ID: 1006189775

View in Genome Browser
Species Human (GRCh38)
Location 6:32200836-32200858
Sequence CTGGCTGTCCACCCTCATGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006189775_1006189780 -3 Left 1006189775 6:32200836-32200858 CCTGCATGAGGGTGGACAGCCAG 0: 1
1: 0
2: 0
3: 23
4: 236
Right 1006189780 6:32200856-32200878 CAGCAGTGGTCCAGGCAGCAGGG 0: 1
1: 0
2: 4
3: 58
4: 463
1006189775_1006189783 6 Left 1006189775 6:32200836-32200858 CCTGCATGAGGGTGGACAGCCAG 0: 1
1: 0
2: 0
3: 23
4: 236
Right 1006189783 6:32200865-32200887 TCCAGGCAGCAGGGGCTCCAGGG 0: 1
1: 0
2: 5
3: 61
4: 511
1006189775_1006189779 -4 Left 1006189775 6:32200836-32200858 CCTGCATGAGGGTGGACAGCCAG 0: 1
1: 0
2: 0
3: 23
4: 236
Right 1006189779 6:32200855-32200877 CCAGCAGTGGTCCAGGCAGCAGG 0: 1
1: 0
2: 5
3: 33
4: 398
1006189775_1006189781 -2 Left 1006189775 6:32200836-32200858 CCTGCATGAGGGTGGACAGCCAG 0: 1
1: 0
2: 0
3: 23
4: 236
Right 1006189781 6:32200857-32200879 AGCAGTGGTCCAGGCAGCAGGGG 0: 1
1: 0
2: 4
3: 47
4: 414
1006189775_1006189782 5 Left 1006189775 6:32200836-32200858 CCTGCATGAGGGTGGACAGCCAG 0: 1
1: 0
2: 0
3: 23
4: 236
Right 1006189782 6:32200864-32200886 GTCCAGGCAGCAGGGGCTCCAGG 0: 1
1: 0
2: 1
3: 48
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006189775 Original CRISPR CTGGCTGTCCACCCTCATGC AGG (reversed) Exonic
900528064 1:3138816-3138838 CCGGCTGTGTGCCCTCATGCAGG - Intronic
900600008 1:3498888-3498910 CTGGCTTTCCAGCCCCATGTTGG + Intronic
901027311 1:6285421-6285443 CAGGCTCTCCACCCTTTTGCAGG - Intronic
901039842 1:6357346-6357368 CTGGCTGTGCACCTTCAGGTGGG - Intronic
901878599 1:12181096-12181118 CTGGCAGTTCACCCCCAGGCTGG - Intronic
902579026 1:17396810-17396832 CAGGCTATTCCCCCTCATGCTGG + Intronic
904943969 1:34185617-34185639 CTGGCAGTCCCCCTTCATGATGG + Intronic
905063568 1:35160442-35160464 CTGCCTGTCCAACCTCAGCCAGG + Intergenic
905924532 1:41740299-41740321 CTGGCTGCCCAGCCTCCAGCAGG - Intronic
908816460 1:68040362-68040384 CTGTCTGTCCAACCTCAGGCTGG + Intergenic
910238978 1:85065515-85065537 CTGCCTGTCCAACCTCAGACTGG - Intronic
912971913 1:114291613-114291635 CTGGCTTTCCAAGCTCAAGCCGG - Intergenic
915231380 1:154448150-154448172 CGAGGTGTCCACCCCCATGCAGG + Exonic
915343117 1:155186955-155186977 TTGGCCGTCCACATTCATGCTGG - Intronic
919739735 1:200974415-200974437 CTGGCTGTCTTCCCCCGTGCAGG - Intronic
920210026 1:204321228-204321250 CATGCTGTGCACCCTCAGGCAGG + Intronic
920253911 1:204641186-204641208 CTGGCTATCCAACCTCAGACTGG + Intronic
1063141805 10:3262490-3262512 CTGCCTGTCCAGCCTCAGACAGG - Intergenic
1063245108 10:4209548-4209570 TTGGCTGCCCACCCTTATTCTGG + Intergenic
1067460708 10:46456246-46456268 CTCTCTGTCCACCCTGATACTGG - Intergenic
1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG + Intergenic
