ID: 1006190138

View in Genome Browser
Species Human (GRCh38)
Location 6:32202403-32202425
Sequence TTGTATAGGCATGGGGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 811}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006190126_1006190138 8 Left 1006190126 6:32202372-32202394 CCCCAAGCCCGTGGTCTCTGAGC 0: 1
1: 0
2: 3
3: 20
4: 778
Right 1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG 0: 1
1: 0
2: 2
3: 41
4: 811
1006190124_1006190138 10 Left 1006190124 6:32202370-32202392 CCCCCCAAGCCCGTGGTCTCTGA 0: 1
1: 0
2: 5
3: 43
4: 159
Right 1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG 0: 1
1: 0
2: 2
3: 41
4: 811
1006190129_1006190138 1 Left 1006190129 6:32202379-32202401 CCCGTGGTCTCTGAGCAGCTGCC 0: 1
1: 1
2: 7
3: 37
4: 320
Right 1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG 0: 1
1: 0
2: 2
3: 41
4: 811
1006190125_1006190138 9 Left 1006190125 6:32202371-32202393 CCCCCAAGCCCGTGGTCTCTGAG 0: 1
1: 0
2: 6
3: 591
4: 1944
Right 1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG 0: 1
1: 0
2: 2
3: 41
4: 811
1006190127_1006190138 7 Left 1006190127 6:32202373-32202395 CCCAAGCCCGTGGTCTCTGAGCA 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG 0: 1
1: 0
2: 2
3: 41
4: 811
1006190123_1006190138 16 Left 1006190123 6:32202364-32202386 CCTGGGCCCCCCAAGCCCGTGGT 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG 0: 1
1: 0
2: 2
3: 41
4: 811
1006190128_1006190138 6 Left 1006190128 6:32202374-32202396 CCAAGCCCGTGGTCTCTGAGCAG 0: 1
1: 0
2: 1
3: 18
4: 184
Right 1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG 0: 1
1: 0
2: 2
3: 41
4: 811
1006190130_1006190138 0 Left 1006190130 6:32202380-32202402 CCGTGGTCTCTGAGCAGCTGCCA 0: 1
1: 0
2: 3
3: 34
4: 327
Right 1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG 0: 1
1: 0
2: 2
3: 41
4: 811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006190138 Original CRISPR TTGTATAGGCATGGGGAGGG AGG Exonic
901012652 1:6210209-6210231 TCGTATTGGCTGGGGGAGGGGGG - Exonic
901152558 1:7113483-7113505 GTGTCTAGGAATGGAGAGGGAGG + Intronic
901386896 1:8916265-8916287 TTGTCAAGGGATGGGGAGGGGGG + Intergenic
903331261 1:22598235-22598257 TTGCATGGGCTTGGGGAGGGAGG + Intronic
903607353 1:24584660-24584682 TGGGCTAGGCATGGGGTGGGCGG + Intronic
905710165 1:40095443-40095465 TTGTAGAGGCATTTGGAGTGTGG - Intronic
905744808 1:40406008-40406030 TTTTATAGGCCTGGGGTTGGGGG + Intronic
906014389 1:42561560-42561582 TTGAATAGGTATGGTGAGAGAGG - Intronic
906116510 1:43360634-43360656 GTGTACAGTCAAGGGGAGGGTGG - Intronic
906173003 1:43743845-43743867 TAATATAGGAATGGGGGGGGGGG - Intronic
907799717 1:57752395-57752417 TTCTAGAGGCATGGGGTGTGGGG + Intronic
907958495 1:59254903-59254925 TTGAATAGGAATGGTGAGAGAGG - Intergenic
908878654 1:68706366-68706388 GTTTATGGGGATGGGGAGGGTGG + Intergenic
908937302 1:69391486-69391508 GTGAATAGGAATGGTGAGGGGGG + Intergenic
908939746 1:69417344-69417366 TTGAATAGGAATGGTGAGAGAGG + Intergenic
909666008 1:78134436-78134458 TGGCATGGGAATGGGGAGGGAGG - Intronic
909689772 1:78394280-78394302 TTGAATAGGAATGGTGAGAGAGG + Intronic
909822529 1:80084412-80084434 TTTTAGAGGAATGGGGAGGGTGG + Intergenic
910853874 1:91674621-91674643 TTCCATAAACATGGGGAGGGAGG + Intergenic
911358200 1:96846644-96846666 TGGAATAGGGATGGGGAGGGAGG + Intergenic
911750067 1:101486502-101486524 TTATCTTGGCATGGGGAGAGGGG - Intergenic
912279720 1:108300297-108300319 TTGAATAGGAGTGGCGAGGGAGG + Intergenic
912288506 1:108394060-108394082 TTGAATAGGAGTGGCGAGGGAGG - Intronic
913355739 1:117919869-117919891 TTGCTTGGGGATGGGGAGGGAGG + Intronic
913512889 1:119578293-119578315 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
914863825 1:151408651-151408673 TTTTATAGGCCCAGGGAGGGAGG - Intronic
914994401 1:152529265-152529287 TTGAATAGGGATGGTGAGAGAGG + Intronic
915304775 1:154970915-154970937 TTGTATAGGGCAGGGGAGAGGGG - Intronic
915618883 1:157066393-157066415 TTGAATAGGAATGGTGAGAGAGG + Intergenic
915816080 1:158966815-158966837 TTGAATAGGAATGGTGAGGGAGG - Intronic
916530220 1:165649439-165649461 TTACATAGGGAGGGGGAGGGAGG - Intronic
916985544 1:170187559-170187581 TTGAATAGGAATGGTGAGAGAGG + Intergenic
917263782 1:173197677-173197699 TTGCAGGGGCAAGGGGAGGGAGG + Intronic
918159742 1:181887144-181887166 TTGAAAAGGAGTGGGGAGGGAGG + Intergenic
918616221 1:186547338-186547360 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
918679580 1:187335187-187335209 TTGAATAGCAATGGGGAGAGAGG - Intergenic
918921899 1:190722998-190723020 TTGATTAGGAATGGGGAGAGGGG + Intergenic
918973035 1:191444812-191444834 TTGAATAGGAATGGTGAGAGAGG + Intergenic
920064929 1:203262058-203262080 TTGAATAGGAGTGGTGAGGGAGG - Intronic
920085845 1:203416072-203416094 TTGAATAGGAATGGTGAGAGAGG - Intergenic
921038316 1:211404330-211404352 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
921675457 1:217970579-217970601 TTGAATAGGAATGGTGAGAGTGG + Intergenic
921751537 1:218800138-218800160 TTGAATAGGAGTGGTGAGGGTGG + Intergenic
922357339 1:224788864-224788886 TTTTGTAGACATGGCGAGGGAGG + Intergenic
922971425 1:229744027-229744049 TTGAATAGGAATGGTGAGAGTGG + Intergenic
923190437 1:231615161-231615183 ATGCATAGGGGTGGGGAGGGTGG - Intronic
923213049 1:231823280-231823302 TTTTATTGGCAGGGAGAGGGAGG + Intronic
924130013 1:240897319-240897341 TTGAATAGGAATGGTGAGAGAGG + Intronic
924878589 1:248132764-248132786 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1063116737 10:3076930-3076952 TTATGTAGGCATGGGGAGGTGGG - Intronic
1063418918 10:5895658-5895680 GTGTGTAGGTGTGGGGAGGGAGG + Intronic
1063853926 10:10225181-10225203 TTGGACAGGCCTGGGGAAGGAGG - Intergenic
1064370116 10:14744385-14744407 TTGAATAGGAATGGTGAGAGAGG + Intronic
1064702122 10:18032687-18032709 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1064975390 10:21109036-21109058 TTGAATAGGAGTGGGGAGAGAGG + Intronic
1065080612 10:22125948-22125970 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1065247525 10:23773997-23774019 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1065396936 10:25249349-25249371 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1066139017 10:32484534-32484556 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1066158879 10:32707424-32707446 TTGAATAGGCGTGGTGAGAGAGG - Intronic
1067053036 10:43035975-43035997 TTGCCTAGGGATGGGGCGGGAGG + Intergenic
1067331198 10:45321135-45321157 TTGAAGAGGAATGGGGAGAGAGG + Intergenic
1067372606 10:45699346-45699368 TTTTATTGGCATGAGGAGAGGGG - Intergenic
1067387172 10:45826778-45826800 TTTTATTGGCATGAGGAGAGGGG + Exonic
1067418956 10:46130473-46130495 TTTTATTGGCATGAGGAGAGGGG - Intergenic
1067590278 10:47502931-47502953 TTTTATTGGCATGAGGAGAGGGG + Exonic
1067637399 10:48011033-48011055 TTTTATTGGCATGAGGAGAGGGG + Intergenic
1067947782 10:50701304-50701326 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1068085729 10:52371269-52371291 TTGAACAGGCATGGTGAGAGAGG + Intergenic
1068490709 10:57720169-57720191 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1068505612 10:57895921-57895943 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1068848912 10:61713548-61713570 TTGAATAGGAATGGTGAGAGAGG + Intronic
1068876129 10:61998776-61998798 GAGTATGGGTATGGGGAGGGTGG + Intronic
1069274953 10:66578354-66578376 TTGAATAGGAATGGTGAGTGTGG + Intronic
1069930820 10:71880525-71880547 GAGTAGAGGCATGGGCAGGGAGG - Intergenic
1070062105 10:72993982-72994004 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1070065040 10:73025566-73025588 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1070133996 10:73675462-73675484 TTTTATTGGCATGAGGAGAGGGG + Exonic
1070445981 10:76502929-76502951 TTGAATAGGAGTGGGGAGAGTGG + Intronic
1070883099 10:79866297-79866319 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1070932893 10:80273426-80273448 TGGCACAGGCAAGGGGAGGGAGG + Exonic
1071001115 10:80831537-80831559 TTGAATAGGCATGGTGAGAGAGG - Intergenic
1071020288 10:81046062-81046084 TTGGATAGGAATGGTGAGAGAGG + Intergenic
1071101751 10:82046606-82046628 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1071187069 10:83058332-83058354 GGGTAGAGGCACGGGGAGGGGGG - Intergenic
1071481997 10:86071682-86071704 TGCTATAGGCATGCTGAGGGAGG + Intronic
