ID: 1006191662

View in Genome Browser
Species Human (GRCh38)
Location 6:32213195-32213217
Sequence CAGAGGCAGGAGAAGGTGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 998
Summary {0: 1, 1: 0, 2: 11, 3: 104, 4: 882}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006191653_1006191662 9 Left 1006191653 6:32213163-32213185 CCTCACAGCGCGGGCCCTGGAAG 0: 1
1: 1
2: 1
3: 14
4: 146
Right 1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG 0: 1
1: 0
2: 11
3: 104
4: 882
1006191656_1006191662 -6 Left 1006191656 6:32213178-32213200 CCTGGAAGCCCATGGCACAGAGG 0: 1
1: 0
2: 7
3: 40
4: 322
Right 1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG 0: 1
1: 0
2: 11
3: 104
4: 882
1006191655_1006191662 -5 Left 1006191655 6:32213177-32213199 CCCTGGAAGCCCATGGCACAGAG 0: 2
1: 0
2: 0
3: 22
4: 299
Right 1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG 0: 1
1: 0
2: 11
3: 104
4: 882
1006191652_1006191662 10 Left 1006191652 6:32213162-32213184 CCCTCACAGCGCGGGCCCTGGAA 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG 0: 1
1: 0
2: 11
3: 104
4: 882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006191662 Original CRISPR CAGAGGCAGGAGAAGGTGCC AGG Exonic
900025247 1:266781-266803 CAGAGGCTGTAGAATGTGCACGG + Intergenic
900028849 1:356163-356185 CAGAGGCTGTAGAATGTGCACGG + Intergenic
900179032 1:1303352-1303374 CAGAGGCAGGAAGAGCTCCCAGG + Intronic
900294104 1:1940074-1940096 CACATGCAGGTGCAGGTGCCTGG + Intronic
900465770 1:2824807-2824829 CAGAGGGAGGAGAGGCAGCCAGG - Intergenic
900511982 1:3065107-3065129 CTGGGGCAGGAGAACATGCCCGG + Intergenic
900647269 1:3714605-3714627 CAGAGGCCGGAGGAGAGGCCAGG + Intronic
900930595 1:5734688-5734710 CAGAGACAGGGGAGGGTGCGTGG - Intergenic
900997689 1:6131251-6131273 CAGAGGCAGGAGAGAGTGAAAGG - Intronic
901212390 1:7534019-7534041 CAGGGTCAGGAGAAGGCTCCAGG - Intronic
901788661 1:11641677-11641699 GAAAGGCAGGGGAAGGTCCCAGG + Intergenic
901798671 1:11694628-11694650 CAGAGGCATGAGCATGTTCCTGG + Intronic
901809972 1:11762000-11762022 CAGAGGGTGGAGGAGGTTCCCGG + Exonic
902056879 1:13608285-13608307 CATAGACAAGAGAAGGTGCCAGG + Intronic
902161049 1:14530608-14530630 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902521328 1:17018677-17018699 CAGGGGAATGTGAAGGTGCCAGG - Intergenic
903179982 1:21600335-21600357 GAGAGGCAGGAAAGGGTGGCAGG - Intronic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903736849 1:25535351-25535373 CAGAGGCTGGTTAAGGGGCCTGG - Intergenic
903810172 1:26030957-26030979 CAGAGGTGGGAGATGGTGGCAGG - Intronic
903894562 1:26595415-26595437 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904284372 1:29444484-29444506 TAGAGGCAGGACTAGGGGCCTGG + Intergenic
904300356 1:29549953-29549975 CAGAGGCTGGAGGTGGGGCCTGG + Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904397540 1:30232253-30232275 CAGATACAGGAGAAGTTCCCGGG + Intergenic
904457868 1:30658103-30658125 CAGAGGCTGGAGGTGGGGCCTGG - Intergenic
904494623 1:30879646-30879668 CAGGGGCAGGAGCCGGAGCCTGG - Intronic
904611723 1:31729483-31729505 TAAAGGCAGGAGAAGGTGCCGGG - Intronic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905012227 1:34755361-34755383 CAAAGGTAGGAGCAGGGGCCAGG + Intronic
905027762 1:34862910-34862932 CATAGGCTGGAGAGGGTGACAGG - Intergenic
905540109 1:38753919-38753941 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
905595711 1:39204863-39204885 GAGATGGAGGAGAAGCTGCCAGG + Intronic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
906060410 1:42944773-42944795 CAGAGGCAGGCTAAGGGGTCAGG - Intronic
906197567 1:43938429-43938451 CAGAGGCAGGAGCTGCAGCCGGG + Intergenic
906702638 1:47871236-47871258 CAGGAGCAGGAGAATGTGCTTGG + Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907679695 1:56551561-56551583 AAGGGGAAGGAGAAGATGCCTGG + Intronic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
910764666 1:90769751-90769773 CACAGACAGGAGAGGGTGTCAGG + Intergenic
910979734 1:92947884-92947906 CAGAGGTAGGAAAAGGTACGGGG + Intronic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911695600 1:100887795-100887817 CTGAGGCAGGAGAATGACCCGGG - Intronic
912144804 1:106780392-106780414 CAGATGCAGGATAAGGTGCAGGG - Intergenic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912411211 1:109481868-109481890 CTGAGGTAGAAGAAGGTGTCTGG + Exonic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
913056560 1:115167123-115167145 CAAAGACAAGAGAAGGAGCCAGG - Intergenic
913200748 1:116493826-116493848 CTGAGGCCTGAGATGGTGCCGGG + Intergenic
913329289 1:117653857-117653879 CAGGTGCTGGAGAAGATGCCAGG - Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913600771 1:120419873-120419895 TAGATGCAGGCGAAGGTTCCTGG + Intergenic
913702108 1:121383660-121383682 GAGAGGCAGGAGAAGCTCCTGGG + Intronic
914042666 1:144064129-144064151 GAGAGGCAGGAGAAGCTCCTGGG + Intergenic
914086286 1:144456760-144456782 TAGATGCAGGCGAAGGTTCCTGG - Exonic
914135420 1:144896359-144896381 GAGAGGCAGGAGAAGCTCCTGGG - Intronic
914192180 1:145420711-145420733 TAGATGCAGGCGAAGGTTCCTGG - Intergenic
914244125 1:145873167-145873189 CTGAGGCAGCAGCAGCTGCCTGG - Exonic
914590087 1:149098661-149098683 TAGATGCAGGCGAAGGTTCCTGG - Exonic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
915002654 1:152607696-152607718 CTGAGCCAGGAGAGGGTGCTGGG - Intergenic
915239200 1:154507790-154507812 CATAGCCAGGACTAGGTGCCAGG - Intronic
915283736 1:154839816-154839838 CACAGACGGGACAAGGTGCCAGG + Intronic
915294988 1:154913953-154913975 GAGAGACAGCAGGAGGTGCCAGG - Intergenic
915662500 1:157415865-157415887 CGGAGGCAGGAGTCTGTGCCCGG - Intergenic
916108264 1:161446270-161446292 CAGAGGCTGGAGAGGGTGTGTGG + Intergenic
916109850 1:161453650-161453672 CAGAGGCTGGAGAGGGTGTGTGG + Intergenic
916111437 1:161461061-161461083 CAGAGGCTGGAGAGGGTGTGTGG + Intergenic
916113023 1:161468441-161468463 CAGAGGCTGGAGAGGGTGTGTGG + Intergenic
916116815 1:161491988-161492010 CAGAGGCTGGAGAGGGTGTATGG - Intergenic
916400896 1:164447706-164447728 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
916454122 1:164953069-164953091 CAGGCGCTGGAGAAGCTGCCTGG + Intergenic
916776329 1:167968569-167968591 ATGAGGCAGGAGAAGCTGTCGGG + Intronic
916853459 1:168726936-168726958 CAGCAGCAGGTGAGGGTGCCGGG - Intronic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917542432 1:175927240-175927262 AAGAGAGAGGAGAAGGTGCCAGG + Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918473925 1:184903566-184903588 AAGAGAGAGGAGAAGGTGCCAGG - Intronic
919781776 1:201225850-201225872 CACCTGCAGGAGAACGTGCCTGG + Exonic
920150851 1:203906220-203906242 CTGAGGCAGGAGGATGGGCCAGG - Intergenic
920189984 1:204187555-204187577 CAGGGGCAAGAGCAGATGCCTGG + Intergenic
920371120 1:205479971-205479993 GAGGGGCAGGAGAAGAAGCCAGG + Intergenic
920415178 1:205794830-205794852 CAGGGGCATGGGAAGGAGCCAGG - Intronic
920489529 1:206402375-206402397 GAGAGGCAGGAGAAGCTCCTCGG + Intronic
921231865 1:213081350-213081372 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
921238576 1:213153300-213153322 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
922812964 1:228428271-228428293 AAGAGAGAGGAGGAGGTGCCGGG + Intergenic
922891068 1:229062312-229062334 CATAGGCAGGGCCAGGTGCCAGG + Intergenic
923040703 1:230318062-230318084 CAGAGCTAGGAGAATGTGCCTGG + Intergenic
923417065 1:233773309-233773331 AAGAGGGAGGAGGAGGTGCCAGG + Intergenic
923946879 1:238898185-238898207 CTGAGGCAGGAGAATTGGCCAGG + Intergenic
924426210 1:243952547-243952569 CAGACGCAGGAGCAGCTGGCTGG + Intergenic
1062934201 10:1374056-1374078 CAGAGGCAGGAGGACATGCCAGG - Intronic