1068692470 10:59931135-59931157 CTCACTGTCCACCCTCAAGTAGG + Intergenic
1073042069 10:100614637-100614659 CTGGCTGTGCACGCACATGTTGG + Intergenic
1073852888 10:107641784-107641806 CTGGTTGACCACACTAATGCAGG - Intergenic
1074016133 10:109536011-109536033 CTGGCTGTCTGCCCTCATAGAGG - Intergenic
1074357690 10:112800418-112800440 CTGGCTGTACCCCCACATGCAGG - Intronic
1074540847 10:114364220-114364242 CTGGCAGTCACCCCTCATGTGGG + Intronic
1074979372 10:118607595-118607617 CTCCCTGTCCACCCTCATGTAGG + Intergenic
1075216152 10:120537921-120537943 CTGGGTGTCCATCCTCAGCCAGG + Intronic
1075730930 10:124636462-124636484 CCGGCTAACCACCCACATGCAGG - Intronic
1076749308 10:132534493-132534515 CTGCCTGTCCAGCCTCAGACTGG + Intergenic
1077037409 11:502145-502167 CTGGATGTCCAGGCTCATGGTGG + Exonic
1077118303 11:895336-895358 CTGGGTGTCCACCCACAGTCAGG + Intronic
1077316046 11:1919811-1919833 GGGGCTGTCCACCCGCACGCAGG - Intronic
1077411954 11:2407817-2407839 CTGGCTGGTCATCCTCCTGCTGG - Exonic
1078460452 11:11511265-11511287 CCGGCTGTCCAGCTTCACGCAGG + Intronic
1078663657 11:13306906-13306928 GTGGCTGTGCCCCCTCAGGCAGG - Intronic
1078885495 11:15495919-15495941 CAGAATGTCCACCTTCATGCCGG + Intergenic
1079583044 11:22089839-22089861 CTGCCTTTCCACCCTCAGACTGG - Intergenic
1079697208 11:23496406-23496428 CTGGCTCTCCAGCCTCTTCCTGG + Intergenic
1085322122 11:75581715-75581737 CTCGCTTTCCACACTCCTGCTGG + Intergenic
1089011268 11:115133731-115133753 GTGGCTGTCTACGCTCAAGCAGG - Intergenic
1090271527 11:125389442-125389464 GTGGCTTTCCACCCTCATGGTGG + Intronic
1091314383 11:134601647-134601669 CTGCCTTTCCACTCTCATGATGG - Intergenic
1091391837 12:130654-130676 CTGGCTGCCCACTCCCAGGCAGG + Intronic
1091761196 12:3088471-3088493 CTGGCTGTCACCCATCATCCAGG + Intronic
1094479839 12:30872905-30872927 CTGTCTGTCAACCTTCATGGTGG - Intergenic
1094799729 12:34019186-34019208 CTGCCTGTCCAACCTCAAACTGG + Intergenic
1095112518 12:38313505-38313527 CTGCCTGTCCAACCTCAAACTGG + Intergenic
1095442028 12:42247053-42247075 CTAGCTGTGCAGCCTCCTGCTGG + Intronic
1100307691 12:93366209-93366231 CTGGCTGCCCACTCTAATGCTGG - Intergenic
1102029110 12:109729930-109729952 CTAGCTGTGCAGCCTCAGGCAGG - Intronic
1103906564 12:124330722-124330744 CTGGGTGTACCCCCTCATTCTGG - Intronic
1105723041 13:23135142-23135164 CAGGCTGTCCAACCTAGTGCAGG - Intergenic
1106899527 13:34340607-34340629 CAGGCTGCCCACACTCATGGTGG + Intergenic
1106901984 13:34363336-34363358 CTGGCTGTGAGCCCTCAAGCAGG - Intergenic
1107748308 13:43536775-43536797 CCAGCTGTTCACCCTTATGCTGG + Intronic
1109670525 13:65600754-65600776 CTGGCAGTCCACTCTGTTGCAGG + Intergenic
1110512237 13:76364459-76364481 CTGCCTGTCCAACCTCAGACTGG - Intergenic
1114455521 14:22851044-22851066 CTGGCTGCCCAGCCCCTTGCAGG - Intergenic