1071649667 10:87382612-87382634 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1071748349 10:88447116-88447138 TTGAATAGGAATGGTGAGAGAGG - Intronic
1071922550 10:90367837-90367859 TTGAATAGGAAGGGGGAGAGAGG + Intergenic
1071983513 10:91027878-91027900 TTGAATAGGCGTGGTGAGAGAGG - Intergenic
1072270163 10:93768534-93768556 TTATAAACACATGGGGAGGGTGG + Intronic
1072384520 10:94910749-94910771 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1073374759 10:103023547-103023569 TTTTGTGGGGATGGGGAGGGGGG - Intronic
1073494182 10:103876518-103876540 GTGGCCAGGCATGGGGAGGGTGG - Intergenic
1073523000 10:104152385-104152407 TGGCAGAGGCATGAGGAGGGAGG + Intronic
1073549153 10:104381408-104381430 TGGTCTAGGAATGGGGTGGGAGG + Intronic
1073808077 10:107121840-107121862 TGGTTTGGGCATGGGGAGAGGGG + Intronic
1074642992 10:115409605-115409627 TTGGATAAGCATGGTGAGAGTGG + Intronic
1074795113 10:116935202-116935224 TTGAATAGGCGTGGTGAGAGAGG + Intronic
1075860444 10:125671170-125671192 TTGAATAGGAATGGTGAGAGGGG + Intronic
1076390230 10:130094830-130094852 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1076737514 10:132465411-132465433 CTGTGTAAGCACGGGGAGGGTGG - Intergenic
1076808498 10:132872906-132872928 ATGTGCTGGCATGGGGAGGGAGG - Intronic
1076921189 10:133455601-133455623 TTGCAGAGGCCTGGAGAGGGTGG + Intergenic
1078046906 11:7922297-7922319 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1078115675 11:8447740-8447762 TTGAATAGGAATGGTGAGAGAGG - Intronic
1078119667 11:8494051-8494073 TTGAATAGGAATGGTGAGAGAGG - Intronic
1078421069 11:11213441-11213463 GAGTAAAGGCATGGAGAGGGTGG - Intergenic
1078510987 11:11983818-11983840 TTGTATAGGCATTGGGTCGGGGG - Intronic
1078684296 11:13513585-13513607 TTGAATAGGAATGGTGAGAGTGG + Intergenic
1079675245 11:23218708-23218730 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1080591519 11:33727626-33727648 TTGAATAGGAATGGTGAGAGAGG - Intronic
1080906230 11:36548228-36548250 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1080982911 11:37429932-37429954 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1081241066 11:40707248-40707270 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1082016822 11:47495366-47495388 TTGCTTAGGAATGGGGATGGGGG + Intronic
1082279397 11:50255202-50255224 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1082316082 11:50724200-50724222 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1082317247 11:50745021-50745043 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1082581366 11:54873411-54873433 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1083532729 11:63439264-63439286 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1085135297 11:74082024-74082046 TTGAATAGGAATGGTGAGAGAGG + Intronic
1085205510 11:74729833-74729855 TTGGCTGGGCATGGGGAGGGGGG + Intronic
1085466407 11:76726678-76726700 TTGAGTAAGCACGGGGAGGGGGG + Intergenic
1085876326 11:80410468-80410490 TTGAATAGGCGTGGTGAGAGTGG - Intergenic
1085908414 11:80792366-80792388 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1085909257 11:80801905-80801927 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1086029936 11:82342431-82342453 TTGAATAGGAATGGTGAGAGTGG + Intergenic
1086567609 11:88244565-88244587 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1087341396 11:96912019-96912041 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1087379348 11:97385009-97385031 GTGTCTAGGCAAGGCGAGGGAGG - Intergenic
1087476844 11:98647115-98647137 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
1087511166 11:99095692-99095714 TTGTATAAGCATGGAAAGAGAGG + Intronic
1087612937 11:100455824-100455846 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1087874182 11:103336442-103336464 GTGTATAGGGGTTGGGAGGGAGG - Intronic
1087878560 11:103388541-103388563 TTGAATAGGAATGGTGAGAGAGG + Intronic
1087881640 11:103422790-103422812 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1088405261 11:109469098-109469120 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1088521189 11:110702489-110702511 TTGAATAGGAATGGTGAGAGAGG - Intronic
1088753487 11:112865707-112865729 TTTTTGAGGCAAGGGGAGGGTGG + Intergenic
1088845299 11:113660697-113660719 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1089068413 11:115679692-115679714 TTGTATGGAGCTGGGGAGGGTGG - Intergenic
1089736350 11:120552639-120552661 TGGTGCAGGCATGGAGAGGGTGG + Intronic
1090441486 11:126728656-126728678 TTGTATAGGGAGGGGAAAGGAGG + Intronic
1091813567 12:3419546-3419568 TTGCTTAGGCAAGGGGTGGGTGG - Intronic
1092204743 12:6607894-6607916 TGGGATGGCCATGGGGAGGGAGG - Intergenic
1092334071 12:7613020-7613042 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1092626465 12:10334475-10334497 ATGTATAGGGAAGGGGGGGGGGG + Intergenic
1092805307 12:12216840-12216862 TTGCAGGGGCAGGGGGAGGGAGG - Intronic
1093324207 12:17754035-17754057 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
1093413274 12:18892260-18892282 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1093465253 12:19441719-19441741 CTGTGTAGGCATGGGTAGGAAGG + Intronic
1093491060 12:19704876-19704898 TTGAATAGGCATGGTGAGAGTGG - Intronic
1093599697 12:21006785-21006807 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1094332923 12:29315788-29315810 TTGTGTATGCATTGGGAAGGGGG + Intronic
1094710802 12:32960272-32960294 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1094745121 12:33335817-33335839 TTGAATAGGAATGGTGAGAGGGG - Intergenic
1095608182 12:44095820-44095842 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1095647189 12:44561282-44561304 TTGAATAGGAATGGTGAGAGAGG - Intronic
1095697878 12:45161161-45161183 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1095870586 12:47023415-47023437 TTCCATTGGCTTGGGGAGGGAGG - Intergenic
1096028845 12:48393368-48393390 TTTAATAGGAATGGTGAGGGAGG + Intergenic
1096029540 12:48400286-48400308 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
1096034321 12:48451445-48451467 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1096431609 12:51548895-51548917 ATTTAAAGCCATGGGGAGGGAGG - Intergenic
1097456068 12:59800023-59800045 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1097688427 12:62712263-62712285 TTGTAGAGACAGGGGCAGGGGGG - Intronic
1097774714 12:63632168-63632190 TTGTATAGGAGTGGTGAGAGAGG - Intronic
1097948431 12:65399639-65399661 TTGAATAGGAATGGTGAGAGAGG + Intronic
1098284805 12:68896199-68896221 TTGAAAAGGCAAGGGGAGGTTGG - Intronic
1098371487 12:69765177-69765199 TTGAATAGGAATGGTGAGAGTGG + Intronic
1099031202 12:77527851-77527873 TTGAATAGGAGTGGTGAGGGGGG - Intergenic
1099239769 12:80125075-80125097 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1099313609 12:81058376-81058398 TTGAATAGGAATGGTGAGAGAGG + Intronic
1099388576 12:82049938-82049960 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1100073549 12:90751515-90751537 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
1100174865 12:92017977-92017999 TTGAATAGGAATGGTGAGAGTGG + Intronic
1101201958 12:102445770-102445792 TTGAATAGGAGTGGGGAGAGGGG + Intronic
1101346916 12:103894471-103894493 TTCTATAGGCATGGCAAGGCAGG - Intergenic
1102391937 12:112556407-112556429 TCTTATAAGCATGGGGAGGGAGG - Intergenic
1102988584 12:117298487-117298509 TTTGATGGGGATGGGGAGGGAGG - Intronic
1103615037 12:122146429-122146451 TGGTACAGGCATGGGGGTGGGGG - Exonic
1104189090 12:126460534-126460556 GTGTATAGGTATAGGTAGGGAGG + Intergenic
1104794080 12:131504726-131504748 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1106006440 13:25774406-25774428 TTGGGGAGGCAGGGGGAGGGAGG + Intronic
1106094616 13:26632209-26632231 TTGAATAAGCATGGTGAGAGAGG + Intronic
1106366588 13:29087139-29087161 TTGAATAGGAATGGTGAGAGTGG + Intronic
1106615453 13:31323064-31323086 TTGTCTAGTCAAGGGCAGGGAGG + Intronic
1107329892 13:39287931-39287953 TTGAATAGGTGTGGGGAGAGAGG - Intergenic
1107587010 13:41861409-41861431 TTGAATAGGAATGGTGAGAGTGG - Intronic
1108328163 13:49355795-49355817 ATATAAAGGCAGGGGGAGGGAGG + Intronic
1108425614 13:50296352-50296374 TTGAATAGGAATGGTGAGAGAGG + Intronic