1063004170 10:1952623-1952645 CAGAGGCCGGGGAGGGTGCTGGG - Intergenic
1063369842 10:5514072-5514094 CAGAGGGAGGAGAGGGGGCAGGG - Intergenic
1063541098 10:6934634-6934656 GAGAGGGAAGAGGAGGTGCCAGG - Intergenic
1063960576 10:11302224-11302246 CTGAGGCATGAGAAGGTGAGAGG - Intronic
1064628645 10:17286661-17286683 AAGAGGGAGGAGGAGGTGTCAGG + Intergenic
1064960956 10:20964496-20964518 CAAGGGCAGGGGAATGTGCCAGG + Intronic
1064978941 10:21147222-21147244 GAGAGGCAGGAGGAGGTCCCAGG - Intronic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066554000 10:36591117-36591139 AAGGAGCAGGAGAAGGTGCTGGG + Intergenic
1067753311 10:48985854-48985876 CAGAGGCAGCAGAGGTAGCCAGG + Intergenic
1067762521 10:49058822-49058844 CAGGGTCAGGAGAAGATGCCTGG - Intronic
1068041042 10:51824734-51824756 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1068610913 10:59058977-59058999 CACAGGAAGGAGAAATTGCCTGG - Intergenic
1068806063 10:61195106-61195128 CAGGGGCAGGATAAGGACCCAGG - Intergenic
1069555473 10:69394927-69394949 CTGAGACAGGAGGAGGGGCCTGG - Intronic
1069729149 10:70599999-70600021 CAGAGGCAGGAGACCTGGCCGGG - Intronic
1070700703 10:78599766-78599788 CAGAGGAAGGAGAGGATCCCAGG + Intergenic
1070742871 10:78913894-78913916 CTGGGGCAGGAACAGGTGCCCGG + Intergenic
1070827977 10:79402127-79402149 CAGAGGAGGCAGAAGGTCCCTGG + Intronic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071198642 10:83191797-83191819 CAGTGGCAGGAGTAAGAGCCAGG + Intergenic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071514045 10:86285259-86285281 CAGAGGCGGGAGAGGGTGTCTGG - Intronic
1071562944 10:86657382-86657404 CCGAGGCTGGTGAAAGTGCCTGG + Intronic
1071572675 10:86706597-86706619 GAGAGGCAGCAGCAGGTGGCTGG - Intronic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1072567027 10:96625258-96625280 AAGAGGGCAGAGAAGGTGCCAGG + Intronic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1073476470 10:103756942-103756964 TAGAGACAGAAGAAGGTGCTAGG - Intronic
1073502151 10:103949937-103949959 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1073542255 10:104323823-104323845 CAGATCCAGGGGCAGGTGCCTGG - Intronic
1073831894 10:107394145-107394167 TAGGGCCAGAAGAAGGTGCCAGG - Intergenic
1074003006 10:109391024-109391046 CAACAGCAGGAGAAGGTTCCAGG + Intergenic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074496702 10:113985924-113985946 CAGAGGCAGGAGAGAGAGACAGG + Intergenic
1074753711 10:116609649-116609671 CAGAGGCAGGCACAGGTGCAGGG + Intergenic
1074895989 10:117778176-117778198 CAGAGGGAGGAGCAGGTACAAGG + Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075166422 10:120071951-120071973 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1075278034 10:121112929-121112951 GAGAGGGAGGTGAAGGTGCCAGG + Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1075870696 10:125771062-125771084 CAGAGGGAGCTGGAGGTGCCAGG + Intronic
1076178777 10:128389420-128389442 CAGAGGGAAGAGAAGGTGCGAGG + Intergenic
1076526737 10:131116844-131116866 CAGAGGCAGGAGGATCTGCGGGG + Exonic
1076725324 10:132410412-132410434 CAGAGGCAGGTGGAGATGACAGG + Intronic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076796001 10:132798813-132798835 GTGAGGTAGGAGAAGGGGCCTGG + Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076886413 10:133264826-133264848 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886455 10:133265024-133265046 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886509 10:133265263-133265285 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886519 10:133265303-133265325 CAGAGGCTGCAGCAGGAGCCGGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077054543 11:584549-584571 GAGGGGCAGGAGGAGGTGGCTGG + Intronic
1077231304 11:1459260-1459282 AAGTGGCAGGTGGAGGTGCCAGG - Intronic
1077233639 11:1469629-1469651 CAGGAGCAGGAGCAGGTGCAGGG + Intronic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077237440 11:1488492-1488514 AACAGTCAGGACAAGGTGCCGGG + Intronic
1077614180 11:3663275-3663297 CAGAGCCAGGACAAGAAGCCAGG + Intronic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078103623 11:8344873-8344895 AGGAGGCTGGAGATGGTGCCTGG - Intergenic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078582168 11:12547129-12547151 CAGAGGGCTGAGAAGGGGCCAGG - Intergenic
1079076058 11:17386250-17386272 CACAGGGAGGAGGAGATGCCAGG - Exonic
1079401717 11:20111296-20111318 CTAAGGCAGGAGAAGGAACCTGG - Intronic
1080422295 11:32121269-32121291 ATGAGGCAGGAGCAGGTGGCTGG + Intergenic
1080718912 11:34830425-34830447 CACAGGCAGGAGAAGCTTCCAGG - Intergenic
1080882197 11:36332742-36332764 CAGCAGGAGGAGGAGGTGCCAGG - Intronic
1081391744 11:42537572-42537594 CAGAGGCAAGTGAATGTGTCTGG - Intergenic
1081906347 11:46672771-46672793 AAGAGGAAGGAGACAGTGCCAGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082812006 11:57483966-57483988 CAGAGGCACAAGCAGGTGCAGGG + Intergenic
1082987901 11:59183752-59183774 CAGAGGTAGGAGTAGGGGCTGGG - Intronic
1083118074 11:60483628-60483650 CAGAGGCAAGTGAAGGATCCTGG - Intergenic
1083153885 11:60810771-60810793 TGGAGTCAGGAGCAGGTGCCAGG - Intergenic
1083280969 11:61627138-61627160 CAGAGGCAGGAGCAGGCCCAGGG - Intergenic
1083307566 11:61769233-61769255 GAGAGCCAGGGGAAGGGGCCGGG - Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083495942 11:63053121-63053143 GAGAGAGGGGAGAAGGTGCCAGG - Intergenic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1083935656 11:65868551-65868573 CAGTGGCAGGAGAAACGGCCTGG + Exonic
1083935952 11:65870245-65870267 TAGAGGCAGGAGAAGGAGGGCGG + Intronic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084642416 11:70433753-70433775 CAGAGGCAGGCGCAGCTGCCTGG - Intronic
1084724434 11:70931654-70931676 AAGGGGCAAGAGAAGGTGTCTGG + Intronic
1084775069 11:71369565-71369587 CAGAGGCTGGACCAGGTGCTGGG + Intergenic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1085017720 11:73186118-73186140 CAGAGACAGGAGAAGCTGCAAGG - Intergenic
1085409538 11:76283033-76283055 CAGAGTCAGCAGCAGGGGCCAGG - Intergenic
1085450488 11:76629315-76629337 CCCAGACAGGAGAAGGGGCCTGG - Intergenic
1085636565 11:78163777-78163799 AAGGGGCAGGAGAAGATGCTGGG + Intergenic
1085637138 11:78167644-78167666 AAGGGGCAGGAGAAGATGCTAGG + Intergenic
1086193462 11:84108631-84108653 CTGAGGCAAGAGAAGGTAGCAGG + Intronic
1086365852 11:86109761-86109783 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1087044807 11:93836072-93836094 ATGAGGAAGGAGAAGGTGTCAGG - Intronic
1087153936 11:94883047-94883069 CACAGGCAGGGTAAGGTGCAGGG - Intergenic
1087219514 11:95531245-95531267 AAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1088115678 11:106310131-106310153 CAGAGCCAGGAGATGGTTCCTGG + Intergenic
1088424318 11:109685485-109685507 CAGAGGCTTGAGAGGGTGCATGG + Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089155378 11:116398057-116398079 GAGATGCAGGAGAAGTGGCCAGG + Intergenic
1089272838 11:117314145-117314167 CAGAAACAGGAGTAGGTCCCAGG + Intronic
1089289075 11:117426956-117426978 GAGAGGCAGAAGCAGGTGACTGG - Intergenic
1089586672 11:119513858-119513880 AAAAGGCAGGAGACGGGGCCAGG - Intergenic
1090091586 11:123702891-123702913 AAGAGGGAGGAGAAAGTGCTAGG + Intergenic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1092124490 12:6065799-6065821 CAGAGGCAGGATGAGGTGGGAGG + Intronic
1092500496 12:9041586-9041608 AAGAGACAGTAGAAGTTGCCAGG - Intergenic
1092701271 12:11233704-11233726 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1092751754 12:11725767-11725789 GAGAGGCAGGGGGAGGTACCAGG - Intronic
1092961295 12:13598833-13598855 CACAGGAAGGAGTAGCTGCCAGG - Intronic
1093939846 12:25041105-25041127 CAGAGCAAGGAGCCGGTGCCAGG + Intronic