1115455256 14:33594602-33594624 CTGCCTGCCCAGCCTCCTGCTGG + Intronic
1117292388 14:54346223-54346245 CTGGGAGTCAACCCTCCTGCAGG + Intergenic
1119132527 14:72187590-72187612 CAGGGTGTCCTCCTTCATGCTGG - Intronic
1119957290 14:78812391-78812413 GAGGCTTTCCACCTTCATGCTGG - Intronic
1121497907 14:94409699-94409721 CTGCCTGTCCAACCTCAGACTGG - Intergenic
1121863753 14:97343102-97343124 CTGGTTCTCCACCTTCATGTGGG + Intergenic
1122932726 14:104942149-104942171 TTGGATGTCCACCTCCATGCTGG + Exonic
1122932959 14:104943139-104943161 CTGGACGTCCACCTCCATGCTGG + Exonic
1122933885 14:104947099-104947121 CTGGACGTCCACCTCCATGCTGG + Exonic
1122933997 14:104947594-104947616 CTGGACGTCCACCTCCATGCTGG + Exonic
1122934344 14:104949079-104949101 CTGGACGTCCACCTCCATGCTGG + Exonic
1122934702 14:104950564-104950586 CTGGACGTCCACCTCCATGCTGG + Exonic
1122935287 14:104953039-104953061 CTGGACGTCCACCTCCATGCTGG + Exonic
1123104720 14:105835433-105835455 CGGGCTGTCCAACCTCAGACTGG - Intergenic
1123990726 15:25681311-25681333 CTGTCTGTCCAACCTCAAACAGG + Intronic
1126846262 15:52763196-52763218 CTGCTTGCCCACCCTCATGGAGG - Intronic
1128934452 15:71733312-71733334 TTTGCTGTGCACCCTCAGGCGGG + Intronic
1129672639 15:77615819-77615841 CTGGCAGCCCATCCTCCTGCTGG - Exonic
1130062355 15:80579026-80579048 CTGCCTGTCCACACTAAGGCAGG + Intronic
1130236010 15:82134149-82134171 CAGGCTGTCCACACAGATGCAGG - Intronic
1130396714 15:83508780-83508802 CTGGTTGGCCACCATCATGTTGG + Intronic
1131091664 15:89628682-89628704 CTGGCTGTCCCCCCTCACTGAGG - Exonic
1132556780 16:576089-576111 TGTGCTGGCCACCCTCATGCCGG + Intronic
1133110376 16:3544527-3544549 CTGGCGGTTCAGACTCATGCAGG - Intronic
1133113783 16:3564660-3564682 CAGGCTGGCCTCCCTCCTGCTGG - Exonic
1135541603 16:23334132-23334154 GTGGCTGTCCACCCTGTTGGGGG - Intronic
1136064582 16:27750101-27750123 CTGGCTGGCCCCCTTCACGCGGG + Exonic
1137276975 16:46941625-46941647 CTGCCTGTCCAACCTCAGACTGG - Intergenic
1137299809 16:47137997-47138019 CTGGCACTCCAGCCTCATACTGG - Intronic
1138440180 16:57029679-57029701 CAGGATGGCCACCCTCATGTGGG - Intronic
1139280098 16:65763416-65763438 CTGTGTGTCCAACCCCATGCTGG + Intergenic
1139321724 16:66119721-66119743 CAGGCTGTACATCCTCCTGCAGG - Intergenic
1142434720 16:90048871-90048893 CAGCCAGTCCACCATCATGCGGG - Intergenic
1142750158 17:1982714-1982736 CTGGCGGTCCACCTCCATGCAGG - Intronic
1143794500 17:9325835-9325857 CTGGCTGGCCACGCTCTAGCTGG - Intronic
1144721193 17:17470929-17470951 CTGGCTGCCCTCCTTCCTGCTGG - Intergenic
1146209299 17:30929606-30929628 CAGGGTTTCCACCCTCATGGTGG + Intronic
1146654222 17:34625975-34625997 CTGGCTGTCCATCCTCCGGTGGG - Intronic
1149382835 17:56110964-56110986 CTGGCTGGGCAGCCTCAAGCTGG + Intronic
1149813370 17:59699784-59699806 CTGGCTTGCCACCTTCATGCTGG + Exonic
