTGAGGATGG - Intergenic
1180173164 21:46071366-46071388 GTGGAGGAACCCACAGAGGAGGG + Intergenic
1180799383 22:18624692-18624714 GTGGCCGCTCTCATAGAGCAGGG + Intergenic
1181222335 22:21370574-21370596 GTGGCCGCTCTCATAGAGCAGGG - Intergenic
1184385569 22:44172452-44172474 GTGGACGCTCGGACAAGGGCAGG + Intronic
950276629 3:11666858-11666880 GTGGAGGGGAGCACAGAGGAGGG - Intronic
953979788 3:47407816-47407838 GTGGAGGGTGGCACAGAGGGAGG + Intronic
955677652 3:61465662-61465684 GACTACGCTTGCACAGAGGAAGG - Intergenic
961331988 3:126147832-126147854 GTTGATGCTCGCCCTGAGGATGG - Intronic
962352758 3:134667653-134667675 GTGGCCGCTCCCACAGTGGTGGG + Intronic
969091665 4:4698565-4698587 GTGGACTCTGGCTCAGAGCAGGG + Intergenic
969706063 4:8792444-8792466 ATGGACACACACACAGAGGAAGG + Intergenic
971395984 4:26227957-26227979 GGTGACGCTGGCACAGAGGCAGG - Intronic
973365978 4:49210050-49210072 GTGAACGCCCGCAGGGAGGAAGG - Intergenic
973394620 4:49582401-49582423 GTGAACGCCCGCAGGGAGGAAGG + Intergenic
978530208 4:109704558-109704580 CTGGAAGCTAGCAGAGAGGATGG + Intergenic
986669370 5:10129208-10129230 GAGGACACTTGCACACAGGATGG + Intergenic
990042046 5:51387792-51387814 GTGGCCGCTGGCACACAGGCTGG - Intronic
990798044 5:59566281-59566303 GTGGAGGCAGGCACAGAGGTGGG - Intronic
996472391 5:123875862-123875884 AGGGACGCTCGCAGAGAGGAGGG + Intergenic
1002070904 5:176678480-176678502 GAGGAGGCTGGGACAGAGGAAGG + Intergenic
1003631451 6:7791305-7791327 GTGGACGCAAACACAGAGGAGGG - Intronic
1006189159 6:32197023-32197045 GTGGACGCTCGCACAGAGGACGG - Exonic
1007830815 6:44637005-44637027 GTGGCTGCAGGCACAGAGGATGG - Intergenic
1013498532 6:110723058-110723080 GTGCACACTCAGACAGAGGAGGG - Intronic
1019301982 7:310018-310040 GTGGAGACTCGCAGAGACGATGG - Intergenic
1029648559 7:101874463-101874485 CAGGACACACGCACAGAGGAAGG + Intronic
1032522946 7:132560217-132560239 TTGGAGGCACGCACCGAGGAAGG + Intronic
1047211864 8:122847217-122847239 GGGGAAGCTCACACAGAGGACGG - Intronic
1049345491 8:142136504-142136526 GTGAAGGCACCCACAGAGGATGG - Intergenic
1050491593 9:6194420-6194442 GTGGGCCCTGGCACATAGGAAGG - Intergenic
1059191727 9:112333485-112333507 ATGGAGGCGCGCACAGAGCAGGG + Intronic
1061492916 9:130956195-130956217 GTGGCCGCCCCCACTGAGGAGGG + Intergenic
1061572254 9:131485035-131485057 CTGGAGGCACCCACAGAGGATGG - Exonic
1193250851 X:79289151-79289173 GTGAATGCCCGCACAGAGGCAGG + Intergenic
1196130594 X:112151199-112151221 GTGCACGGTCTCACAGAGCATGG + Intergenic