1094228923 12:28080655-28080677 GAGAGACAGGAGGAGGTGCAAGG - Intergenic
1095773454 12:45988077-45988099 CAGAAGCAAGACAAGGTGCAAGG + Intronic
1096034897 12:48457931-48457953 CAGAGGAGGGAGAAGCTGCTGGG - Intergenic
1096476832 12:51913678-51913700 CGGAGGCAGGAGAAGCAGCGTGG + Exonic
1096749312 12:53748643-53748665 CAGAGGCATGAGAAGGTCCCAGG + Intergenic
1096817705 12:54211759-54211781 CAGAGACAGGAGGAAGTGCAAGG - Intergenic
1096825400 12:54272933-54272955 CAGAGGCAGGACAAGAACCCAGG + Intronic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1097024187 12:56042129-56042151 CGGAGAGAGGAGACGGTGCCTGG - Exonic
1097874822 12:64633440-64633462 GAGAGAGAGGAGGAGGTGCCAGG - Intronic
1098083315 12:66813238-66813260 AAGAGAGAGGAAAAGGTGCCGGG + Intergenic
1098270014 12:68761044-68761066 CAGAGGCAACAGCAGGTGCGAGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099184453 12:79502727-79502749 CAGAGAGAGGAGGAGATGCCAGG + Intergenic
1099543240 12:83941700-83941722 GAAAGAGAGGAGAAGGTGCCAGG + Intergenic
1100281926 12:93126525-93126547 CAAAGGTAGGAGAAGGTTCTGGG - Intergenic
1101146276 12:101843752-101843774 TAGAAGCAGGAGTAGATGCCAGG - Intergenic
1101442143 12:104711867-104711889 CTGAGGCAGAAGAAGCTTCCGGG + Intronic
1101443743 12:104722629-104722651 CACAGGAAGGAACAGGTGCCAGG - Intronic
1101548676 12:105741146-105741168 GTCAGGCAGGAGAAGGTGGCAGG + Intergenic
1102027629 12:109722604-109722626 GACGGGCAGGAGAAGGGGCCAGG + Intronic
1102206917 12:111097140-111097162 CAGAGGCATGAGAAGGGAACAGG - Intronic
1102493245 12:113301848-113301870 CAGAGTCAGGCAGAGGTGCCAGG - Intronic
1102697206 12:114809215-114809237 AAGAGGCAAGAGAAGGGGTCAGG - Intergenic
1102761608 12:115390836-115390858 CACAGGCAGGAAAGTGTGCCTGG - Intergenic
1102984901 12:117270117-117270139 CAGAAGCAGGAGCTGGTGTCAGG + Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103598464 12:122038734-122038756 CACAGCCAGGGGAAGGTGCAGGG - Intronic
1104571968 12:129933667-129933689 CTGAGGCAGGAGAAGGTCAGGGG - Intergenic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1105477091 13:20737722-20737744 CAGCTGTAGGAGAAGGTGGCAGG - Exonic
1105705983 13:22967650-22967672 CAGAGACAGCAGGAGGTCCCAGG - Intergenic
1105858884 13:24392634-24392656 CAGAGACAGCAGGAGGTCCCAGG - Intergenic
1106232584 13:27832660-27832682 CAGGGGCTGGAGGAGGTGGCGGG + Intergenic
1106406560 13:29479888-29479910 CAGCGGCTGGAGAAGGAGCTGGG - Intronic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107749299 13:43547111-43547133 CAGAGGCAAGAGGATGGGCCAGG - Intronic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108207558 13:48106305-48106327 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1108571651 13:51757538-51757560 CAGAGGCGGGAAAAGGTGCAGGG - Intronic
1109973130 13:69796444-69796466 GAGAGACAGGAGCAGGTGTCAGG - Intronic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1111179976 13:84651568-84651590 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1111364143 13:87219232-87219254 CAGATGCAGGACCAGGTGCAGGG - Intergenic
1111991790 13:95123978-95124000 GAGAGGCAGGAAAGGGTGACGGG + Intronic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1112768827 13:102773905-102773927 CGGAGCTAGGGGAAGGTGCCAGG + Intergenic
1113314268 13:109161988-109162010 CTGAGGCAGGAGAATCTCCCAGG + Intronic
1113516665 13:110908079-110908101 AAGAGCCAGGTGAAGGTGCCCGG + Intronic
1113761844 13:112853602-112853624 CAGACGCTGCAGAAGGTGTCGGG - Intronic
1113762878 13:112862372-112862394 CAGAGCCTGGGGGAGGTGCCGGG + Intronic
1113786303 13:113003676-113003698 CAGAGCCTGGAGCAGGTCCCGGG - Intronic
1113820450 13:113209275-113209297 CCGAGCCAGGAGGGGGTGCCCGG + Intronic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1113984934 13:114306497-114306519 CTGAGGCAGGAGAATGAACCTGG + Intergenic
1114174585 14:20309261-20309283 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1114467219 14:22931539-22931561 CTGAGGCAGGAGAATGACCCAGG + Intergenic
1114597363 14:23925112-23925134 CAGAGGCAGCAGGAGGTGCTGGG - Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1115486535 14:33916090-33916112 CAGAGGCAGGAAAGGGTGCGGGG - Intergenic
1115500767 14:34047547-34047569 GAGAGAGAGGAGAAGGTGCCAGG + Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115857419 14:37645669-37645691 CAGAGGGAGGAGATAGTGCAAGG + Intronic
1115903650 14:38183185-38183207 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116485799 14:45446556-45446578 CAGAGACTGGGGAAGGTGCATGG - Intergenic
1116811943 14:49547656-49547678 CTGAGGCAGGAGAATGGCCCGGG + Intergenic
1117066915 14:52020100-52020122 CAACGGCAGGAGAAGGAACCAGG + Exonic
1117318742 14:54600221-54600243 CATGCTCAGGAGAAGGTGCCTGG - Intronic
1117763837 14:59059696-59059718 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1118084966 14:62404181-62404203 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1118181901 14:63502253-63502275 TAGAGGCAGGAGGTGCTGCCCGG + Intronic
1118235936 14:64005033-64005055 CAGAGGCAGCAGTAGGTACAAGG + Intronic
1118493320 14:66283177-66283199 CAGAGGCAGGAGAATTGGCCAGG - Intergenic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1118862490 14:69675391-69675413 CAGGGCCAGGAGGAGGTGCTGGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119655429 14:76413886-76413908 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1119655436 14:76413904-76413926 CAGGGGCGGGAGACGGTGCAGGG - Intronic
1119655480 14:76414028-76414050 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1119655513 14:76414116-76414138 CAGGGGCGGGAGACGGTGCAGGG - Intronic
1119655519 14:76414134-76414156 CAGGGGCGGGAGACGGTGCAGGG - Intronic
1119920241 14:78439958-78439980 AAAAGGAAGGAGCAGGTGCCAGG - Intronic
1120037896 14:79718646-79718668 CAGAGACAGGACAAGATGCAGGG - Intronic
1120055611 14:79920393-79920415 GAGATGCAGCAGAAGGTGTCGGG + Intergenic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121114693 14:91335443-91335465 CAGAGGCAGGAGCAAAGGCCTGG - Intronic
1121115361 14:91339248-91339270 CAAAGGTAGGAGAAGCAGCCGGG + Intronic
1121232670 14:92369125-92369147 AAGAGGCAGGAAGAGCTGCCTGG - Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121688490 14:95857349-95857371 TGGAGGCAGCAGAAGGGGCCTGG - Intergenic
1121696100 14:95913633-95913655 TAGAGGCTGCAGAAAGTGCCAGG + Intergenic
1121759904 14:96436068-96436090 CAGAGGCAGGGCAAGATGGCGGG - Intronic
1122037595 14:98960191-98960213 CAAAGGCAGGCAAAGGAGCCTGG + Intergenic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122432347 14:101661843-101661865 GAGAGAGAGGAGAAAGTGCCAGG - Intergenic
1122498454 14:102176825-102176847 CTGAGGCAGGAGAATGAACCCGG - Intronic
1122557597 14:102590103-102590125 CAGAGGCAGGAGAGGGTTTGGGG + Intergenic
1122580590 14:102769216-102769238 CAGAGGGAACAGCAGGTGCCAGG + Intergenic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122767271 14:104081230-104081252 GAGGGGCAGGAGGAAGTGCCTGG - Intergenic
1124156771 15:27233027-27233049 CAGGGACAAGAGGAGGTGCCTGG - Intronic
1124716840 15:32071664-32071686 GAGAGAGAGGAGGAGGTGCCAGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126959752 15:53978370-53978392 CGGCGGCAGGAGAGGGAGCCCGG + Intergenic
1128109089 15:65065181-65065203 CACAGGCAGCAGAAGGTACGGGG + Intronic
1128217486 15:65944516-65944538 GAGAGGCAGCAGCAGGAGCCTGG + Intronic
1128610715 15:69070993-69071015 GAGAGGGAGGAAGAGGTGCCAGG + Intergenic
1128726232 15:69990600-69990622 CACAGGCAGTAGAAGGCACCTGG - Intergenic
1128732482 15:70030656-70030678 CAGAGGGAGAAGGAGGTGGCTGG - Intergenic
1128750595 15:70146271-70146293 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129953017 15:79608596-79608618 GAGAGGTAGGAGGTGGTGCCTGG - Intergenic