1108815287 13:54283364-54283386 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1109101086 13:58184178-58184200 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1109577448 13:64280322-64280344 TTGAATAGGAGTGGGGAGAGTGG - Intergenic
1109635171 13:65105946-65105968 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1109774783 13:67026517-67026539 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1109867495 13:68284403-68284425 TTGTCTTGGGGTGGGGAGGGGGG + Intergenic
1109941293 13:69369431-69369453 TTGAATAGGAGTGGTGAGGGTGG - Intergenic
1109992142 13:70072905-70072927 TTGCATAGGAATGGTGAGAGGGG - Intronic
1110510693 13:76346688-76346710 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1110606582 13:77439860-77439882 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1110907821 13:80915335-80915357 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1110959809 13:81607452-81607474 ATTTATAGCCAAGGGGAGGGAGG - Intergenic
1111429346 13:88131953-88131975 TTGAATAGGAATGGGAATGGAGG - Intergenic
1111596164 13:90414256-90414278 TTGCATAGAAATAGGGAGGGAGG - Intergenic
1111747146 13:92284845-92284867 TTGAATAGGCGTGGTGAGAGAGG - Intronic
1111786558 13:92794487-92794509 TTGAATAGGAATGGTGAGAGAGG - Intronic
1111817830 13:93176343-93176365 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1112134410 13:96560477-96560499 TTGAATAGGAATGGTGAGAGTGG - Intronic
1112592852 13:100779894-100779916 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1112645298 13:101324813-101324835 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1112663443 13:101541092-101541114 TTGTATAGGAGTGGTGAGAGAGG + Intronic
1113725919 13:112601700-112601722 TTGTATAGGCCTGAAAAGGGGGG - Intergenic
1114386246 14:22258397-22258419 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1114684916 14:24519527-24519549 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1114800781 14:25773355-25773377 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1115032656 14:28815335-28815357 TTGTATGGGTATGGGGAGATGGG + Intergenic
1115950370 14:38714407-38714429 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1116185153 14:41591035-41591057 TTGAATAGGGATGGTGAGAGAGG - Intergenic
1116583862 14:46677451-46677473 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1116675872 14:47905143-47905165 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1116855419 14:49948183-49948205 TTTTCTAGGGATGGGGAGTGAGG + Intergenic
1117017707 14:51535362-51535384 TTGTTTAGGGATGGGGTGAGGGG - Intronic
1117082021 14:52161793-52161815 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1117223624 14:53633002-53633024 TGGTATAGGAATGGGCAGAGTGG - Intergenic
1117645263 14:57844938-57844960 TTGTATGTGCATGGGGGGGTGGG - Intronic
1118545086 14:66877340-66877362 TTGAATAGGAATGGTGAGAGAGG - Intronic
1118569241 14:67176114-67176136 TTGAATAGGAATGGTGAGAGAGG + Intronic
1118734200 14:68690464-68690486 TTGCAGAGGAATGGGGAGGCAGG - Intronic
1118964889 14:70571589-70571611 TTGTATAGGCATGGGGAGAATGG - Intergenic
1119406970 14:74405116-74405138 TTGTAAAAGCATGGAGAGGGAGG - Intergenic
1119557702 14:75566319-75566341 TTAAATAGCCATGGAGAGGGTGG + Intergenic
1120058831 14:79957654-79957676 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1120564975 14:86044370-86044392 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1121068905 14:90998187-90998209 TTGTTTAGGACTGGGGAGGATGG + Intronic
1121676784 14:95760039-95760061 TTGCAGAGGGATGGGGAGGAAGG - Intergenic
1124064675 15:26330682-26330704 TTCAATAGGAATGGTGAGGGAGG - Intergenic
1124155292 15:27219769-27219791 TTTTATAGGCAAGGCGAGGAGGG - Intronic
1124400333 15:29342238-29342260 TTGTATGTGTATGGGCAGGGAGG + Intronic
1124569631 15:30850642-30850664 TTGAATAGGCATGGTGAGAGAGG + Intergenic
1124668910 15:31619805-31619827 TTGAATAGGAATGGTGAGAGAGG + Intronic
1124874583 15:33579996-33580018 TTCTATAGGCAGGGTGATGGGGG - Exonic
1124886027 15:33687020-33687042 TTGAATAGGCGTGGTGAGAGAGG - Intronic
1125985116 15:44042881-44042903 TTGAATAGGAATGGTGAGAGAGG - Intronic
1126086680 15:45017048-45017070 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1126956698 15:53940420-53940442 TTGTATAGGAATGGTGGGAGAGG - Intergenic
1127007585 15:54587717-54587739 TTGGCTGGGCATGGGGAGGTGGG - Intronic
1129489678 15:75911801-75911823 TTGAATAGGAATGGTGAGAGAGG + Intronic
1129498764 15:76015379-76015401 TTGAATAGGAATGGTGAGAGAGG + Intronic
1129583309 15:76835647-76835669 TTGAATAGGAATGGTGAGGTGGG - Intronic
1130584412 15:85169275-85169297 TTGTATTTGTATGTGGAGGGGGG - Intergenic
1131314839 15:91326205-91326227 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1131415493 15:92252643-92252665 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1131509582 15:93042356-93042378 TTGTCTGGTCGTGGGGAGGGAGG - Intronic
1131710728 15:95053388-95053410 TTGAATAGGCATGGTAAGAGTGG + Intergenic
1132002398 15:98193273-98193295 TTTTGTTGGCAAGGGGAGGGTGG - Intergenic
1132850247 16:2021780-2021802 TTGAAGAGGCAGCGGGAGGGAGG - Intergenic
1134559166 16:15192946-15192968 TTATATATTCATGGGGAGGCAGG - Intergenic
1134919701 16:18104559-18104581 TTATATATTCATGGGGAGGCAGG - Intergenic
1136727393 16:32371419-32371441 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1136917010 16:34214876-34214898 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
1137224225 16:46487035-46487057 TTGAATAGGAATGGAGAGAGTGG - Intergenic
1137481925 16:48858995-48859017 TGGGCTAAGCATGGGGAGGGGGG + Intergenic
1138216157 16:55207190-55207212 CTGAATAGTTATGGGGAGGGAGG - Intergenic
1139670969 16:68492423-68492445 TTTTATGGGCAAGGGGAGGAGGG - Intergenic
1140965899 16:79965685-79965707 TTTTAGAGGGATGGGGAGTGGGG + Intergenic
1141119742 16:81343721-81343743 TTGAATAGGAATGGTGAGAGAGG - Intronic
1142065847 16:88062179-88062201 TTTTAAAGGCATGGGGGGTGGGG + Intronic
1142259244 16:89034893-89034915 TTGTAGAGGCAGGTGGAGAGGGG + Intergenic
1202999040 16_KI270728v1_random:146331-146353 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1203130638 16_KI270728v1_random:1682739-1682761 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1144432303 17:15204953-15204975 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1144725075 17:17497761-17497783 GTGGGTAGGCATGGGGTGGGTGG - Intergenic
1144764287 17:17724463-17724485 TTGTGGAGGAAAGGGGAGGGGGG - Intronic
1144795514 17:17888701-17888723 TTGCTGGGGCATGGGGAGGGGGG + Intronic
1146580578 17:34034465-34034487 TTGAATAGGAATGGTGAGAGAGG - Intronic
1146920095 17:36704360-36704382 CTCTGAAGGCATGGGGAGGGGGG + Intergenic
1147667480 17:42157784-42157806 TTGTATAGAGATGGGTGGGGGGG + Intronic
1147956467 17:44138059-44138081 TGGGATAGGCTTGGGGAGGTGGG + Intergenic
1148690235 17:49522922-49522944 TATTATAGGGATAGGGAGGGAGG + Intergenic
1148759312 17:49991306-49991328 GTGTCTAGGCAGAGGGAGGGAGG + Exonic
1149235872 17:54590076-54590098 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1149246834 17:54719024-54719046 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1149255773 17:54824768-54824790 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1149786556 17:59440463-59440485 TTTTGTAGAGATGGGGAGGGGGG - Intergenic
1149970100 17:61209469-61209491 TTATAAAGGCAAGGGGAGGAGGG + Intronic
1151188094 17:72378709-72378731 GTGTGCAGGCAGGGGGAGGGCGG + Intergenic
1151255088 17:72870619-72870641 CTGTAGAGGAATGGGGAGAGGGG - Intronic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152082223 17:78195133-78195155 TGGTAGGGGCAAGGGGAGGGAGG + Intronic
1152830670 17:82495387-82495409 TTGTAGAGGCCGGGGGGGGGGGG - Intergenic
1153090703 18:1339303-1339325 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1153314881 18:3711902-3711924 TGGTTTAGGGATGGGGAGTGTGG + Intronic
1153399794 18:4671027-4671049 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1153857749 18:9167755-9167777 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1154184351 18:12169171-12169193 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1155561558 18:27083197-27083219 TTAAATAGGCATTGGAAGGGAGG + Intronic
1156084490 18:33382594-33382616 TTCCTTTGGCATGGGGAGGGAGG - Intronic