1150338127 17:64344703-64344725 CTGGCTCTCCACCCACAGGAAGG + Intronic
1151856490 17:76726030-76726052 CTGGCTGTCAAGGCTCATGGGGG - Intronic
1151960375 17:77402533-77402555 CTGGATCTCCACCCTCTTGGGGG - Exonic
1152374754 17:79913379-79913401 CAGGGTGGCCACCCTTATGCTGG + Intergenic
1154309850 18:13258960-13258982 CCTGCTGTCCAGCATCATGCTGG - Intronic
1155131282 18:22937208-22937230 CTGACCCTCCACCCTCATGTAGG + Intronic
1158543845 18:58379268-58379290 GATGCTGTCCACCCTCATGACGG + Intronic
1159832413 18:73293581-73293603 CTGGCTTTCCATCCTGATGATGG + Intergenic
1159965075 18:74587333-74587355 CTCACTGTTCACACTCATGCTGG + Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161861548 19:6801792-6801814 CTGGCTTTCCACGCTCCTTCGGG - Intronic
1162154720 19:8669717-8669739 CTGGCTGTGCGACCTCAGGCAGG + Intergenic
1163592135 19:18199982-18200004 CTGGCCTTCCACACTCATTCTGG - Intronic
1165945789 19:39441435-39441457 CTGGCTGGCCACCCACAGCCGGG - Intronic
1166068998 19:40376945-40376967 CTGCCTGTGCCCCCTCATCCCGG - Intronic
1167744643 19:51343347-51343369 CTGGCTGTGCAACCTCCTGCAGG - Intergenic
1167764758 19:51474399-51474421 CTTACTGTCCACCCTCAAGGAGG + Intergenic
925275070 2:2643039-2643061 CTGGCTGTCCATCCCCTAGCTGG - Intergenic
926623303 2:15068152-15068174 CTGGCTGTATAGCCTCAGGCAGG + Intergenic
927341658 2:21990373-21990395 CTTGCTCTCCAACCTCATGCTGG + Intergenic
928324543 2:30309207-30309229 CAGACTGGCCACCCTCCTGCAGG + Intronic
928453981 2:31403011-31403033 CTGGCTGACCACCCACATGGGGG - Intronic
931244402 2:60480360-60480382 CTGACTGTCCAGCACCATGCTGG + Intronic
931459347 2:62436828-62436850 CAGGCTGGCCACCCTCAGGCTGG + Intergenic
932347835 2:71007298-71007320 CTGGCTTTCCACCCCTCTGCTGG + Intergenic
932577354 2:72970130-72970152 ATGGCTGTCCTCCCTCAGGGGGG + Intronic
935527198 2:104184623-104184645 CTGCCTGACTACCTTCATGCTGG + Intergenic
935675534 2:105592352-105592374 CAATCTGTCCACCCTCATGCTGG + Intergenic
936473608 2:112820530-112820552 CTGCCTGTCCAACCTCAGACTGG - Intergenic
937479081 2:122240683-122240705 CATGCTGTCCACCCTGGTGCTGG + Intergenic
941740779 2:169033010-169033032 CTTCCTCTGCACCCTCATGCTGG + Intergenic
946247103 2:218394155-218394177 CAGCATGCCCACCCTCATGCAGG + Exonic
946556143 2:220859861-220859883 CTGCCTGTCCAACCTCAGACTGG - Intergenic
947718535 2:232353701-232353723 CTGCCTGTCCAGCCTCAGACTGG + Intergenic
947730010 2:232422632-232422654 CTGCCTGTCCATCCTCAAACTGG + Intergenic
948280739 2:236746102-236746124 CCACCTGGCCACCCTCATGCTGG - Intergenic
948699090 2:239749366-239749388 GGGGCTGTCCACCCCCAGGCTGG - Intergenic
948896225 2:240929041-240929063 CTGGCTGTACACCCTCCAGAGGG - Intronic
1169325871 20:4676042-4676064 CTGCCTGTCCAACCTCAGACTGG + Intergenic
1172441987 20:34972228-34972250 CTGCCTGTCCACCCTCACCTTGG + Intergenic
1172602695 20:36194810-36194832 CTGTGTGTACACGCTCATGCAGG + Intronic