1130024119 15:80256447-80256469 CAGAGGCAGCAGGAGGTGCATGG - Intergenic
1130051502 15:80487425-80487447 CTGATGCAGGAGAGGGTGCAGGG + Intronic
1130095713 15:80854322-80854344 TATAGCCAGGAGAAGTTGCCAGG - Intronic
1130137938 15:81197288-81197310 CAGGGGCAGGAGCAGAAGCCAGG + Intronic
1130371253 15:83286284-83286306 AAGAGGCAGAAAAAAGTGCCTGG - Intergenic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130522241 15:84672239-84672261 CAGAGGCAGGGGCAGGGGCATGG - Intronic
1130747203 15:86668036-86668058 GAGAGAGAGGAGCAGGTGCCAGG + Intronic
1131228781 15:90645897-90645919 TGGTGGCAGGAGAAGGGGCCTGG - Intergenic
1131373871 15:91907616-91907638 CTGAGGCAGGAGAATCTGCCTGG - Intronic
1131557654 15:93413722-93413744 CAGAGAAAGGAGAAGCTGCTGGG - Intergenic
1132121486 15:99179733-99179755 CAGAAGCAGGTGGAGGGGCCTGG + Intronic
1132364998 15:101251099-101251121 CGGACGCAGGAGGCGGTGCCCGG + Intronic
1132755729 16:1484077-1484099 CAGAGGCTGGGGAGGGTGCGGGG + Intergenic
1132761617 16:1511217-1511239 CAGGGGCAGCAGCACGTGCCTGG - Intronic
1132806146 16:1776034-1776056 CAAAGGCATGAGAGGGCGCCTGG - Intronic
1133002526 16:2858405-2858427 CAGGGGCAGAGAAAGGTGCCAGG + Intergenic
1133692790 16:8232738-8232760 CAGAGGCAGAGGAAGGTGGGTGG - Intergenic
1133740354 16:8646644-8646666 AAGAGGCAGGAGCTGGCGCCAGG + Exonic
1133968971 16:10553485-10553507 CATGCCCAGGAGAAGGTGCCGGG - Intronic
1134302151 16:13001313-13001335 GAGAGGGAGGAGCAGGTCCCCGG - Intronic
1134489956 16:14689111-14689133 CAGAGGCAGGGGCTTGTGCCTGG - Intronic
1134495337 16:14728228-14728250 CAGAGGCAGGGGCTTGTGCCTGG - Intronic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135033558 16:19058054-19058076 CAGGTGTAGTAGAAGGTGCCTGG - Intronic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135985059 16:27178020-27178042 CCGAGGCAGGAGAATGAACCCGG + Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136246013 16:28976289-28976311 TAAAGGCAGGAGAGGGTGTCTGG + Intronic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136580861 16:31150009-31150031 AAGGGGGAGGAGCAGGTGCCGGG + Exonic
1137283344 16:46996473-46996495 CAGAGGCAGGAGGCGGGGCTTGG + Intergenic
1137498831 16:48994887-48994909 CAAGGGCAGGAGACGGTGCTAGG - Intergenic
1137582771 16:49644097-49644119 GAGATGCTGGAGAAGGTGCTCGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1138247487 16:55478662-55478684 CAGAGACAGTGGAAGGTCCCAGG - Intronic
1138530487 16:57631798-57631820 CAGAGACAGGAGGAGGGGCAGGG - Intronic
1138535810 16:57659741-57659763 GAGAGGCAGAACCAGGTGCCTGG - Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138856214 16:60696708-60696730 CAGAGGAAGAAGAAGATGACTGG - Intergenic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139268361 16:65660243-65660265 CAGAGGCAGCAGCTGGTACCAGG - Intergenic
1139306085 16:65987473-65987495 AAGAGGCAGGAGTAGTTACCAGG + Intergenic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140035406 16:71367842-71367864 CACAGGCAGCAGGAGGTTCCCGG - Intronic
1140125130 16:72112259-72112281 CAGAGGAGTGAGAATGTGCCGGG + Intronic
1140229500 16:73105938-73105960 CAGAGGTAGGAGATGGGGCGGGG - Intergenic
1141103203 16:81212873-81212895 CCGAGGCAGGAGAAAGTTCTGGG + Intergenic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141236546 16:82222977-82222999 CAGAAGCAGAAGCTGGTGCCAGG + Intergenic
1141480015 16:84300218-84300240 CACAGTCAGGCCAAGGTGCCGGG + Intronic
1141586474 16:85036961-85036983 TAGAGGCAGGAGAAAGTTTCTGG - Intronic
1141671585 16:85494895-85494917 CAGAGGCAGGGGACAGGGCCCGG - Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1142158836 16:88546924-88546946 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142158843 16:88546948-88546970 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142158859 16:88546996-88547018 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142158875 16:88547044-88547066 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142158882 16:88547068-88547090 CAGAGGGTGGAGAAGGTGAGGGG + Intergenic
1142159004 16:88547400-88547422 CAGAGGGTGGGGAAGGTGACCGG + Intergenic
1142159014 16:88547424-88547446 CAGAGGGTGGGGAAGGTGCGGGG + Intergenic
1142159023 16:88547448-88547470 CAGAGGGTGGGGAAGGTGCGGGG + Intergenic
1142159039 16:88547496-88547518 CAGAGGGTGGGGAAGGTGCGGGG + Intergenic
1142159046 16:88547520-88547542 CAGAGGGTGGGGAAGGTGACTGG + Intergenic
1142159054 16:88547544-88547566 CAGAGGGTGGGGAAGGTGACGGG + Intergenic
1142159070 16:88547592-88547614 CAGAGGGTGGGGAAGGTGACCGG + Intergenic
1142215354 16:88827064-88827086 CAGAGGCAGAGAAGGGTGCCAGG - Intronic
1142215897 16:88829668-88829690 CAGAGGTGGGAGCAGGCGCCTGG - Intronic
1143490634 17:7283542-7283564 CAGAGGGTGGTGAGGGTGCCTGG - Exonic
1143582051 17:7833375-7833397 CAGGGGCAGGAGTACATGCCTGG - Exonic
1143593453 17:7899810-7899832 CACAGTCAGGACAAGGTGTCTGG + Intronic
1143593998 17:7903246-7903268 CAGGGGCAAGAGAAAGTGGCGGG - Intronic
1143981593 17:10874712-10874734 GAGGTGCAGAAGAAGGTGCCTGG - Intergenic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1144506540 17:15836234-15836256 CAGAGGCAGGAGACGGGGCTGGG - Intergenic
1144568824 17:16382104-16382126 CAGACGCAGGACCAGGTGCAGGG - Exonic
1144568860 17:16382332-16382354 CAGACGCAGGACCAGGTGCAGGG - Exonic
1145170714 17:20654166-20654188 CAGAGGCAGGAGACGGGGCTGGG - Intergenic
1145173977 17:20684500-20684522 CTGAGGCAGGAGAATCTGGCAGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145360088 17:22204744-22204766 CAGACGCAGGACCAGGTGCAGGG - Intronic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1146389720 17:32410794-32410816 TATAGGCACGAGAACGTGCCCGG - Intergenic
1147119941 17:38330013-38330035 CAGAGGCAGGAGGATGACCCAGG - Exonic
1147248495 17:39138311-39138333 CAAGGGCAGGAGAGGGGGCCAGG + Intronic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147829835 17:43291659-43291681 CAGAGGCAGGGGTGGCTGCCGGG + Intergenic
1147899551 17:43775056-43775078 ATGAGGCAGGAGAAGCTGGCAGG - Intronic
1148085370 17:44990613-44990635 CAGAGCCAAGATAAGGTGCTGGG - Intergenic
1148208621 17:45794859-45794881 CAGAGGCAGGAGGCAGAGCCGGG - Intronic
1148352378 17:46950336-46950358 CAGAGGCAAGTGAAAGGGCCAGG + Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1149542231 17:57476318-57476340 CAGGCTCAGGGGAAGGTGCCAGG - Intronic
1149648103 17:58255007-58255029 CAGAGCCAGGAGTGGGAGCCAGG - Intronic
1149648185 17:58255607-58255629 CAGAGCCAGGAGTGGGAGCCAGG + Intronic
1150270167 17:63858976-63858998 CAGAGGCAAGAGCAGCTTCCGGG - Intergenic
1151077937 17:71295900-71295922 GAGAGAGAGGAGGAGGTGCCTGG + Intergenic
1151161832 17:72172491-72172513 CAGAGACAGGAGCTGGTGCCTGG - Intergenic
1151250528 17:72830582-72830604 TAGAGACAGGGGATGGTGCCTGG - Intronic
1151363337 17:73601641-73601663 CAGAGCTAGGAGACGGTCCCGGG + Intronic
1151480200 17:74366052-74366074 CAGATGCAAGGGAGGGTGCCAGG - Intergenic
1151480836 17:74369331-74369353 CACAGGCAGGGGAAGGGGTCGGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151659687 17:75512251-75512273 CTGAGGCAGGAGGAGTTCCCTGG - Intronic
1151671135 17:75572230-75572252 CTGAGGCAGGACAGGGGGCCAGG + Intronic
1151980021 17:77503164-77503186 CAGAGGCAGGAGAAGCGGCGGGG - Intergenic
1152068738 17:78124993-78125015 CAGAGGCAGCCATAGGTGCCTGG + Intronic
1152161836 17:78673664-78673686 CAGAAGCAGGGGAAGGCGCTTGG - Intergenic
1152305875 17:79519890-79519912 CAGAGGCAGGGCAGGGTCCCGGG - Intergenic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1152524368 17:80879216-80879238 CAGAGGACGGAGATGATGCCAGG - Intronic
1152623331 17:81377101-81377123 CTGAGGAAGGCGAAGCTGCCAGG + Intergenic