1157031217 18:43910663-43910685 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1157396970 18:47350265-47350287 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1157615555 18:48985483-48985505 TGGTATAGGGATGGGGTGGTGGG - Intergenic
1157673717 18:49552273-49552295 TTTTATAGGAGTGGGGAGGGTGG + Intergenic
1158059102 18:53316984-53317006 TTGAATAGGGATGGTGAGAGAGG + Intronic
1158173989 18:54633363-54633385 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1158921252 18:62193401-62193423 TTGAATAGGAGTGGGGAGAGAGG + Intronic
1160629525 18:80236455-80236477 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1161766936 19:6213399-6213421 CCGTGTAGGCCTGGGGAGGGGGG + Exonic
1162158753 19:8696973-8696995 GTGTGTGGGCATGGGGTGGGTGG + Intergenic
1162478525 19:10915067-10915089 TTGTGCAGGCAGGGGCAGGGGGG + Intronic
1162925674 19:13929701-13929723 CAGGATAGGCATGGGGGGGGAGG + Intronic
1162927098 19:13936170-13936192 TTGAGTAGGGATGGGGAGGAGGG - Intronic
1164116723 19:22228458-22228480 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1165011404 19:32850135-32850157 TTGAATAGGAATGGTGAGAGAGG - Intronic
1166409396 19:42546737-42546759 ATGTACAGGGTTGGGGAGGGTGG + Intronic
1166796270 19:45428264-45428286 TTGTAGAGGCGTGGGGGTGGGGG + Intronic
1167673816 19:50872418-50872440 TTGTACAGGCATGGAGAATGAGG + Intronic
925475834 2:4213666-4213688 TTGAATAGACATGGTGAGAGTGG + Intergenic
925750484 2:7085987-7086009 TTGAATAGGAATGGTGAGAGTGG + Intergenic
926454232 2:13044411-13044433 TTGAATAGGAATGGTGAGAGAGG - Intergenic
926895597 2:17684170-17684192 TTGTTTAGGACAGGGGAGGGTGG - Intronic
926934040 2:18069000-18069022 GAGTAGAGGCATGGAGAGGGAGG - Intronic
927127850 2:20029299-20029321 TTGAATAGGAGTGGGGAGAGTGG - Intergenic
927443672 2:23139102-23139124 TTTTATAGGCAAGGGAAGTGAGG - Intergenic
927617487 2:24613765-24613787 TGGTCTTGGCATGGGGAGAGTGG + Intronic
928576597 2:32661805-32661827 TTGAATAGGAATGGTGAGGGAGG + Intronic
928631650 2:33199578-33199600 TTGAATAGGAATGGTGAGAGAGG - Intronic
928811719 2:35235472-35235494 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
929276043 2:40025922-40025944 TTGAATAGGAATGGTGAGAGAGG - Intergenic
929913113 2:46109738-46109760 TTGAATAGGAATGGGGGGAGAGG + Intronic
930677174 2:54215285-54215307 TTGAATAGGAATGGTGAGAGAGG + Intronic
930826428 2:55700699-55700721 TGGTGTAGGCCTGGGGAAGGGGG - Intergenic
930961961 2:57272888-57272910 TTGAATAGGAATGGTGAGAGAGG + Intergenic
931037823 2:58263037-58263059 TTGAATAGGAATGGTGAGAGAGG - Intergenic
931454192 2:62394527-62394549 TTGACTAGGAATGGGGAGAGAGG - Intergenic
931907224 2:66855294-66855316 TTGAATAGGAATGGTGAGAGAGG + Intergenic
932045773 2:68348083-68348105 TTGAATAGGAATGGTGAGAGAGG - Intergenic
932542175 2:72666481-72666503 TTGAATAGGAATGGTGAGAGTGG - Intronic
932941635 2:76173569-76173591 TTGAATAGGAATGGTGAGAGAGG + Intergenic
935315017 2:101824101-101824123 TTGTAAGGGCATGGCGGGGGTGG + Intronic
935843664 2:107141306-107141328 TTGTTTAGGAGTGGTGAGGGAGG + Intergenic
935852477 2:107237515-107237537 TTGAATAGGAATGGTGAGAGAGG - Intergenic
936041400 2:109152728-109152750 TTGAGTAGGCATGGGCAGAGGGG + Intronic
936094551 2:109521903-109521925 TTCTGCAGGGATGGGGAGGGAGG + Intergenic
936530265 2:113271421-113271443 TTGGAAAGGCAGAGGGAGGGAGG - Intronic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
937085257 2:119167411-119167433 TTGTGTAGGCATGAGCAGGGAGG - Intergenic
937272637 2:120663103-120663125 TTGTCTGGGCCTGGGGAGGTGGG - Intergenic
937500123 2:122469360-122469382 TTTTATAGTCATGGTGGGGGAGG - Intergenic
938276456 2:130029521-130029543 TTGTGTATGTATTGGGAGGGGGG - Intergenic
938327413 2:130420279-130420301 TTGTGTATGTATTGGGAGGGGGG - Intergenic
938362528 2:130701198-130701220 TTGTGTATGTATTGGGAGGGGGG + Intergenic
938438916 2:131307838-131307860 TTGTGTATGTATTGGGAGGGGGG + Intronic
938871579 2:135482654-135482676 TTGAATAGGAATGGTGAGAGAGG + Intronic
939157309 2:138540780-138540802 TTGAATAGGAGTGGTGAGGGAGG + Intronic
939947548 2:148427948-148427970 TTGAATAGGAATGGTGAGAGAGG - Intronic
940393048 2:153154768-153154790 TTGAATAGGAATGGTGAGAGAGG + Intergenic
941776911 2:169403238-169403260 TTGAATAGGAATGGTGAGAGAGG - Intergenic
941981030 2:171457017-171457039 TTGAATAGGAATGGTGAGAGTGG + Intronic
942213307 2:173693206-173693228 TTTTCTAGGCATGGAGAGAGGGG - Intergenic
943234072 2:185295036-185295058 TTGAATAGGAATGGTGAGAGAGG - Intergenic
943250674 2:185518147-185518169 TTGTATAGGAGTGGTGAGAGAGG + Intergenic
943688341 2:190842922-190842944 TTTAAAATGCATGGGGAGGGTGG + Intergenic
943999114 2:194809981-194810003 TTGAATAGGAATGGTGAGAGAGG - Intergenic
944163299 2:196689783-196689805 TTGAATAGGAATGGTGAGAGAGG + Intronic
945346845 2:208728442-208728464 TTGAATAGGAATGGTGAGAGTGG + Intronic
945791081 2:214306413-214306435 TTGAATAGGCATAGTGAGAGAGG + Intronic
946040575 2:216780022-216780044 TTGTATAGCCCTGATGAGGGAGG + Intergenic
946945052 2:224812524-224812546 TTGAATAGGAGTGGTGAGGGAGG + Intronic
947086397 2:226457816-226457838 TTGAATAGGAATGGTGAGAGAGG - Intergenic
947198287 2:227591258-227591280 TTGAATAGGAATGGTGAGAGAGG + Intergenic
947255584 2:228160198-228160220 TTGTATAATCATGGGGAAGATGG - Intronic
947449332 2:230192238-230192260 TTGAATAGGAATGGTGAGAGAGG - Intronic
948113464 2:235475760-235475782 TTGAATAGGAATGGTGAGAGTGG + Intergenic
1168733402 20:107585-107607 TTGAATAGGCATGGTGAGAGTGG - Intergenic
1169500339 20:6153925-6153947 TTGAATAGGTATGGTGAGAGTGG + Intergenic
1169919800 20:10723021-10723043 TGTTATAGCCATTGGGAGGGAGG - Intergenic
1170855420 20:20049144-20049166 TAGAATAGTCCTGGGGAGGGTGG - Intronic
1172126296 20:32627099-32627121 TTGTCTGGGCATAGGGAGGTTGG - Intergenic
1173278328 20:41604006-41604028 TTGTATAGGAAGGGTGGGGGTGG + Intronic
1173719056 20:45237244-45237266 ATGGATAGGGGTGGGGAGGGAGG - Intergenic
1173994635 20:47328283-47328305 TTTTATAAGCATGGAGAGGGTGG + Intronic
1174440248 20:50545842-50545864 TTGTAGAGACGGGGGGAGGGGGG - Intronic
1174694907 20:52547350-52547372 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1174929643 20:54798901-54798923 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1174968487 20:55247054-55247076 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1176300430 21:5096548-5096570 ATCTGAAGGCATGGGGAGGGCGG - Intergenic
1177233272 21:18350669-18350691 TTGTAAGAGGATGGGGAGGGTGG - Intronic
1178165297 21:29967751-29967773 GTGTGTAGGCATGGGGCAGGGGG + Intergenic
1178787088 21:35663762-35663784 TTGTCTAGGCAAGAGGAGAGAGG - Intronic
1179146741 21:38774755-38774777 TGGTACAGGCAGGGGGAGGATGG + Intergenic
1179310488 21:40191476-40191498 TTTTATAGGCTAGGGGAAGGGGG - Intronic
1179856614 21:44165433-44165455 ATCTGAAGGCATGGGGAGGGCGG + Intergenic
1179884634 21:44308464-44308486 GTGAATAGGCATGGAGAGGTAGG + Intronic
1181685017 22:24522381-24522403 TGGTTTGGGCAAGGGGAGGGGGG - Intronic
1182167952 22:28195389-28195411 TTGAATAGGAATGGTGAGAGAGG - Intronic
1182169557 22:28213232-28213254 TTGAATAGGAATGGTGAGAGAGG - Intronic
1182952265 22:34388395-34388417 TTGAATAGGCATGGCAAGAGAGG + Intergenic
1183624788 22:38995218-38995240 TTGCAGATGAATGGGGAGGGGGG - Intergenic
949149940 3:754357-754379 TTGAATAGGCATGGTGAAAGTGG + Intergenic
949766418 3:7531841-7531863 TTGAATAGGAGTGGGGAGAGAGG + Intronic
950561604 3:13732432-13732454 TTGAATAGGCATGGTGAGAGAGG + Intergenic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
951261061 3:20509424-20509446 TTGAATAGGAATGGTGAGAGAGG + Intergenic
951452570 3:22855651-22855673 TTGAATAGGAATGGTGAGAGAGG + Intergenic
952616742 3:35282354-35282376 TTGAATAGGAATGGTGAGAGAGG - Intergenic
952813635 3:37427392-37427414 TTGAATAGGAATGGTGAGCGAGG + Intronic
953080937 3:39617032-39617054 TTGAATAGGAATGGTGAGAGAGG + Intergenic
953312914 3:41897458-41897480 TTGTATAGGGATTTGGAGGTAGG - Intronic
953316242 3:41929445-41929467 TTGAATAGGAATGGTGAGAGAGG - Intronic
953553564 3:43924082-43924104 TTGTCTGGGCATGCTGAGGGAGG - Intergenic
954490223 3:50897519-50897541 TTAAATAGGCATGGTGAGAGAGG + Intronic
954517641 3:51192953-51192975 TTGAATAGGAATGGTGAAGGTGG + Intronic
954519619 3:51213073-51213095 TGGTCTAGGAATGGGGAGGGAGG - Intronic
955240631 3:57174803-57174825 TGGCAAAGGCATGGGTAGGGTGG + Intergenic
956163269 3:66377042-66377064 CTGAGTAGGTATGGGGAGGGGGG + Intronic
956569453 3:70677711-70677733 TTGAATAGGAATGGTGAGAGAGG + Intergenic
