ID: 1006190428

View in Genome Browser
Species Human (GRCh38)
Location 6:32204247-32204269
Sequence CAGCGTAGCCCCACAAAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006190425_1006190428 -9 Left 1006190425 6:32204233-32204255 CCACGTCTCCCTCACAGCGTAGC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1006190428 6:32204247-32204269 CAGCGTAGCCCCACAAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1006190424_1006190428 3 Left 1006190424 6:32204221-32204243 CCAGACACTCGTCCACGTCTCCC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1006190428 6:32204247-32204269 CAGCGTAGCCCCACAAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1006190423_1006190428 25 Left 1006190423 6:32204199-32204221 CCTGTGGGGTGGCAGGGCTGGTC 0: 1
1: 0
2: 7
3: 41
4: 303
Right 1006190428 6:32204247-32204269 CAGCGTAGCCCCACAAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006190428 Original CRISPR CAGCGTAGCCCCACAAAGCC TGG Exonic
900148627 1:1168807-1168829 CCGGGTACCCCCACACAGCCAGG + Intergenic
902252431 1:15163132-15163154 CACCGTTTCCCCCCAAAGCCTGG - Intronic
904587216 1:31587059-31587081 CAGCCTCGCCCGACAGAGCCCGG + Exonic
913119494 1:115726745-115726767 CAGCAAATCCCCTCAAAGCCAGG - Intronic
919803713 1:201368419-201368441 CAGCTTAGCCCCACTCATCCCGG + Intronic
923479890 1:234373958-234373980 CAGCGTGGGCTCAGAAAGCCCGG - Intronic
1064580616 10:16789445-16789467 CAACAGACCCCCACAAAGCCCGG + Intronic
1070890484 10:79939286-79939308 CTGAGCAGCCCAACAAAGCCAGG - Intronic
1070890999 10:79942191-79942213 CAGAGGAGCCCCAGAAAGCAAGG - Intronic
1070960522 10:80497260-80497282 CTGCTCAGCCACACAAAGCCTGG - Intronic
1074340415 10:112623350-112623372 TAGAGTAGCCCCAAAAAGTCAGG + Intronic
1076116371 10:127904577-127904599 CAGAGGAGCTCCTCAAAGCCTGG + Intergenic
1078865606 11:15294564-15294586 CAGCAAAGCCCAATAAAGCCTGG - Intergenic
1084605092 11:70167736-70167758 CAGCGCAGCCCGACACAGCCTGG + Intronic
1087012114 11:93524246-93524268 CAGCTCAGGCTCACAAAGCCAGG + Intronic
1087048339 11:93863165-93863187 CAACGTTACCCCACAGAGCCTGG - Intergenic
1088673439 11:112167228-112167250 CACCGTAGCCTCCCAGAGCCAGG - Intronic
1092836867 12:12498555-12498577 CAGGCTAGGGCCACAAAGCCCGG + Intronic
1093922023 12:24869409-24869431 CAGGGACTCCCCACAAAGCCAGG - Intronic
1097261302 12:57721696-57721718 CAGGGTAGCTAAACAAAGCCTGG + Intergenic
1101328498 12:103737954-103737976 CTACTTAGCCCCACACAGCCTGG + Intronic
1105067272 12:133211436-133211458 CAGAGTAGCGCCACCACGCCTGG - Intergenic
1117674182 14:58139280-58139302 CAGCGTTGCCACACAATGTCTGG - Exonic
1118697323 14:68397722-68397744 CAGCCTTGCCTCAGAAAGCCGGG + Intronic
1118939306 14:70317783-70317805 CAGCAGAGCCTCACAAACCCTGG - Intergenic
1121797567 14:96747785-96747807 TACCGGAGCCCCTCAAAGCCAGG + Intergenic
1122054201 14:99081517-99081539 CAGCGTGGCCCCAAAATGCCTGG - Intergenic
1202860973 14_GL000225v1_random:80605-80627 CAGCGCAGTCTCACAAAGGCAGG + Intergenic
1128081075 15:64857184-64857206 CAGACTAGGCCCACAAGGCCTGG - Intronic
1132348222 15:101121321-101121343 CAGCGTGGCCCCCCAAATCACGG + Intergenic
1135994187 16:27236002-27236024 CAGAGTTGCACCACAAGGCCGGG + Intronic
1144226905 17:13158034-13158056 CAGGGTAGCACCACCAAGCCTGG - Intergenic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1147637787 17:41974558-41974580 CAGTGTAGCCCCAAGAAGGCTGG + Exonic
1148767174 17:50046202-50046224 CAGCCTGACCGCACAAAGCCAGG + Intergenic
1154367686 18:13726415-13726437 CAGAGCAGCCCGACAAAGCGTGG + Exonic
1157478491 18:48038030-48038052 CACCTTAGCCCCACAGAACCAGG - Intronic
1160765973 19:808266-808288 CCGCGCACCCCCACAAGGCCCGG - Intronic
1160991290 19:1861374-1861396 CAACTTACCCCCAAAAAGCCAGG + Intronic
1163546382 19:17943449-17943471 CAGCCTTGCCCCGAAAAGCCCGG - Intronic