1173059846 20:39650866-39650888 CTGGCTCTCCTCCCTCTTCCTGG + Intergenic
1173138540 20:40461503-40461525 CAGCCTGTCCACTCTCATCCAGG + Intergenic
1174048677 20:47752030-47752052 AGTGCTGTCCACGCTCATGCAGG - Intronic
1174501820 20:50990739-50990761 CTGTCTGCTCACCCGCATGCAGG - Intergenic
1175860723 20:62148764-62148786 CTGGCCATACACCCTCTTGCTGG + Intronic
1177729811 21:25014198-25014220 CTGCCTGTGCACCCTCAGACTGG + Intergenic
1180257637 21:46643570-46643592 CTGGCTGTACTCCCTCCTGCAGG - Exonic
1183806891 22:40219412-40219434 CCTCCTGTCCACCCTCCTGCTGG - Intronic
1184278925 22:43426318-43426340 CTGGGTGCCCACCCCCAAGCTGG + Intronic
1184470874 22:44695393-44695415 CTGCCTGTCCAACCTCGGGCTGG - Intronic
1184822624 22:46921237-46921259 CCCGCTCTCCACCCTCAGGCAGG + Intronic
1184839550 22:47044396-47044418 CACGCTGTCCACCCTCACCCAGG - Intronic
1185331233 22:50252876-50252898 CTGGCTGTGCGTCCTCATGCCGG - Intronic
949549752 3:5103079-5103101 CTGCCTGTCCAACCTCAGACTGG - Intergenic
951615907 3:24543715-24543737 CTGCCTGTCCAACCTCAGACTGG - Intergenic
952467949 3:33611238-33611260 CTGCCTGTCCAACCTCAAGTTGG + Intronic
953857393 3:46509986-46510008 CTGTCTGCCCACCCACATGGGGG + Intergenic
953920217 3:46946617-46946639 CAGGGTGTCGGCCCTCATGCTGG - Intronic
954675910 3:52315327-52315349 CTGGCTGGCCAGCCACATGAAGG + Intergenic
954705405 3:52477861-52477883 ATGGCTGTCCACCTTCAGGACGG - Intronic
955545900 3:60029828-60029850 CTGCCTGTCCAACCTCTTTCTGG - Intronic
958982120 3:100733999-100734021 CTGCCTGTCCAACCTCAGACTGG - Intronic
960518326 3:118626599-118626621 CAGTCTGAGCACCCTCATGCCGG - Intergenic
960803433 3:121561062-121561084 CTGCCTGTCCAACCTCAGACTGG + Intergenic
961877552 3:130035228-130035250 CTGGATGTCCACGCTCATCTTGG + Intergenic
965347989 3:167575963-167575985 ATGGCTTTTCACCCTCTTGCTGG + Exonic
967274896 3:187764758-187764780 CTGGCTGTCAATCAGCATGCAGG - Intergenic
967906567 3:194506267-194506289 CTGGCTGTTCAACCTCAAACTGG + Intergenic
968703992 4:2069680-2069702 CTGGGGGTCCACCCCCATCCTGG - Intergenic
969486434 4:7474886-7474908 CTGGCTGTCCCACCTCCTGGTGG + Intronic
972802665 4:42493689-42493711 CTGGCTGTCTTTCCTCAGGCAGG + Intronic
978714963 4:111831044-111831066 CTGGATTTCCACTCTCATGAGGG + Intergenic
979145294 4:117239664-117239686 GTGGCTGTCCTCCCAGATGCAGG + Intergenic
979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG + Intergenic
981444790 4:144823138-144823160 CTCGCTCTCCACCCTCAAGTAGG + Intergenic
981490194 4:145331294-145331316 CTGGCTGCCTCCCCTCCTGCTGG - Intergenic
983522078 4:168719728-168719750 CCCGCTCTCCACCCTCAAGCAGG + Intronic
985070040 4:186158643-186158665 CTGGGTCTCCACCCTCAACCTGG - Intronic
985427892 4:189847859-189847881 CTGGGGGTCCACAGTCATGCAGG + Intergenic
985561221 5:587075-587097 CTGGCTGAACATCCTCAAGCTGG + Intergenic