957005004 3:74934718-74934740 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
957622573 3:82613132-82613154 TTGTATAGGAGTGGTGAGAGAGG + Intergenic
957644736 3:82906478-82906500 TTGAATAGGAATGGTGAGAGAGG + Intergenic
957815658 3:85293892-85293914 TTGAATAGGAGTGGTGAGGGAGG - Intronic
958081453 3:88751041-88751063 TTGAATAGGCGTGGTGAGAGTGG - Intergenic
958255127 3:91316667-91316689 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG + Intergenic
958706638 3:97664424-97664446 TTGAATAGGAGTGGTGAGGGAGG - Intronic
958998269 3:100931299-100931321 TTGAATAGGAATGGTGAGAGTGG - Intronic
959522665 3:107337807-107337829 TTGAATAGGAATGGTGAGAGAGG - Intergenic
959556494 3:107725446-107725468 TTGAATAGGAATGGTGAGAGAGG + Intronic
959724193 3:109525442-109525464 TTGAATAGGCGTGGTGAGAGAGG - Intergenic
959888784 3:111531294-111531316 TTGTTTAGGCATTGGGAGGATGG + Intronic
959953165 3:112205005-112205027 TTGAATAGGAATGGTGAGAGAGG - Intronic
959954086 3:112215312-112215334 TTGAATAGGAATGGTGAGAGAGG - Intronic
959993804 3:112658734-112658756 TTGAATAGGAGTGGGGAGAGTGG + Intergenic
960220244 3:115099328-115099350 TTATTTATGCTTGGGGAGGGTGG - Intronic
960561541 3:119089532-119089554 TTGTATAGGAGTGGTGAGAGTGG - Intronic
961448155 3:126990773-126990795 TTGAAAAGCCAAGGGGAGGGTGG - Intronic
961933484 3:130558323-130558345 TTGTGTGTGCATGGGGTGGGTGG - Intergenic
962656337 3:137547739-137547761 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
962715913 3:138125927-138125949 TTGGAGAGGGGTGGGGAGGGAGG + Intronic
963450735 3:145479040-145479062 TTGAATAGGAATGGTGAGAGAGG + Intergenic
963925759 3:150949311-150949333 TTGAATAGGCGTGGTGAGAGAGG - Intronic
964053526 3:152424032-152424054 TTGAATAGGAGTGGTGAGGGAGG - Intronic
964190786 3:153998712-153998734 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
964208617 3:154203036-154203058 TTGAATAGGAGTGGGGAGAGAGG + Intronic
964228563 3:154435618-154435640 TTGAATAGGAATGGTGAGAGAGG + Intergenic
964264521 3:154879086-154879108 TCGAATAGGCATGGTGAGAGAGG - Intergenic
964564818 3:158038233-158038255 TTGAATAGGAATGGTGAGAGAGG - Intergenic
964783117 3:160362971-160362993 TTGAATAGGAATGGTGAGAGAGG - Intronic
965218621 3:165897543-165897565 ATGTAAAAGCCTGGGGAGGGAGG - Intergenic
965295967 3:166946859-166946881 TTGTATAGGAGTGGTGAGAGAGG - Intergenic
965527281 3:169734430-169734452 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
965823153 3:172705174-172705196 TTTTGTAGAGATGGGGAGGGTGG + Intronic
966297722 3:178443518-178443540 TAATTTAGGCAAGGGGAGGGGGG + Intronic
966475283 3:180337488-180337510 TTATATAGGCATGGGGGTTGAGG - Intergenic
966574263 3:181481729-181481751 TTGAATAGGAATGGTGAGAGAGG - Intergenic
966715833 3:183012196-183012218 TTGTAGAGACATGGGGCAGGCGG + Intergenic
966818155 3:183905820-183905842 TTCTACAGACATGGGTAGGGTGG - Intergenic
966863913 3:184245863-184245885 GTCTGGAGGCATGGGGAGGGTGG - Intronic
967281135 3:187824769-187824791 CAGTATATGCATGAGGAGGGTGG - Intergenic
967338890 3:188374744-188374766 TTGAATAGGAGTGGGGAGAGAGG + Intronic
967850672 3:194080436-194080458 TTTCATAGGCATGGGTGGGGAGG - Intergenic
967944530 3:194792551-194792573 TTGAATAGGCATGGTGAAAGTGG + Intergenic
968065611 3:195757422-195757444 TTGTCTGGGGAGGGGGAGGGTGG - Intronic
969164442 4:5294810-5294832 TTGTATAGGAGTGGTGAGAGAGG + Intronic
969698659 4:8752318-8752340 TTGAATAGGAATGGTGAGAGAGG - Intergenic
970155045 4:13133226-13133248 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
970175421 4:13334616-13334638 TTGAATAGGAATGGTGAGAGAGG + Intergenic
970555590 4:17228495-17228517 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
970566972 4:17341003-17341025 TAGTGTAGGGTTGGGGAGGGGGG - Intergenic
970812088 4:20106225-20106247 TTGAATAGGCATGGTGAGAGAGG - Intergenic
970917829 4:21356274-21356296 TTGAATAGGAATGGTGAGAGAGG - Intronic
971772022 4:30909284-30909306 TTGAATAGGAATGGTGAGAGAGG - Intronic
972813157 4:42613036-42613058 GTGTATAGGAGTGGGGAGGGAGG - Intronic
972892922 4:43581994-43582016 TTGAATAGGAATGGTGAGTGAGG + Intergenic
973064737 4:45774522-45774544 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
973132429 4:46664192-46664214 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
973529976 4:51826946-51826968 TTGAATAGGAATGGCGAGAGAGG + Intergenic
973669657 4:53203064-53203086 TTGAATAGGAGTGGTGAGGGAGG + Intronic
974119464 4:57621373-57621395 TTGAATAGGAATGGTGAGAGAGG + Intergenic
974263592 4:59556504-59556526 TTGAATAGGAATGGTGAGAGAGG + Intergenic
974370931 4:61015732-61015754 TTGAATAGGAATGGTGAGAGAGG - Intergenic
974689245 4:65273648-65273670 TTGAATAGGAATGGTGAGAGAGG + Intergenic
974717869 4:65694073-65694095 TTGTGTGTGTATGGGGAGGGGGG - Intergenic
975023043 4:69514497-69514519 TTGTATAGGAGTGGGGAGAGAGG + Intronic
975297937 4:72755483-72755505 TTGAATAGGAATGGTGAGAGAGG - Intergenic
975427509 4:74247517-74247539 TTGTATAGGAGTGGTGAGAGAGG + Intronic
975690871 4:76961719-76961741 TTGTATAGGCATTTGAAGTGTGG + Intronic
975792741 4:77972126-77972148 TTGAATAGGAATGGTGAGAGGGG - Intergenic
976594865 4:86885736-86885758 TTGAATAGGAGTGGGGAGAGAGG + Intronic
976682534 4:87773174-87773196 TTGAATAGGAATGGGGAGAGAGG - Intergenic
977193516 4:94029793-94029815 TTGTATAGGAGTGGTGAGAGAGG - Intergenic
977273886 4:94951310-94951332 TTGAATAGGAATGGTGAGAGAGG + Intronic
977479919 4:97562479-97562501 TTGAATAGGAGTGGTGAGGGAGG + Intronic
977482260 4:97593503-97593525 TGGTGTTGGCATGGGGAGGTGGG - Intronic
977815309 4:101407703-101407725 TTGAATAGGAATGGTGAGAGAGG + Intergenic
977899923 4:102408457-102408479 GTGTTTTGGCATGAGGAGGGAGG - Intronic
977899967 4:102411091-102411113 GTGTTTTGGCATGAGGAGGGAGG - Intronic
978108649 4:104934529-104934551 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
978140177 4:105309277-105309299 TTGAATAGGAATGGTGAGAGAGG + Intergenic
978271913 4:106901447-106901469 TTGTATAGGAGTGGTGAGAGAGG - Intergenic
978600368 4:110420903-110420925 TTGAATAGGAATGGTGAGAGAGG - Intronic
978632141 4:110759519-110759541 TTGTATAGGAGTGGTGAGAGAGG + Intergenic
978929283 4:114291137-114291159 TTGAATAGGAATGGTGAGAGAGG - Intergenic
979009670 4:115351677-115351699 TTGAATAGGAATGGTGAGAGAGG + Intergenic
979012684 4:115391359-115391381 TTGAATAGGAATGATGAGGGAGG - Intergenic
979017094 4:115448664-115448686 TTGAATAGGAATGGTGAGAGAGG + Intergenic
979048620 4:115901599-115901621 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
979096495 4:116557555-116557577 TTGAATAGACATGGTGAGAGAGG + Intergenic
979141797 4:117184691-117184713 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
979176354 4:117668687-117668709 TTGAATAGGAATGGTGAGAGAGG + Intergenic
980174023 4:129323488-129323510 TTGAATGGCCATAGGGAGGGGGG - Intergenic
980395515 4:132208785-132208807 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
981415351 4:144486534-144486556 TTGAATAGGAATGGTGAGAGAGG - Intergenic
981738690 4:147980070-147980092 TTGAATAGGAATGGTGAGAGTGG + Intronic
981859466 4:149337616-149337638 TTGAATAGGGATGGTGAGAGAGG + Intergenic
982524862 4:156466123-156466145 TTGAATAGGAATGGTGAGAGAGG - Intergenic
982690879 4:158546488-158546510 TTGAATAGGAATGGTGAGAGAGG + Intronic
982848621 4:160281678-160281700 TTGAATAGGAGTGGCGAGGGAGG - Intergenic
983048819 4:163019810-163019832 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
984217912 4:176937054-176937076 TTGAATAGGAATGGTGAGAGAGG + Intergenic
984236261 4:177162388-177162410 TTGAATAGGAATGGCGAGAGTGG - Intergenic
984457242 4:179985892-179985914 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
984482576 4:180324848-180324870 TTGAATAGGAATGGTGAGAGAGG + Intergenic
984485290 4:180360401-180360423 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
986277567 5:6291688-6291710 TTGAATAGGAATGGTGAGAGAGG - Intergenic
986356301 5:6930593-6930615 TTGAATAGGGGTGGTGAGGGAGG + Intergenic
986665107 5:10095410-10095432 TTGAATAGGAATGGTGAGAGAGG - Intergenic
987031976 5:13984566-13984588 TTGTATAGGAGTGGTGAGAGAGG + Intergenic
987223298 5:15813167-15813189 TTGAATAGGAGTGGTGAGGGAGG + Intronic
987228698 5:15870138-15870160 TTGTCAAGGTATGGTGAGGGGGG + Intronic
987962527 5:24828621-24828643 TTGAATAGGAATGGTGAGAGAGG - Intergenic