929994572 2:46817314-46817336 AAGAGAAGCCCCACAGAGCCAGG - Exonic
931754634 2:65361893-65361915 CAGCAGAGCCCCACAGGGCCAGG + Intronic
934541228 2:95176617-95176639 CAGCCTAGCCCCACACTCCCTGG - Intronic
934566489 2:95344361-95344383 CAGCGTAGGCCCACTGAGGCTGG - Intronic
937331314 2:121032079-121032101 AAGCGTAACCCCACAGGGCCTGG + Intergenic
937492912 2:122388514-122388536 CTGAGTGGCCCCACAAAGCATGG - Intergenic
948965507 2:241376549-241376571 CTGCATAGCCCCACAGAGGCAGG + Intronic
948983310 2:241505998-241506020 CAGTGTTGCCCCACAAAACAAGG + Intronic
949046233 2:241873737-241873759 CAGGGCAGACCCACAAAACCAGG - Exonic
949061337 2:241959636-241959658 CAGCTGAGCCCCCGAAAGCCGGG - Intergenic
1169697170 20:8403217-8403239 CTCCTCAGCCCCACAAAGCCAGG + Intronic
1171949524 20:31408307-31408329 CAGCTTTGCCCCACCATGCCCGG - Intronic
1172696940 20:36829450-36829472 CAGCACAGCCCCAGAAAGCTGGG + Intronic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1177206130 21:18014042-18014064 CAGCTTGTGCCCACAAAGCCTGG - Intronic
1178427545 21:32491204-32491226 CACTGCAGCCCCAGAAAGCCAGG - Intronic
1178910194 21:36667863-36667885 CATGGTTGCTCCACAAAGCCAGG - Intergenic
1182797413 22:33000853-33000875 CAGGGCAGCCCCACAATGCCTGG - Intronic
1183493187 22:38127566-38127588 CAGGGTAGCCCGACCAAGCCTGG - Intronic
1185252930 22:49814969-49814991 GAACGTTGCCCCACAAAGCTAGG + Intronic
959062368 3:101627534-101627556 CAGCTGTGCCCCACAATGCCCGG + Intergenic
961825098 3:129595158-129595180 CAGCCCAGCCGCACACAGCCAGG + Intronic
965534779 3:169812768-169812790 CAGCGGAGCCCCTCAAACCTCGG - Intronic
969642525 4:8407549-8407571 CAGCAAAGCACCACAAAGCAGGG - Intronic
972961175 4:44454016-44454038 TAGCTTAGCTCCCCAAAGCCTGG + Intergenic
981600318 4:146481162-146481184 CTGCTTAGCCCCAGAAAGCATGG - Intronic
996856686 5:128016120-128016142 CAGCTTTGCCCCACACTGCCTGG + Intergenic
999183106 5:149684027-149684049 CACCTTGGCCTCACAAAGCCTGG + Intergenic
1001630002 5:173167987-173168009 GAGCGTGGCACCACATAGCCGGG - Intergenic
1005361443 6:25035157-25035179 CGGCTGGGCCCCACAAAGCCTGG - Intronic
1006190428 6:32204247-32204269 CAGCGTAGCCCCACAAAGCCTGG + Exonic
1006885605 6:37379587-37379609 CAGAGGAGCCCCACAAATACAGG + Intronic
1008810956 6:55498193-55498215 CAGGCTGGCCCCACAAAACCTGG - Intronic
1013056172 6:106584997-106585019 CAGCATAGCCAGGCAAAGCCAGG + Intronic
1018664981 6:166127002-166127024 CAGCGAAGCACAAGAAAGCCAGG + Intergenic
1019620286 7:1988461-1988483 CAGGGAAGCCCTCCAAAGCCAGG + Intronic
1022063439 7:26824668-26824690 GACCATAGTCCCACAAAGCCTGG - Intronic
1024189237 7:46988639-46988661 CAGGGTTGCACCACCAAGCCTGG - Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1032582691 7:133117851-133117873 CATCGTAGCTCCACATAGGCAGG - Intergenic
1035221146 7:157407182-157407204 CAGGGTAACCCCACACATCCTGG - Intronic
1037626859 8:20615705-20615727 CAGCTTGGCCTCCCAAAGCCTGG + Intergenic
1041205934 8:55498040-55498062 AAGCGGAGCCCTGCAAAGCCAGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1049682655 8:143926576-143926598 CAGTGTAGCCACACCAGGCCAGG + Intronic
1051791704 9:20811222-20811244 CCACTTAGCCCCACAAAGACAGG - Intronic
1057746996 9:97760334-97760356 CAGCATAGCCCAACAATGCTAGG + Intergenic
1059758609 9:117317406-117317428 CAGCAGAGCCCGACAATGCCTGG + Intronic
1062005449 9:134236459-134236481 CAGAGTGGCAGCACAAAGCCTGG - Intergenic
1062239428 9:135527695-135527717 CAGGGTTGCGCCACCAAGCCTGG - Intergenic
1062424090 9:136498099-136498121 CAGCATGGCCCCACAGAGACTGG - Intronic
1062522758 9:136965255-136965277 ACGCGAAGCCCCAGAAAGCCAGG + Intergenic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1186857608 X:13640761-13640783 CAGCCTAGCCTGAGAAAGCCTGG + Intergenic
1190776847 X:53559465-53559487 CAGCCTTCCCCTACAAAGCCGGG - Exonic
1195551004 X:106171009-106171031 CAGCCGAGCCCCAGAAAGACAGG + Exonic