1152657644 17:81527407-81527429 CTGAGGCAGGTGCAGGAGCCAGG + Intergenic
1152703815 17:81832959-81832981 CCCAGGCAGGGGCAGGTGCCGGG - Intronic
1152776650 17:82206090-82206112 GAGCGGCAGGAGAAGCCGCCGGG + Intronic
1152892444 17:82890292-82890314 CAGAGGCCGGAGAGGGGACCGGG + Intronic
1152950909 17:83230394-83230416 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1153841580 18:9012822-9012844 GACAGAGAGGAGAAGGTGCCAGG + Intergenic
1154412881 18:14150816-14150838 CAGGGGCCAGAGCAGGTGCCTGG + Intergenic
1155185502 18:23383529-23383551 CAGGAGCAGCAGAAGGTGACAGG + Intronic
1155558335 18:27047094-27047116 CAGAGGCAGGACAAGGACTCAGG - Intronic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1157320856 18:46632757-46632779 CACAGGCCCCAGAAGGTGCCAGG + Intronic
1157392438 18:47314018-47314040 CAGAGGCTGGAGAAGAGGCCAGG - Intergenic
1157556855 18:48618540-48618562 CAGAGGAAGGGGAGGGTCCCTGG + Intronic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1157697954 18:49738672-49738694 CAAAAGCAGGAGAAGCTTCCTGG + Intergenic
1158392617 18:57055961-57055983 AGGAGTCAGGAGAAGGTGCTGGG + Intergenic
1158403476 18:57141214-57141236 GAGAGACAGCAGGAGGTGCCAGG - Intergenic
1158571239 18:58598452-58598474 CAGGGGCAGGAGAGGCTCCCAGG + Intronic
1158918379 18:62160604-62160626 CTGAGGCAGGAGAACCTGCGAGG - Intronic
1159355491 18:67334161-67334183 CAGAAGAAGAAGAAGATGCCAGG + Intergenic
1160213697 18:76907311-76907333 CAGAGGCAGAAGAGGGGACCAGG + Intronic
1160498824 18:79392331-79392353 CAGAGGGAGGAGAGGGGACCGGG + Intergenic
1160619414 18:80160327-80160349 CACGGGCTGGAGAAGGTGCCCGG - Exonic
1160625740 18:80203685-80203707 CAGAGGCAGGAGAGGACGCAAGG + Intronic
1160770165 19:827608-827630 CAGGGGCAGGTGAGGGTGTCAGG - Intronic
1160949417 19:1658365-1658387 CAGGTGCAGGTGAAGGAGCCTGG - Intergenic
1160971523 19:1769873-1769895 CAGAGGCTGGGGGAGGGGCCGGG - Intronic
1161004749 19:1929601-1929623 CTGAGGCAGGAGAATCTGCCGGG + Intergenic
1161353825 19:3808417-3808439 CAGAGGGAAGAGAACGCGCCAGG - Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162738730 19:12761624-12761646 CTGAGGCAGGAGAATGAACCCGG - Intergenic
1162782043 19:13011534-13011556 CAGAGGCAGGGGGGTGTGCCGGG + Intronic
1162827834 19:13264588-13264610 CAGAGGCAAAAGAATGTGGCTGG - Intronic
1163696980 19:18768990-18769012 CTGAGGCACGAGCAGGTGGCTGG + Intronic
1163764193 19:19153328-19153350 CAGAAGGAAGAGCAGGTGCCAGG + Intronic
1164054892 19:21614388-21614410 CTGAGGCAGGAGAATCAGCCAGG - Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164449522 19:28348428-28348450 CAGAGGCAGGAGAACCTGGGAGG + Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164597086 19:29537422-29537444 TGCAGGCAGGAGAAGGGGCCTGG - Intronic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164685580 19:30164449-30164471 AAGAGAGAGGAGGAGGTGCCTGG - Intergenic
1164853048 19:31500552-31500574 CAGAAGCAGTGGAAAGTGCCTGG + Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1165336769 19:35176003-35176025 CAGAGAGAGGGGGAGGTGCCAGG - Intergenic
1165442110 19:35834790-35834812 CTGAGGCAGGAGAGGAAGCCGGG + Intronic
1165462829 19:35954125-35954147 CAGAGGCAGGAGAGGGCACCAGG - Intergenic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166110150 19:40617159-40617181 CAGAGGCACTGGAAGGAGCCGGG - Exonic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166657676 19:44624013-44624035 CACAGGCTGGAGAGGGTGCAGGG - Intronic
1166718889 19:44986406-44986428 CAGAGGCAGGTGGAAGTGCTCGG - Intronic
1166737577 19:45095229-45095251 CTGAGGCAGGAGAATTGGCCTGG - Intronic
1166783721 19:45355435-45355457 CAGAGGCAGCATAATGTGACAGG - Intronic
1167154559 19:47730192-47730214 AGGAAGCAGGGGAAGGTGCCAGG - Intronic
1167281023 19:48568617-48568639 CAGAGGCAGGGCAGGGCGCCGGG + Intronic
1167353726 19:48991438-48991460 CAGACGAAGGCGAAGGTGACAGG - Exonic
1168253549 19:55154933-55154955 CTGAGGGAGGAGAAGGGGCTGGG + Intronic
925422348 2:3723296-3723318 CAGAGGCAGGATGAAGTGCTTGG + Intronic
925596875 2:5563951-5563973 TATTGGCAGGAGAAGGTGCCAGG + Intergenic
925869249 2:8254914-8254936 CAGAGCCAGGAGAAAGTGAGGGG - Intergenic
925914980 2:8598303-8598325 CAGAGGCAGGAGAGGAAGCTGGG + Intergenic
926166775 2:10526032-10526054 CAGTGGCAGGCCATGGTGCCCGG - Intergenic
926396686 2:12450049-12450071 AAGATGCAGGAGAAGGTAACTGG - Intergenic
926561411 2:14421322-14421344 GAGAGGCTGGAGCAGGTGGCAGG + Intergenic
927191861 2:20522497-20522519 CTAAGGCAGGAGGAGGTGCAGGG - Intergenic
927553161 2:24016307-24016329 CAGGGCCAGGACCAGGTGCCTGG - Intronic
928259831 2:29756623-29756645 CTGAGGCAGGAGAATCTGCCGGG - Intronic
928676315 2:33655007-33655029 CGCAGGGAGGAGAAGGTGCCTGG - Intergenic
928727417 2:34191257-34191279 CAGAGGCAGGAGATTGTCCATGG - Intergenic
929003222 2:37368324-37368346 CAGAGTCAGGAGAAGATGCAGGG - Intronic
929570002 2:43016715-43016737 GAGAGAAGGGAGAAGGTGCCAGG - Intergenic
929589302 2:43134692-43134714 CAGGGGCAGGGGAAGGAGCGGGG - Intergenic
929892228 2:45927920-45927942 CGGAGGCAGGAGAGGGTGGGGGG + Intronic
930039396 2:47108574-47108596 CAGAGGCATGAAAATGTGTCCGG - Intronic
930293730 2:49528404-49528426 CACTGACAGGAAAAGGTGCCAGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931932146 2:67150543-67150565 CTGAGGCAGGAGAATGAACCTGG + Intergenic
932087079 2:68771982-68772004 CAAAGGCAGGAGTAAGTGCGAGG - Intronic
932225301 2:70034900-70034922 CACAGGCAGGACCAGGTGACAGG + Intergenic
933730481 2:85452457-85452479 CAGTGGCAGGAAATGGAGCCAGG - Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
933973513 2:87489458-87489480 CAGAGGCAGGAGCTGGGGCTGGG + Intergenic
934523242 2:95032985-95033007 CAGCGGGAAGAGAAGGTGCAGGG + Intronic
934724515 2:96606972-96606994 AAGAGACAGGAGGAGGTGCCAGG + Intronic
934873000 2:97885288-97885310 CTGAGGCAGGAGAATGGACCGGG - Intronic
935187604 2:100748143-100748165 CAGGGGGAGGAGAGGGTGCTGGG + Intergenic
935234386 2:101126175-101126197 GAGAGAGAGGAGATGGTGCCAGG + Intronic
935264776 2:101384889-101384911 AAGAGAGAGGGGAAGGTGCCAGG - Intronic
935402350 2:102673884-102673906 CTGAGGCAGGAGAATGGGCATGG - Intronic
935914168 2:107931332-107931354 CTGAGGCAGGAGAAAATGGCAGG - Intergenic
936320212 2:111460755-111460777 CAGAGGCAGGAGCTGGGGCTGGG - Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936816277 2:116464679-116464701 AAGTGGGAGGAGGAGGTGCCAGG + Intergenic
936952084 2:117987869-117987891 CAGATACAGCAGAATGTGCCTGG - Intronic
937037872 2:118796789-118796811 CTGAGCCAGGAGTGGGTGCCTGG - Intergenic
937235886 2:120431791-120431813 CAGAGACGGGACAAGGAGCCTGG - Intergenic
938128859 2:128693815-128693837 CAGAGTCGGAGGAAGGTGCCAGG + Intergenic
938376166 2:130808194-130808216 GAGAGCCAGGAGGAGGTGGCAGG + Intergenic
938899432 2:135787405-135787427 CAGACGAAGGAGAATCTGCCTGG + Intergenic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
939888508 2:147707684-147707706 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940939736 2:159545187-159545209 GAGAGGCAGGAGAAGGGACTGGG - Intronic
941524639 2:166592149-166592171 CAGAGGCTGAATAAGGTACCTGG - Intergenic
941694944 2:168541095-168541117 GAGAGGCAGGGAGAGGTGCCAGG + Intronic
942529758 2:176897043-176897065 CAAAGGCAAAAGAAAGTGCCTGG - Intergenic
942802646 2:179893172-179893194 CAGAAGAAGCAGAAGCTGCCAGG + Intergenic
942871167 2:180736097-180736119 GAGAGAGAGGAGAGGGTGCCAGG - Intergenic
943668759 2:190638228-190638250 CAGAGGCAGGAAAAGATGTAAGG - Intergenic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
945041354 2:205746014-205746036 CTGAGGCAGGAGAACATGGCAGG - Intronic
945617753 2:212094589-212094611 GAGAGGCAGGCGGAGGTGCCAGG - Intronic
946329277 2:219000605-219000627 CAGGGGCAGGGGAAGGTCCTTGG - Intergenic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