986213113 5:5692651-5692673 CTGCCTGTCCAACCTCAGACTGG + Intergenic
995797034 5:115952283-115952305 CTGCCTGTCCAACCTCAGACTGG + Intergenic
997339754 5:133134062-133134084 CTGGCTGTTCACTCTGATGGTGG + Intergenic
997418698 5:133749339-133749361 CTGGCTGGAAACCCTCAGGCTGG - Intergenic
998200502 5:140114366-140114388 CTGGATGTCCACCCGCTTGGAGG - Exonic
998252368 5:140561752-140561774 CTGACTTTCCAGCCTCCTGCAGG - Intronic
999199567 5:149806154-149806176 CTGCCTGTCCACCCACCTGAGGG + Intronic
1000133344 5:158320842-158320864 CTGGCTGGCCACCGGCATGTTGG - Intergenic
1002290426 5:178196680-178196702 CTGTCTCTCCACCATCCTGCAGG - Intergenic
1003222446 6:4173204-4173226 CTGGCCCTCTACCCTCAAGCAGG + Intergenic
1004427340 6:15515306-15515328 CCAGCTGTCCATCCTCTTGCTGG + Intronic
1004545763 6:16596992-16597014 CTGGCTGTGCACTCACCTGCAGG + Intronic
1006152355 6:31996287-31996309 ATGGCTCTGCACCCTCATCCTGG - Exonic
1006158656 6:32029025-32029047 ATGGCTCTGCACCCTCATCCTGG - Exonic
1006189775 6:32200836-32200858 CTGGCTGTCCACCCTCATGCAGG - Exonic
1006375636 6:33670345-33670367 CTGGCGGTCCAAGCACATGCGGG - Exonic
1006956523 6:37878334-37878356 CTGTCTGTCCAAACTCATTCAGG - Intronic
1007238104 6:40405608-40405630 GTGGCTGGCAAACCTCATGCAGG + Intronic
1008845868 6:55963493-55963515 CTGCCTGTCCAACCTCCAGCTGG + Intergenic
1011235999 6:85217792-85217814 CTTGCTCTCCACCCTCAGACAGG - Intergenic
1011440733 6:87384332-87384354 CTGCCTGTCCAACCTCAGGCTGG - Intronic
1012583181 6:100892911-100892933 CTGGCTGGCCAGACTCCTGCTGG + Intergenic
1014850488 6:126334754-126334776 CTGCCTGTCCAACCTCAGACTGG + Intergenic
1015046727 6:128785214-128785236 CTGGCTGTCAACCCTCAGACTGG - Intergenic
1015835634 6:137417251-137417273 CTGGCCTTCCACCCTGATTCAGG - Intergenic
1017110718 6:150929576-150929598 CTGGGCCTCCAGCCTCATGCTGG + Intronic
1018204185 6:161421491-161421513 CTCTCTATCCACCCTCATGCTGG - Intronic
1019616599 7:1965775-1965797 CTCCCTGTCCTCCCTCCTGCAGG + Intronic
1019631129 7:2050406-2050428 CTGGCTCACCACCCTCAGCCTGG - Intronic
1019706841 7:2500785-2500807 CGTGCTGTCCACCCTAATCCAGG + Intergenic
1020144782 7:5634164-5634186 CTGGCTGTCCACGTGCCTGCTGG + Intronic
1021869261 7:24987444-24987466 CTGCCTGTCCAACCTCAAACTGG - Intergenic
1022223841 7:28342674-28342696 CTGTCTGTTCCACCTCATGCTGG + Intronic
1022877779 7:34552776-34552798 CTGCCTGTACACACACATGCTGG - Intergenic
1024470221 7:49761782-49761804 CTGCCTGTCCAGCCTCTGGCTGG - Intergenic
1026968009 7:74452850-74452872 CTGGCTGTCTTCACTCATTCCGG - Intergenic
1027523705 7:79241408-79241430 CTGTCTGTCCTCCCTTATTCTGG + Intronic
1030278259 7:107743325-107743347 CTGGCTCTCCACCCTCCATCCGG + Intergenic
1030816729 7:114048465-114048487 CTGGCGGTGGACCCTGATGCTGG + Intronic
1032711364 7:134463243-134463265 CTGTGTGTCCTCCCTCAAGCAGG + Intergenic