988118336 5:26926045-26926067 TTGAATAGGAATGGTGAGAGAGG - Intronic
988291864 5:29297438-29297460 TTGTATGCTCATGGGGATGGGGG - Intergenic
988305990 5:29494747-29494769 TTGAATAGGAATGGTGAGAGAGG + Intergenic
989248207 5:39277773-39277795 TTGAATAGGAATGGTGAGAGAGG + Intergenic
989364846 5:40644117-40644139 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
989461620 5:41705949-41705971 TTGAATAGGAATGGTGAGAGTGG + Intergenic
989489664 5:42035360-42035382 TTGTATAGGAGTGGTGAGAGAGG + Intergenic
989683865 5:44061927-44061949 TTGAATAGGAATGGTGAGAGAGG + Intergenic
989771012 5:45145360-45145382 TTGAATAGGAATGGTGAGAGTGG + Intergenic
990655016 5:57945388-57945410 TTGAATAGGAATGGTGAGAGAGG + Intergenic
991324672 5:65417332-65417354 TTGAATAGGAATGGTGAGAGTGG - Intronic
992032080 5:72731693-72731715 TTGAATAGGAATGGTGAGAGAGG - Intergenic
992212084 5:74490737-74490759 TTGTTTTGGCAGGGGGTGGGAGG - Intergenic
992340737 5:75820749-75820771 TTGAATAGGAATGGTGAGAGAGG - Intergenic
992505586 5:77384510-77384532 TTGAATAGGCGTGGTGAGAGAGG + Intronic
993089855 5:83411862-83411884 TTGAATAGGAATGGTGAGAGAGG - Intergenic
993093848 5:83459840-83459862 TTGAATAGGAATGGTGAGAGAGG + Intergenic
993122702 5:83795650-83795672 TTGAATAGGAATGGTGAGAGAGG + Intergenic
993773456 5:91961693-91961715 TTTTACAGGCATGGGGAAGGAGG + Intergenic
994004696 5:94824082-94824104 TTGAATAGGAATGGTGAGAGAGG + Intronic
994424827 5:99572076-99572098 TTGAATAGGCATGGTGAGGGTGG - Intergenic
994545992 5:101166947-101166969 TTGAATAGGAATGGTGAGAGAGG - Intergenic
994624647 5:102203363-102203385 TTGAATAGGAATGGTGAGAGAGG - Intergenic
994642732 5:102430341-102430363 TTGAATAGGAATGGTGAGAGGGG + Intronic
994868127 5:105305541-105305563 TACTATAGGGATAGGGAGGGAGG - Intergenic
994978286 5:106839746-106839768 TTGAATAGGAATGGTGAGAGAGG + Intergenic
995178797 5:109210532-109210554 TTGAATAGGAATGGTGAGAGAGG + Intergenic
995664375 5:114524697-114524719 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
995692365 5:114841893-114841915 TTGAATAGGAATGGTGAGAGAGG - Intergenic
996244097 5:121238162-121238184 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
996274389 5:121646713-121646735 TTGAATAGGCGTGGTGAGAGAGG + Intergenic
996280325 5:121722411-121722433 TTGAATAGGAATGGTGAGAGAGG + Intergenic
996462834 5:123766790-123766812 TTGAATAGGAATGGTGAGAGAGG + Intergenic
996645951 5:125817250-125817272 TTGTATAGGAACGTGGGGGGGGG - Intergenic
997183880 5:131861494-131861516 TTTAATGGGCATGGGGAAGGTGG + Intronic
997564314 5:134875205-134875227 CTCTAGAGGCATGGCGAGGGTGG + Intronic
997802434 5:136878802-136878824 TTGAATAGGAGTGGTGAGGGTGG - Intergenic
998688660 5:144560421-144560443 TTGAATAGGAATGGTGAGAGAGG - Intergenic
998774463 5:145583394-145583416 TTGAATAGGAATGGTGAGAGAGG - Intronic
999413678 5:151376031-151376053 TTGAATAGGAATGGTGAGAGTGG + Intergenic
999834766 5:155357506-155357528 TTGAATAGGAATGGTGAGAGTGG - Intergenic
999867410 5:155715976-155715998 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1000273909 5:159715533-159715555 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1000566103 5:162849381-162849403 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1001260505 5:170224558-170224580 TTGTCTTGGGATGGGGAGTGGGG - Intergenic
1001292562 5:170474380-170474402 TTGCATAGGTATGGGGGGCGGGG - Intronic
1001488498 5:172138014-172138036 TTGTATAGGAGTGGTGAGCGTGG - Intronic
1001839337 5:174860988-174861010 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1002827491 6:786211-786233 TCATCTAGACATGGGGAGGGAGG + Intergenic
1003239449 6:4330777-4330799 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1003386135 6:5669377-5669399 TTTTATAGGCAGCGGGGGGGTGG - Intronic
1004111775 6:12725446-12725468 TAGTATAGGCAATGGGAGGAAGG - Intronic
1004746143 6:18511011-18511033 TTTTATAGGCACAGGGTGGGGGG - Intergenic
1004839721 6:19569242-19569264 TTGAGAAGGAATGGGGAGGGAGG - Intergenic
1005214847 6:23513322-23513344 CTGTATTGGTATAGGGAGGGGGG - Intergenic
1005789068 6:29277538-29277560 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1005812646 6:29529057-29529079 TGGTCTAGCCATGGGCAGGGAGG - Intergenic
1006172992 6:32106120-32106142 TAGTAGGGGCATGGGGGGGGGGG + Intronic
1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG + Exonic
1006217374 6:32455965-32455987 TTGAATAAGAATGGTGAGGGAGG - Intergenic
1006252661 6:32801980-32802002 TTGAATAAGCATGGCGAGAGTGG - Intergenic
1006594097 6:35179921-35179943 ATGGAGAGGCCTGGGGAGGGGGG + Intergenic
1006788978 6:36686424-36686446 TTGTGAAGGCAGGGGGAAGGTGG + Exonic
1007024684 6:38558434-38558456 TTGAATAGGCGTGGTGAGAGTGG + Intronic
1008084194 6:47226801-47226823 TTGTGGAGGGATGGGGAAGGTGG + Intergenic
1008268629 6:49463197-49463219 TTGTGTGGGCTTGGTGAGGGCGG - Intergenic
1008332087 6:50257538-50257560 TTGAATAGGCATGGTGAGAGAGG + Intergenic
1008407246 6:51132409-51132431 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1008474338 6:51920164-51920186 TTGAATAGGCGTGGTGAGAGAGG + Intronic
1008834252 6:55807107-55807129 TTGAATAGGAATGGTGAGAGGGG + Intronic
1009188705 6:60603919-60603941 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1009361268 6:62817699-62817721 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1009755990 6:67940870-67940892 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1009849373 6:69176174-69176196 TTGTATAGGAGTGGTGAGAGTGG + Intronic
1010310098 6:74375080-74375102 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1010446582 6:75955637-75955659 TTGAATAGGAATGGTGAGAGAGG + Intronic
1010466979 6:76179193-76179215 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1010491900 6:76486803-76486825 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1010501182 6:76602171-76602193 TGGAATAGGCATGGTGAGAGAGG - Intergenic
1010604788 6:77874643-77874665 TTGAATAGGAATGGTGAGAGAGG + Intronic
1010896739 6:81374287-81374309 TTGAATAGGAATGGAGAGAGAGG - Intergenic
1011234961 6:85206101-85206123 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1012063434 6:94515666-94515688 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1012204215 6:96440705-96440727 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1012238656 6:96847523-96847545 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1012584902 6:100910158-100910180 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1012802116 6:103843601-103843623 TTGTGTAAGTATAGGGAGGGTGG + Intergenic
1012980580 6:105826374-105826396 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1013002265 6:106035447-106035469 TTCTATAGAGACGGGGAGGGGGG - Intergenic
1013741695 6:113294917-113294939 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1013860519 6:114630039-114630061 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1013906515 6:115226165-115226187 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1015614580 6:135061939-135061961 TTGCTTAGGGATGGGGAGGTTGG + Intronic
1015802450 6:137074246-137074268 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1015935129 6:138401582-138401604 TTGTCTAGGCATAGGGAATGGGG + Intergenic
1016020960 6:139235790-139235812 TTTTATAGGCACAGGAAGGGGGG - Intergenic
1016656272 6:146521824-146521846 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1017542607 6:155418154-155418176 GTGTGTATGAATGGGGAGGGAGG - Intronic
1018183824 6:161247660-161247682 TTGAATAGGCGTGGTGAGAGAGG - Intronic
1018353859 6:162991777-162991799 TTGAATAGGCGTGGTGAGAGAGG + Intronic
1018607098 6:165609461-165609483 TTGAATAGGAATGGTGAGAGAGG - Intronic
1019411431 7:908452-908474 TTGTAGAGGCTTGGGGAGCGGGG - Intronic
1020366856 7:7390029-7390051 TTGAATAGGAATGGTGAGAGAGG + Intronic
1020584665 7:10051419-10051441 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1020640267 7:10746010-10746032 TTGTATAGGAGTGGTGAGAGAGG - Intergenic
1021290907 7:18844258-18844280 TCGTAAAGCCATAGGGAGGGTGG + Intronic
1021429169 7:20539918-20539940 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022622707 7:32001012-32001034 GTGTGTATGTATGGGGAGGGTGG + Intronic
1023146591 7:37157269-37157291 TTGAATAGGAATGGTGAGAGAGG - Intronic
1023516167 7:41004027-41004049 ATGCCTAGGGATGGGGAGGGTGG - Intergenic