946415527 2:219538098-219538120 CAGGAGCAGGAGAATGTGCTGGG - Exonic
947183205 2:227431201-227431223 GAGAGAGAGGAGAAGGTTCCAGG + Intergenic
947715352 2:232336361-232336383 CAGAGGCCGAAGGAGGGGCCAGG + Intronic
947795721 2:232892852-232892874 CAGGGGCAGGGGGAGGTGCCCGG - Intronic
947926124 2:233924135-233924157 CAGTGTCAGGAGAAGGTCCCTGG - Intronic
948035031 2:234851587-234851609 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
948293223 2:236842763-236842785 GGGAGGCAGGAGAAGAAGCCAGG - Intergenic
948330419 2:237160367-237160389 CAGAGGCCTTACAAGGTGCCGGG + Intergenic
948402287 2:237692598-237692620 CAATGGCAGGCGCAGGTGCCCGG + Intronic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
949045614 2:241871510-241871532 CACAGGCAGGAGCAGGTGCTAGG + Intronic
1168773860 20:432741-432763 CAGGGGCAGGGGAAGGTGAGTGG + Intergenic
1169009386 20:2237635-2237657 CAGAGGCAGAAGACAGTGTCAGG - Intergenic
1169117488 20:3075149-3075171 CAGTGGCTGGAAAAGGTGTCAGG + Intergenic
1169138054 20:3209603-3209625 AAGAAGCTGGAGGAGGTGCCGGG + Exonic
1169267241 20:4174214-4174236 CAGAGACAAGAGAAGGGGCAAGG + Intronic
1170006039 20:11670221-11670243 CAGAGGGAGTAGAAGGTGCTAGG - Intergenic
1170702194 20:18713529-18713551 CAGAGACTGGAGCAGGTCCCTGG + Intronic
1170843516 20:19943115-19943137 AACAGGCAGAAGAAGGAGCCAGG - Intronic
1170995482 20:21352425-21352447 CTGAGGCAGGAGAAATTGCTTGG - Intronic
1171470231 20:25364453-25364475 CAGAGGGGAGGGAAGGTGCCAGG + Intronic
1172299070 20:33835851-33835873 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1172379431 20:34475691-34475713 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1172506654 20:35467621-35467643 GACAGGCAGGGGGAGGTGCCAGG + Intronic
1172631002 20:36378096-36378118 CAGAGGCAGCAGGAGTTGCAAGG + Intronic
1172766619 20:37354583-37354605 CAGGGGCAGGGGCAGGGGCCGGG + Intronic
1172800494 20:37573036-37573058 CAGAGGCAGGGGAAGCTGTCAGG + Intergenic
1172849113 20:37947811-37947833 CAAAAGAAGAAGAAGGTGCCTGG + Intergenic
1172977614 20:38918625-38918647 GAGATGGAGGAGAAGGTGCATGG + Exonic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173191203 20:40876802-40876824 TGGAGGCAGGAGAAGGTGACAGG + Intergenic
1173311282 20:41898227-41898249 CAGAGCCAGGAGAAGGGCCTTGG - Intergenic
1173492314 20:43493019-43493041 CAGAGGCAGCAGAAGAGGGCAGG + Intergenic
1173501857 20:43559675-43559697 CAGCAGCAGGAGAGGGTGCATGG + Intronic
1173646211 20:44634687-44634709 CTGGGGCAGAAGAAGGTCCCTGG + Intronic
1174183037 20:48686960-48686982 GGGAGGCAGGAGCAGGTCCCTGG - Intronic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174468756 20:50739346-50739368 CTGAGGCAGGAGAATCAGCCAGG + Intronic
1174854294 20:54028489-54028511 AAGGGACAGGAAAAGGTGCCAGG - Exonic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175218676 20:57404827-57404849 CAGAGGCATTGGCAGGTGCCAGG + Intronic
1175219357 20:57408127-57408149 GAGAGGCAGGAGAAGGTGCAAGG - Exonic
1175293410 20:57893212-57893234 CAGAGGCAAGACAAGGAACCAGG - Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175466010 20:59191703-59191725 CAGGGGCGAGAGCAGGTGCCAGG + Exonic
1175515512 20:59567438-59567460 CACAGCCAGGAGAGGGTGCCCGG - Intergenic
1175816069 20:61883833-61883855 CAGAGGGAAGAGGAGCTGCCAGG - Intronic
1176177548 20:63735800-63735822 CAGCTGCAGGAGAAGCTGGCAGG + Exonic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176555509 21:8252654-8252676 CAGGGGGAGGAGACGGTTCCGGG + Intergenic
1176860128 21:14007438-14007460 CAGGGGCCAGAGCAGGTGCCTGG - Intergenic
1176985565 21:15431863-15431885 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1177368276 21:20167711-20167733 GAGAAGCAGGGGAAGGTGCCAGG + Intergenic
1177583135 21:23053781-23053803 CAGAGGTTGGAAAAGGTGGCAGG - Intergenic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1178804010 21:35823693-35823715 CTGAGGCTGGAGACGGTGGCGGG - Intronic
1179220280 21:39400675-39400697 CAGAGACAGGATGAGCTGCCTGG - Intronic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179354174 21:40643020-40643042 CAGAGACTGCAGCAGGTGCCAGG - Intronic
1179420516 21:41232632-41232654 GAGAGAGAGGAGGAGGTGCCTGG - Intronic
1179510952 21:41873169-41873191 CACATGCAGGAGAAGGAACCAGG - Intronic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1180042329 21:45287193-45287215 CAGGGGCAGGGGCAGGGGCCGGG - Intronic
1180248199 21:46562440-46562462 CAGAGGCAAGGGAAGGAGCTTGG + Intronic
1180606331 22:17061689-17061711 CCCAGGCAGGAGCAGGTGCTGGG - Intergenic
1180711436 22:17842154-17842176 CAGAGGCCAGAGAAGGACCCTGG + Intronic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181719623 22:24763813-24763835 CCGAGGCAGGAGATGGTGGGCGG - Intronic
1182050910 22:27311860-27311882 AAGAGGCAGGAAAAGGCACCTGG + Intergenic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182256233 22:29040579-29040601 CAGAGGCAGGAATAGCTCCCAGG + Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182384088 22:29921252-29921274 AAGAGAGAGGAGAAGGTGCTAGG + Intronic
1182511746 22:30824929-30824951 CAGAGTCAGGACAAGAAGCCAGG - Intronic
1182551754 22:31104515-31104537 CACAGGCAGGAGACGGTGCCCGG - Exonic
1182796243 22:32993685-32993707 CAGAGGGTGTAGATGGTGCCTGG + Intronic
1182803160 22:33048574-33048596 CAGAGAGAGGAGTACGTGCCAGG - Intronic
1183167798 22:36160758-36160780 CAGAGCCTGGAGAACGTGTCTGG - Exonic
1183302034 22:37063218-37063240 GAGAGGCAGCAGAAGGGGCTGGG + Exonic
1183446431 22:37859032-37859054 CAGAAGCAGCAGCAGGTACCTGG - Intronic
1183469939 22:37999799-37999821 CAGAGGTAAGAGAAGGTAACAGG + Intronic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1183648569 22:39140799-39140821 CAGAGGTGGGAGACTGTGCCTGG + Intronic
1184128380 22:42502833-42502855 AGGAGGAAGGAGAAGGTACCTGG + Intergenic
1184137172 22:42556148-42556170 AGGAGGAAGGAGAAGGTACCTGG + Intronic
1184159287 22:42688395-42688417 CAGGGGCAGGACAAAGTGCAAGG - Intergenic
1184305577 22:43599033-43599055 CAAATGTAGGAGCAGGTGCCTGG - Intronic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
1184457337 22:44618597-44618619 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1184552476 22:45211923-45211945 CAGACGCAGGGGCAGGGGCCGGG + Intronic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184699654 22:46162074-46162096 CAAAGGCAGGACAAGGTGTAGGG + Intronic
1184769814 22:46590389-46590411 CAGAGAGCTGAGAAGGTGCCGGG + Intronic
1184935815 22:47719567-47719589 CACAGGCAGGATGAGGTGCTGGG - Intergenic
1185045136 22:48524950-48524972 AAGAGGCAGGAGAAAGGGCCAGG - Intronic
1185150268 22:49160324-49160346 CAGAGGCTGCACCAGGTGCCAGG + Intergenic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
1185281072 22:49970136-49970158 CTGAGGCAGGCGGAGGGGCCAGG + Intergenic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
949462889 3:4312991-4313013 CGGAGACAGGAGCAAGTGCCAGG - Exonic
950544131 3:13628879-13628901 CAGAGGCAGGTGTAGGTGACAGG - Intronic
950665940 3:14494997-14495019 CAGAAGGAGGAGGAGGTTCCTGG + Intronic
950674459 3:14546193-14546215 CAAAGGGAGGAGGAGGTTCCAGG + Intergenic
950798507 3:15530734-15530756 CAGACACAGGTGCAGGTGCCAGG + Intergenic
950929358 3:16773718-16773740 GAGAGGCAGGAGCAGGAACCGGG + Intergenic
951713324 3:25609567-25609589 AAGAGGGAGAAGAAGGAGCCTGG - Exonic
952878366 3:37967145-37967167 CCAAGGCAGGAGCTGGTGCCAGG + Intronic
953578237 3:44130101-44130123 CAGAGGCAAGAGGAGGTTCCAGG + Intergenic
953682506 3:45050537-45050559 AAGAGAGAGGAGGAGGTGCCAGG - Intergenic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954383028 3:50229660-50229682 CAGAGGCAGCAGCAAGTGCAAGG - Intronic
954583360 3:51715484-51715506 CCGAGGCAGGCGATGGTGACAGG - Exonic