1033344379 7:140515899-140515921 CTGCCTGTCCAGCCTCAGACTGG - Intergenic
1034936531 7:155203910-155203932 CTGTCTGTCCACCCCAAGGCAGG - Intergenic
1035258206 7:157645643-157645665 CGGGCTGTACACACTCATGCAGG + Intronic
1036845646 8:12168276-12168298 CTTGCTGTCCTACCTCATGAAGG + Intergenic
1036867014 8:12410595-12410617 CTTGCTGTCCTACCTCATGAAGG + Intergenic
1038019584 8:23541613-23541635 CTGGCTGGCCAGCTTCCTGCAGG - Intronic
1038189350 8:25304875-25304897 CTGGCTTTCCCCCAACATGCAGG - Intronic
1039573583 8:38605836-38605858 CTGGCTGGCAACCCTCGAGCAGG - Intergenic
1040959414 8:53015348-53015370 CTGCCTGTCCAACCTCAGACTGG + Intergenic
1044946410 8:97393868-97393890 CTGGCTTTCCCCCTGCATGCTGG - Intergenic
1045057843 8:98384723-98384745 CAGGGTGCCCACCCTCCTGCTGG + Intergenic
1046180468 8:110639531-110639553 CTGGCTCTCCACCATCCTCCAGG - Intergenic
1046444837 8:114304630-114304652 CTCGCTCTTCACCCTCAAGCAGG - Intergenic
1049574154 8:143382739-143382761 ATGCCTGTCCCGCCTCATGCTGG + Exonic
1049709773 8:144058260-144058282 CAGGCTGGCCACCCTCCTGCTGG + Exonic
1052766898 9:32650677-32650699 ATGGTGGTCCACCCTCCTGCTGG - Intergenic
1054830258 9:69617085-69617107 CTGCCTGTCCAACCTCAGACTGG + Intronic
1056973985 9:91233729-91233751 CTGCCTGTCCAGCCTCAGGCTGG - Intronic
1057078797 9:92156393-92156415 CTGCCTGTCCAACCTCAGACTGG - Intergenic
1057950936 9:99368636-99368658 CTGGCTGACCCCCCTCCTGCTGG - Intergenic
1058371790 9:104277352-104277374 CTGAGTGTGCACCCTCCTGCAGG + Intergenic
1058732310 9:107862046-107862068 CCAGCTGTCTATCCTCATGCTGG - Intergenic
1060169976 9:121453445-121453467 CTGGAGCTTCACCCTCATGCTGG - Intergenic
1060337087 9:122735304-122735326 CTGGCCCTCCACCCTCAGGTAGG - Intergenic
1060397229 9:123324829-123324851 CTGGCTGTCCACCCGCACCCAGG + Intergenic
1060940246 9:127539328-127539350 CTGGTTTTCCACTCTCTTGCTGG + Intronic
1061512018 9:131067323-131067345 AAGGCTGTCCAGCCTCAGGCAGG + Intronic
1062038022 9:134391328-134391350 CAGGCTTTCCACCCTCAGGGCGG - Intronic
1062483295 9:136762364-136762386 CTTGCTGTCAGCCCTCAGGCTGG - Intronic
1062645786 9:137547472-137547494 CTGGCTGCCCAACCACAGGCTGG + Intronic
1185754097 X:2638961-2638983 CTGGCTGTCCAAACTCAGACTGG - Intergenic
1186531325 X:10298822-10298844 CTGCCTGTCAACCTGCATGCTGG - Intergenic
1190477603 X:50843275-50843297 CTGTCTGAGCACACTCATGCAGG + Intergenic
1192221146 X:69198066-69198088 CTAGCTGTGCAACCTCAGGCAGG - Intergenic
1192321332 X:70092858-70092880 CTGGCTCTGCTCCCTCATCCTGG - Intergenic
1196798188 X:119519204-119519226 CTGCCTGTCCAGCCTCAGACTGG - Intergenic
1197809168 X:130426339-130426361 TTGGCTGTGCAACCTCAGGCAGG + Intergenic
1197838388 X:130719419-130719441 GTGGCTGTCCAGCCTCAAGCTGG - Intronic
1200932730 Y:8711732-8711754 CTGGCTGTGCTCCAGCATGCGGG - Intergenic