1024990149 7:55227825-55227847 TTGAATAGGAATGGTGAGAGAGG + Intronic
1026080483 7:67214537-67214559 TTGAATAGGAATGGTGAGAGGGG + Intronic
1026316526 7:69232337-69232359 TGGGATAGGCAGGGGTAGGGGGG + Intergenic
1026592193 7:71706591-71706613 TTGTTTAGGGACGGGGAGGGAGG + Intronic
1026696606 7:72599491-72599513 TTGAATAGGAATGGTGAGAGGGG - Intronic
1028009032 7:85616682-85616704 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1028055135 7:86231610-86231632 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1028300647 7:89195292-89195314 TTGAATAGGAATGGTGAGAGAGG - Intronic
1028633488 7:92961670-92961692 TTTTACAGGTATGGGGAGAGGGG + Intergenic
1028729584 7:94130617-94130639 TAGGATAGGCATGGGGTTGGGGG - Intergenic
1028733997 7:94186085-94186107 TTGAATAGGAATGGTGAGGGAGG + Intergenic
1028816155 7:95147533-95147555 TTGAATAGGAGTGGGGAGAGAGG + Intronic
1029593434 7:101522638-101522660 TTGTATTTTCATGGGAAGGGAGG + Intronic
1029710022 7:102294445-102294467 ATGTGCAGGCATGGGCAGGGCGG - Intronic
1029919386 7:104246450-104246472 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1030371438 7:108703961-108703983 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1030997405 7:116375341-116375363 TTGAATAGGAATGGTGAGAGAGG - Intronic
1031257040 7:119466418-119466440 TTGTATAGAAAAGGTGAGGGAGG - Intergenic
1031527425 7:122838382-122838404 TTGAATAGGAATGGTGAGAGAGG - Intronic
1032966726 7:137106272-137106294 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1033101332 7:138475170-138475192 TGGTATGGGAATGGTGAGGGGGG + Intronic
1033127927 7:138721167-138721189 TTGCACAGGCAGGGGCAGGGAGG + Intronic
1033240902 7:139679199-139679221 TTGAATAGGCGTGGTGAGAGAGG + Intronic
1034714725 7:153231040-153231062 TTGGATAGGAATGGTGAGAGAGG + Intergenic
1035399107 7:158553235-158553257 GTGTATATGCATGGGGAATGTGG - Intronic
1035886571 8:3297723-3297745 TTGTATAGCTTTGGGGAGGGAGG + Intronic
1036085004 8:5604054-5604076 TTGCAGAGGGATGGGGAGGGCGG - Intergenic
1036591291 8:10170960-10170982 TTGCATAGGCGTGGTGAGAGTGG + Intronic
1036806482 8:11837867-11837889 TTGTGGAGGAGTGGGGAGGGAGG + Intronic
1037529538 8:19759108-19759130 GTGGACAGGCTTGGGGAGGGTGG + Intergenic
1038366109 8:26936975-26936997 TTGAATAGGGGTGGTGAGGGAGG + Intergenic
1038870260 8:31486136-31486158 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1038957792 8:32486077-32486099 TTAGCCAGGCATGGGGAGGGGGG - Intronic
1039036404 8:33364375-33364397 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1039180923 8:34865014-34865036 TTGTCTAGGGAAGGGAAGGGAGG - Intergenic
1039636706 8:39175221-39175243 TTGAATAGGAATGGTGAGAGAGG + Intronic
1039718828 8:40140258-40140280 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1040693763 8:49971468-49971490 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1041286003 8:56262444-56262466 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
1041655207 8:60342506-60342528 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1041713250 8:60911723-60911745 GTGCAGAGGCAAGGGGAGGGTGG + Intergenic
1041769534 8:61457888-61457910 TTGTCTAGGCCAGGGAAGGGGGG + Intronic
1041857193 8:62471230-62471252 GTGGATAGTCCTGGGGAGGGCGG + Intronic
1041886925 8:62820473-62820495 TAGAGTAGGCTTGGGGAGGGAGG + Intronic
1042115830 8:65430441-65430463 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1042116485 8:65437398-65437420 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1042981774 8:74537651-74537673 TTGAATAGGCATGGTGAGAGAGG + Intergenic
1043060841 8:75500845-75500867 TTTCAGAGGCAAGGGGAGGGAGG + Intronic
1043244067 8:77975779-77975801 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1043279778 8:78448944-78448966 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1043339667 8:79222370-79222392 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1044053577 8:87540282-87540304 TTGAATAGGAATGGTGAGAGAGG + Intronic
1044129270 8:88500201-88500223 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1044315473 8:90745616-90745638 CTGAATAGGCATGGTGAGAGAGG + Intronic
1044410161 8:91873478-91873500 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1044412114 8:91895303-91895325 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1044452604 8:92355243-92355265 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
1044455826 8:92392137-92392159 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1044596663 8:93965854-93965876 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1044671642 8:94687168-94687190 TTGTTTAGGGGTGGGGAGAGGGG - Intronic
1044768510 8:95603857-95603879 TATTTTAGGGATGGGGAGGGAGG - Intergenic
1045200053 8:99971330-99971352 TTGAATAGGAATGGTGAGAGAGG - Intronic
1045212480 8:100112695-100112717 TTGAATAGGAATGGTGAGAGAGG - Intronic
1045704151 8:104900618-104900640 GTCTATAGGAATGGGGAGGACGG - Intronic
1045839722 8:106565084-106565106 TTGTACAGGAGTGGTGAGGGAGG - Intronic
1046152477 8:110246157-110246179 TTGAATAGGAATGAGGAGAGTGG + Intergenic
1046285304 8:112085918-112085940 TTGTTTAGGAATGGTGAGAGAGG - Intergenic
1046329374 8:112695685-112695707 TTGAATAGGAATGGTGAGAGAGG - Intronic
1046657143 8:116907066-116907088 TTTCACAGGCATGGAGAGGGTGG + Intergenic
1046706220 8:117455377-117455399 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1046810872 8:118531965-118531987 TTGAATAGGAATGGCGAGCGAGG + Intronic
1046828643 8:118719754-118719776 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1046835715 8:118799044-118799066 TTGAATAGGCGTGGTGAGAGAGG - Intergenic
1046866936 8:119161434-119161456 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1046874409 8:119237892-119237914 TTGAATAGGAATGGTGAGAGAGG - Intronic
1047369182 8:124241606-124241628 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1047604485 8:126461364-126461386 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1047661764 8:127045087-127045109 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1047742387 8:127817008-127817030 TTGTATCGGGAGGGGGTGGGGGG - Intergenic
1048086182 8:131182686-131182708 TTGTATAGGAGTGGTGATGGTGG + Intergenic
1048122355 8:131596072-131596094 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1048367175 8:133748322-133748344 CTGCAAAGGCATGGGGAGAGAGG - Intergenic
1049859521 8:144889108-144889130 TTATATGGACATGGGGATGGCGG + Intronic
1049899371 9:143648-143670 TTGAATAGGAGTGGGGAGAGAGG - Intronic
1050174178 9:2852756-2852778 CTGTATGGGAATGGGGAGTGAGG + Intergenic
1050390851 9:5142736-5142758 TTGAATAGGAGTGGGGAGAGAGG + Intronic
1050505087 9:6339959-6339981 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1050590709 9:7157391-7157413 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1050661127 9:7884026-7884048 TTGAATAGGAGTGGTGAGGGAGG - Intronic
1050924572 9:11247935-11247957 TTGAACAGGCATGGTGAGAGAGG - Intergenic
1050954345 9:11635986-11636008 TTGAATAGGCGTGGTGAGAGAGG + Intergenic
1051300783 9:15648351-15648373 TTGAATAGGAATGGTGAGAGAGG - Intronic
1051319953 9:15892239-15892261 TTAAATAGGCATGGTGAGAGAGG + Intronic
1051549104 9:18309290-18309312 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1052005613 9:23344711-23344733 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1052067198 9:24036571-24036593 TAGTATAGGCAGGGGAAGTGTGG - Intergenic
1052094276 9:24365610-24365632 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1052114731 9:24636607-24636629 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1052281560 9:26739017-26739039 CTGTATAGGAATGGTGAGAGTGG - Intergenic
1052632362 9:31058105-31058127 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1052645264 9:31226545-31226567 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1052753122 9:32512673-32512695 TTGAATAGGAGTGGGGAGAGAGG - Intronic
1053041213 9:34874233-34874255 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1053196963 9:36127005-36127027 TTGTAGAGGCAGGGAGAGGAAGG - Intergenic
1053531176 9:38883119-38883141 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1053583280 9:39429398-39429420 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1054104860 9:60988141-60988163 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1054203398 9:62107551-62107573 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1054634964 9:67480813-67480835 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1054884549 9:70181893-70181915 TTGAATAGGAATGGTGAGAGAGG + Intronic