954652700 3:52175120-52175142 GAGAGGCATGAGAGGGTGCTGGG - Intergenic
955040230 3:55309554-55309576 CAGAGGCAACAGCAAGTGCCAGG + Intergenic
955496860 3:59542517-59542539 CTGAGGCATGAGGAGGAGCCAGG + Intergenic
956191220 3:66610280-66610302 CAGGGGCAGGAGGATGTGCATGG + Intergenic
956482788 3:69689591-69689613 CAGAGATGGGAGAAGGTGACAGG + Intergenic
956552182 3:70473860-70473882 GCGAGAGAGGAGAAGGTGCCAGG - Intergenic
957285313 3:78210077-78210099 GAGAGACGGGAGAGGGTGCCAGG - Intergenic
957456713 3:80460462-80460484 GAGAGTCAGGGGCAGGTGCCAGG - Intergenic
957939677 3:86990185-86990207 CAGAGGTAGGGGAAGCTACCTGG - Intronic
958531276 3:95334081-95334103 GAGAGACGGGAGGAGGTGCCAGG - Intergenic
958983111 3:100748219-100748241 AAAAGGCAGGAGCTGGTGCCTGG - Exonic
959257204 3:104030879-104030901 AAGTGGCAGGGGAAGCTGCCTGG + Intergenic
959392240 3:105790728-105790750 CAAATGCAGAAGAACGTGCCAGG + Intronic
960955387 3:123027468-123027490 CAGAGGCGGGTGCAGGTGCCCGG + Intronic
960994168 3:123330194-123330216 CAGAGGCGGGAGTGGCTGCCAGG - Intronic
961644716 3:128386753-128386775 GAGAGTGAGGAGGAGGTGCCAGG + Intronic
961825559 3:129597402-129597424 CAGAGGCTGGAGAAGGGCACAGG + Intronic
962389033 3:134956436-134956458 CAGAGGCAAGAGAGGATGGCAGG - Intronic
962621313 3:137182486-137182508 GAGAGGGTGGAGGAGGTGCCAGG - Intergenic
962925543 3:139989595-139989617 CAGAGGCATGGGGAGGTTCCAGG - Intronic
963267082 3:143250289-143250311 CTGAGGCAGAAGAAGGTTGCAGG + Intergenic
963707003 3:148699478-148699500 GAGAGGAAGGAGAAGGTACCAGG - Intronic
963808925 3:149755720-149755742 TAGAGTCATGAGAAGGTGGCTGG - Intergenic
964360900 3:155895407-155895429 CTGAGGCAGGAGAATCTGCCAGG - Intronic
964405244 3:156342012-156342034 AGGAGGTAGGAGAAGCTGCCAGG - Intronic
964413501 3:156423812-156423834 CAGAGTCAGGAAAATGAGCCAGG + Intronic
965037829 3:163465510-163465532 CAGAGGCTGGAAATGGTGCTGGG - Intergenic
966675273 3:182579436-182579458 GAGAGAGGGGAGAAGGTGCCAGG + Intergenic
966838491 3:184068383-184068405 CAGAGGCAGAAGATGGCACCTGG + Intergenic
967178848 3:186885575-186885597 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
967472425 3:189878009-189878031 CAGAGTCAGAAAAACGTGCCAGG - Intronic
967941715 3:194771521-194771543 CATAGGCAGAAGAAGGTGAGTGG + Intergenic
967995507 3:195163422-195163444 CAAGGGCAGGAGCAGGTGTCAGG - Intronic
968289168 3:197525619-197525641 CAAAGGCAGGTGAGGGTTCCTGG - Intronic
968981364 4:3851543-3851565 GAGAGGAAGGAGAAGATGTCTGG + Intergenic
969527174 4:7709787-7709809 GAGAGGCAGGTGAAAGTGACTGG - Intronic
970170386 4:13283505-13283527 GAGAGGCCGGAGAAGGTGCCTGG + Intergenic
970678571 4:18481032-18481054 AAGAGCCAGGAGCAGGTGACAGG + Intergenic
971139316 4:23906512-23906534 CTGAGGCAGGAGAAGAACCCAGG + Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
973263221 4:48185954-48185976 CTGAGGCAGGAGAATCTGGCAGG - Intronic
973328974 4:48893180-48893202 CGGGGGCAGGGGAAGGTGGCTGG + Intronic
973567277 4:52201028-52201050 CTGAGGCAGGAGAACCTCCCGGG - Intergenic
973742074 4:53927690-53927712 CAGAGGCTGGAGAAGCAGCAGGG + Intronic
974065646 4:57074402-57074424 CAGAGGCAGGAGAAAATGGTGGG - Intronic
975778813 4:77819076-77819098 CAGAGGCGGGCGAAGGTTCCGGG - Intronic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976467599 4:85388379-85388401 CAGAGAATGGAGAAGGTGCTTGG + Intergenic
976842755 4:89451109-89451131 CAGAGGCAGCAGTTGGTGCAAGG + Intergenic
978746207 4:112197065-112197087 CTGAGGCAGGAGAACGGCCCCGG + Intergenic
980318272 4:131234389-131234411 TAGATGCAGGACAAGGTCCCGGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
981906362 4:149925700-149925722 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
982325770 4:154126999-154127021 GACAGGCAGGAGCAGGAGCCAGG + Intergenic
982495672 4:156088891-156088913 AAGAGAGAGGAGAAGGTGCCAGG - Intergenic
983210867 4:164956488-164956510 CATTGGCAGGAGAAGTTGCTGGG - Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983524265 4:168744465-168744487 CAGAGCCAAGACAAGGTGTCTGG + Intronic
983823725 4:172230486-172230508 CTGAGGCAGGAGAATGGCCCGGG + Intronic
984124245 4:175786556-175786578 GAATGGCAGGAGAAGGTGCTGGG - Intronic
984235516 4:177152847-177152869 AAGAGAGAGGAGCAGGTGCCAGG - Intergenic
985293229 4:188407299-188407321 CACAGGCAGGTGCAGGAGCCAGG - Intergenic
985747642 5:1656114-1656136 AGGAGGCAGGAGAAGGCGGCCGG + Intergenic
985790972 5:1926623-1926645 CAGGGGCAGGGGCAGGTGCAGGG - Intergenic
985887921 5:2694556-2694578 CAGAGGCAGGGGTAGGAGCAAGG + Intergenic
985999605 5:3620218-3620240 CAGAGGCTGGAGGGGGTGCTGGG - Intergenic
986284748 5:6351018-6351040 CATAGGCTGGGGAAGGTGCTGGG - Intergenic
986287481 5:6370586-6370608 CAGAGGGAGGCGAAGCTGCAGGG + Intergenic
986734918 5:10661532-10661554 CACAGGCTGGAGGAGGTGCGAGG - Intergenic
987038220 5:14038601-14038623 CAGAGGCAGGATGAGGACCCAGG + Intergenic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
987849365 5:23329600-23329622 CAGAGGTCAGAGAAGGTGACAGG - Intergenic
988170830 5:27653106-27653128 CAGGGGCAGGATAATGTGTCAGG + Intergenic
989034746 5:37158880-37158902 CTGAGGCAGGAGAATGAACCCGG - Intronic
989539914 5:42606504-42606526 AAGAAAGAGGAGAAGGTGCCAGG + Intronic
990434327 5:55772710-55772732 CAGAGGAAGTAGAGGGTACCAGG - Intronic
990513870 5:56514508-56514530 CAGAGACAGGGGAAGGTGCCAGG - Intronic
991298045 5:65102244-65102266 GAGAGGCAGGAAATGGTGCCTGG + Intergenic
991589196 5:68231324-68231346 CAGAGGCTGCAGGAGGAGCCAGG - Intronic
991601344 5:68354459-68354481 CAGAGGGATGTGAAGGTGGCGGG - Intergenic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994309595 5:98252933-98252955 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
996057580 5:118998588-118998610 CTGAGGCAGGAGAATCAGCCAGG - Intergenic
997111156 5:131076078-131076100 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
997410063 5:133684264-133684286 CAGAGGAAGGTGAGGGTGCAGGG - Intergenic
997535331 5:134616039-134616061 CTGAGACAGGAGAATGTGGCAGG + Intronic
997632180 5:135377192-135377214 CCTGGGAAGGAGAAGGTGCCTGG + Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998888039 5:146715177-146715199 CAGACCCAGGTGATGGTGCCAGG + Intronic
999250478 5:150179586-150179608 AAGAGGCAGGAGTGGGTGCTAGG + Intronic
999330377 5:150670026-150670048 CAAAGGGAGGAGAAGGTTCTGGG - Intronic
1000161140 5:158598745-158598767 TGGAGGCTGGAGATGGTGCCAGG - Intergenic
1000255139 5:159530356-159530378 CTGAGGTGGGAGAAGGCGCCTGG - Intergenic
1000334020 5:160228673-160228695 CACCTGGAGGAGAAGGTGCCAGG - Intronic
1000870918 5:166576245-166576267 TAGTGGCAACAGAAGGTGCCAGG + Intergenic
1001717553 5:173828998-173829020 GAGAGGCAGGAGAGGATGCTGGG - Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001786639 5:174419255-174419277 CAGAGGCAGGACCAGGGTCCTGG + Intergenic
1002191297 5:177479163-177479185 GTGGGGCAGGAGCAGGTGCCAGG - Intergenic
1002278513 5:178117973-178117995 CGGGGGCAGGAGTGGGTGCCCGG + Intronic
1002589627 5:180281162-180281184 CTGAGGCAGGAGCACGTGCTTGG - Intronic
1002745141 5:181464208-181464230 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1002758446 6:183321-183343 CAGAGGCAGGAGAACGGGCAAGG - Intergenic
1003567914 6:7236163-7236185 CAGGTGGAGGAGAGGGTGCCAGG + Intronic
1003844083 6:10154703-10154725 CTGAGGCAGGAGAAATTGCTTGG - Intronic
1004316625 6:14593737-14593759 CTGAGGCTGGAGAAGGTCCAGGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006192272 6:32216962-32216984 CAGAGGCAAAAGAAGGCTCCTGG + Exonic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1006848079 6:37077230-37077252 CAGAGGCAGGAGAATCTGGTGGG + Intergenic
1007027190 6:38588227-38588249 AAAAGGCAGGAGCTGGTGCCTGG - Intronic