1054890348 9:70244399-70244421 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1055061809 9:72076618-72076640 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1055843654 9:80535108-80535130 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1056001332 9:82220032-82220054 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1056458066 9:86782474-86782496 TTGTCTAGGCCTTGGGATGGTGG + Intergenic
1058038913 9:100283135-100283157 TTTTGTAGAGATGGGGAGGGGGG - Intronic
1058055406 9:100443720-100443742 GTCTCTAGGCAAGGGGAGGGTGG + Intronic
1058187515 9:101872495-101872517 TTGAATAGGAATGGTGAGAGGGG - Intergenic
1058236643 9:102498342-102498364 TTGTATAGGCACAGGATGGGGGG + Intergenic
1058403230 9:104641307-104641329 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1058405171 9:104664931-104664953 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1059077005 9:111204057-111204079 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1060450042 9:123729215-123729237 TTGAATAGGAGTGGTGAGGGGGG - Intronic
1061048963 9:128182975-128182997 TTGGACAGGAATGGGGAGGGTGG - Intronic
1061659580 9:132119993-132120015 GTGTAGAGTCATGGGGAGGAGGG - Intergenic
1186740631 X:12514255-12514277 TTGAATAGGAATGGTGAGAGAGG + Intronic
1187769630 X:22680915-22680937 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1187784704 X:22870790-22870812 TTGAATAGGCGTGGTGAGAGAGG - Intergenic
1187945482 X:24422593-24422615 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1188014451 X:25092657-25092679 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1188140230 X:26541116-26541138 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1188828790 X:34870678-34870700 TTGAATAGGCATGGCGAGAGAGG - Intergenic
1188957765 X:36454072-36454094 TTGTGTAGGGATGGGGAGCTGGG - Intergenic
1188969230 X:36592904-36592926 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1188983284 X:36747732-36747754 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1189009623 X:37034255-37034277 TTGGTTAAGCAAGGGGAGGGGGG + Intergenic
1189038947 X:37521462-37521484 TTGGTTAAGCAAGGGGAGGGGGG - Intronic
1189584009 X:42438791-42438813 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1189945674 X:46175603-46175625 TTGAATAGGCATGGTGAAAGTGG + Intergenic
1190593374 X:52027663-52027685 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1190606352 X:52147366-52147388 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1190836464 X:54105512-54105534 TTGAATAGGAATGGTGAGAGAGG - Intronic
1190922349 X:54866342-54866364 TTGAATAGGAGTGGTGAGGGTGG + Intergenic
1191173210 X:57471199-57471221 TTGAATAGGAATGGTGAGAGAGG - Intronic
1191196337 X:57727515-57727537 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1191203240 X:57807070-57807092 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1191209202 X:57867247-57867269 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1191227010 X:58054357-58054379 ATGTTCAGGCATGGGCAGGGTGG - Intergenic
1191606519 X:63068444-63068466 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1191657130 X:63610604-63610626 TTGAATAGGAGTGGTGAGGGAGG - Intergenic
1191768500 X:64729308-64729330 TTGAATAGGCATGGTGAGAGAGG + Intergenic
1191827908 X:65385682-65385704 TTGAATAGGAATGGTGAGAGAGG + Intronic
1191948829 X:66565824-66565846 TTGAATAGGAGTGGGGAGAGAGG + Intergenic
1192008024 X:67238184-67238206 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1192048945 X:67705683-67705705 TTGAATAGGAATGGTGAGAGAGG + Intronic
1192476645 X:71449705-71449727 TTGTACAGGCTTGGTGAAGGAGG + Intronic
1192707735 X:73544555-73544577 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1192832010 X:74760425-74760447 TTGAATAGGAACGGTGAGGGAGG + Intronic
1192880771 X:75281302-75281324 TTGAAGAGGAATGGTGAGGGTGG + Intronic
1192966158 X:76179329-76179351 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1193085368 X:77444132-77444154 ATGTGTGGGCATGGGGTGGGGGG + Intergenic
1193091521 X:77498666-77498688 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1193469614 X:81883839-81883861 TTGAATAGGCATGGTGAAAGTGG + Intergenic
1193510386 X:82392198-82392220 TTGAATAGGGATGGTGAGAGAGG - Intergenic
1193594234 X:83426193-83426215 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1193752407 X:85362281-85362303 TTGAATAGGAGTGGGGAGAGAGG + Intronic
1193766352 X:85533168-85533190 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1193773528 X:85616657-85616679 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1193806926 X:86006366-86006388 TTGAATAGGCATGGTGAGAGAGG - Intronic
1193963693 X:87956759-87956781 TTGAATAGGGATGGTGAGTGTGG - Intergenic
1194417473 X:93631422-93631444 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1194441918 X:93943840-93943862 TTGAATAGGAGTGGGGAGAGAGG - Intergenic
1194501124 X:94682496-94682518 TTTAATAGGCATGGTGAGAGTGG + Intergenic
1194636192 X:96347403-96347425 TTGAATAGGAATGGGGAGAGAGG + Intergenic
1194658483 X:96601725-96601747 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1194945078 X:100057391-100057413 AAGTATAGGCTTGGGCAGGGTGG - Intergenic
1195930968 X:110075495-110075517 TTGAATAGGAATGGTGAGAGCGG + Intronic
1196133030 X:112178188-112178210 TGGTATAGGCAAGGGGAGCTTGG - Intergenic
1196608134 X:117679136-117679158 TTGAATAGGAATGGTGAGAGTGG - Intergenic
1196649714 X:118156493-118156515 TTGTGTTGGAATGGGGTGGGAGG - Intergenic
1197191471 X:123652385-123652407 TTGAATAGGAATGGTGAGAGAGG - Intronic
1197447089 X:126563714-126563736 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1197448338 X:126580209-126580231 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1197466639 X:126812703-126812725 TTGAAAGGGTATGGGGAGGGTGG + Intergenic
1197523050 X:127523598-127523620 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1197600947 X:128529095-128529117 TTGAATAGGAGTGGGGAGAGTGG - Intergenic
1197687175 X:129453400-129453422 TTGAATAGGAGTGGGGAGAGAGG - Intronic
1198361494 X:135900031-135900053 TTGAATAGGCGAGGTGAGGGAGG + Intronic
1198474126 X:136979163-136979185 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1198579028 X:138043051-138043073 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1198885222 X:141327789-141327811 TTGAATAGGTATGGTGAGAGAGG - Intergenic
1199269733 X:145869040-145869062 TTGAATAGGCGTGGTGAGGGAGG + Intergenic
1199437671 X:147830900-147830922 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1200388114 X:155914399-155914421 TTGAATAGGAGTGGTGAGGGAGG + Intronic
1200471448 Y:3591095-3591117 TTGAATAGGAGTGGTGAGGGAGG + Intergenic
1200583406 Y:4977336-4977358 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1200887985 Y:8290751-8290773 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1201376934 Y:13332695-13332717 TTGAATAGGTATGGTGAGAGAGG - Intronic
1201421913 Y:13808761-13808783 TTGAATAGGCGTGGTGAGAGAGG + Intergenic
1201595590 Y:15664810-15664832 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1201652037 Y:16299462-16299484 TTGAATAGGCGTGGTGAGAGAGG - Intergenic
1201704058 Y:16916144-16916166 TTGTATAGGAGTGGTGAGAGAGG - Intergenic
1201800341 Y:17948205-17948227 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1201801212 Y:17957751-17957773 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1202017641 Y:20428313-20428335 TTGGAAAGGTATTGGGAGGGAGG + Intergenic
1202175011 Y:22090152-22090174 TTGAATAGGAATGGTGAGAGAGG - Intronic
1202216351 Y:22496231-22496253 TTGAATAGGAATGGTGAGAGAGG + Intronic
1202326835 Y:23699833-23699855 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1202357036 Y:24062737-24062759 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1202361156 Y:24111714-24111736 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1202509622 Y:25558404-25558426 TTGAATAGGAATGGTGAGAGAGG - Intergenic
1202513741 Y:25607377-25607399 TTGAATAGGAATGGTGAGAGAGG + Intergenic
1202543934 Y:25970219-25970241 TTGAATAGGAATGGTGAGAGAGG + Intergenic