1007316331 6:40992302-40992324 CGGAGGTAAGAGAAAGTGCCTGG - Intergenic
1007475658 6:42118260-42118282 TAGAGGCAGGAGTAGGTGGGAGG + Intronic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1007590343 6:43017138-43017160 CAGAGGCAGCAGGCCGTGCCGGG + Exonic
1008256096 6:49302531-49302553 AATAGGCAGGAGGAGGTGACTGG + Intergenic
1008763564 6:54883034-54883056 CTGAGGCAGGAGAAGCTCCCGGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010628388 6:78167353-78167375 CAGAGGCAAGAAATGGTCCCAGG - Intergenic
1011110009 6:83827440-83827462 CATAGGAAGGAGAAGCTGCCAGG + Intergenic
1011816666 6:91199370-91199392 CAAAGGCTGGAAATGGTGCCAGG - Intergenic
1012288821 6:97425508-97425530 CAAAGGGAAGAGCAGGTGCCAGG - Intergenic
1012986675 6:105883550-105883572 CAGATGCAGCTGAAGGTGCCGGG + Intergenic
1013552785 6:111225455-111225477 CTGAGGCAGGAGAAGAATCCAGG + Intronic
1013632774 6:112001250-112001272 CAGAGGCATGAGAAAGTGTGCGG + Intergenic
1013799982 6:113931584-113931606 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1015190308 6:130465015-130465037 GAGAGAAAGGAGAAGGTTCCAGG + Intergenic
1015489872 6:133812842-133812864 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1015978542 6:138815913-138815935 CAGATGCAGGAGTAGCTGACAGG - Intronic
1016406964 6:143741147-143741169 CTGAGGCAGGAGAATGAGTCAGG + Intronic
1016779667 6:147943897-147943919 GAGAGCCAGGAAAAGGGGCCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016897305 6:149066086-149066108 CAGAGAGAGGTGAGGGTGCCAGG + Intronic
1017034253 6:150252711-150252733 CAGAGAGGGGAGGAGGTGCCAGG - Intergenic
1017184022 6:151582755-151582777 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1017274557 6:152551079-152551101 TAGAGGAAGGAAAAGGTGTCAGG - Intronic
1017917815 6:158846208-158846230 CAGAGGCTGGAGACCGTGCCAGG + Intergenic
1018178447 6:161199515-161199537 CAGTGGCAGGCCAAGCTGCCTGG + Intronic
1018429675 6:163713324-163713346 CCCACGCAGGAGAGGGTGCCTGG + Intergenic
1018525924 6:164710032-164710054 CAAAGGCAGGAGAATGTGGAAGG - Intergenic
1018608569 6:165624232-165624254 CAGATGCTGGAGAGTGTGCCAGG - Intronic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018678319 6:166242098-166242120 GAGAGGCAGGTGGAGTTGCCTGG - Intergenic
1018964577 6:168474444-168474466 CAGACGCAGGAGCTGGAGCCTGG - Intronic
1019175867 6:170159287-170159309 CAGTGGCAGGTGAAGGGGCTGGG - Intergenic
1019250049 6:170737754-170737776 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1019493734 7:1326652-1326674 CAGAGGCAGCAGCAGGCTCCAGG - Intergenic
1019519853 7:1455655-1455677 CAGAGGCAGAACCAGGAGCCCGG + Intronic
1019542189 7:1556409-1556431 CATAGGCAGGTGAGGGCGCCAGG - Exonic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020012584 7:4814874-4814896 CTGAGGCTGGAGGAGGGGCCAGG - Intronic
1021440054 7:20667715-20667737 CAGAGGCAGGGGCAGGGGCAGGG - Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021744585 7:23725954-23725976 CAAAGGGAGGAAGAGGTGCCAGG + Intronic
1022800969 7:33776941-33776963 CAGATGAAGCAGATGGTGCCAGG + Intergenic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023745633 7:43320044-43320066 CAGATGCTGGGGAAGGTGCAGGG - Intronic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025626132 7:63224101-63224123 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1026043317 7:66886994-66887016 CGGAGAGAGGAGGAGGTGCCAGG + Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026450724 7:70526827-70526849 CAGAGGCTGGTGAGGGTGTCGGG - Intronic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1026941779 7:74291219-74291241 AAGAGGCAGGTGGAGGCGCCTGG + Intronic
1027131066 7:75591818-75591840 CATTGGCAGGAGAAGCTCCCAGG + Intronic
1028748842 7:94359252-94359274 CAGATGCTGGTGAAGGTGCAGGG + Intergenic
1028860820 7:95648402-95648424 CTGAGGCAGGAGAATCTCCCAGG - Intergenic
1029124147 7:98285681-98285703 GAAAGGCCTGAGAAGGTGCCCGG - Intronic
1029198838 7:98825445-98825467 GAGAGTGAGGAGGAGGTGCCAGG - Intergenic
1029569532 7:101360460-101360482 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1029859201 7:103551198-103551220 GAGGGGCAGCAGAAGGTGCCAGG + Exonic
1029981799 7:104885911-104885933 CAGAGGCAGGAGAAATAGCAGGG - Intronic
1030013804 7:105198262-105198284 CAGAGGCAGTAGGGGGTGCCTGG - Intronic
1030148291 7:106378342-106378364 CAGAGGCTGGGTATGGTGCCTGG + Intergenic
1032731999 7:134652628-134652650 CAGAGGCAGGGAAAGGTAACAGG - Intronic
1033282823 7:140017850-140017872 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033539107 7:142339373-142339395 TAGAAGCAGCAGAAAGTGCCTGG - Intergenic
1033750874 7:144360207-144360229 CTGAGGCAGGAGAGGGATCCTGG - Intronic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034337407 7:150332363-150332385 AAGAGGCAGGGGAAGGCTCCAGG + Exonic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034422112 7:150995759-150995781 CAGAGGGAGGAGGGGGTGCAGGG - Intronic
1034845781 7:154443141-154443163 CAGAGGGAGTGGCAGGTGCCTGG - Intronic
1034903077 7:154919928-154919950 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1035070790 7:156143749-156143771 CAGAGGCAGGAAGCAGTGCCAGG + Intergenic
1035265581 7:157688946-157688968 CAGAGCCAGGAGAGGGGTCCCGG + Intronic
1035300933 7:157896802-157896824 AAGAGGCAGGACATGGTGACAGG - Intronic
1035357491 7:158285287-158285309 TAGGGACAGGAGAAGGTGCCAGG + Intronic
1035403978 7:158586937-158586959 TAGAGGCAGGAGGCGGCGCCGGG + Intronic
1035420257 7:158723906-158723928 CAGGGGCACAAGAGGGTGCCTGG + Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036453955 8:8892517-8892539 GAGAGGCAGGAGAGGGAGTCAGG + Exonic
1037570529 8:20154083-20154105 CAGAGGCAGATGCTGGTGCCAGG + Intronic
1037601073 8:20394618-20394640 CAGAGGCATGAGAAGATCCATGG - Intergenic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1038450860 8:27637907-27637929 CAGGGGCACGGGAAGGAGCCAGG + Intronic
1038452536 8:27649218-27649240 CAGAGGGAGGAGGAGATGACAGG - Intronic
1039808509 8:41024065-41024087 GAGCAGCAGGAGGAGGTGCCAGG - Intergenic
1039964549 8:42274464-42274486 CAGAGGCAGGAAAGGGTGGTGGG - Intronic
1040478511 8:47802574-47802596 CTGAGGCAGGAGAATGAACCTGG - Intronic
1041277706 8:56179991-56180013 CAGAGGCAGAATAAGGAGCCAGG + Intronic
1043519141 8:81025721-81025743 CAGCCACAGGAGGAGGTGCCTGG + Intronic
1044477607 8:92646608-92646630 CAGAGGCCAGAGATGCTGCCAGG + Intergenic
1044584014 8:93852141-93852163 GAGAGGGAGGAGGAGGTGCCAGG + Intergenic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1045489469 8:102657400-102657422 GAGAGGCAGGAAGAGCTGCCGGG - Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046625507 8:116572664-116572686 CAGAGGCAGGAGAAGAGCCGTGG + Intergenic
1046754143 8:117955832-117955854 CAGGTGCAGGACAATGTGCCTGG + Intronic
1046863549 8:119121028-119121050 CAGAAGCAGGTGAAGTTGCTTGG + Intergenic
1047348505 8:124051344-124051366 CTGAGGCACCAGGAGGTGCCTGG - Intronic
1048195269 8:132327491-132327513 CAGAGCCAGGACAGGGTCCCTGG - Intronic
1048773752 8:137922909-137922931 CACAGGCAGGAGAAGTTGGGGGG + Intergenic
1048975757 8:139672244-139672266 CAGAGGCAGGAGCAGGACCAGGG + Intronic
1049102846 8:140591326-140591348 CAGGGGCTGTAGAAGGTGCTGGG + Intronic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049276062 8:141720730-141720752 CCCTGGCAGGAGCAGGTGCCTGG + Intergenic
1049277720 8:141728270-141728292 GGAAGCCAGGAGAAGGTGCCAGG - Intergenic
1049301441 8:141872706-141872728 CAGAGGCAGGTGAGGGTGGTGGG + Intergenic
1049324731 8:142016037-142016059 CAGAGGCAGGAGGTGGCGACTGG - Intergenic
1049340578 8:142110228-142110250 CAGAGGGAGGAGACAGTGCTGGG - Intergenic
1049391207 8:142372608-142372630 CAGAGGCTCGGGAATGTGCCAGG - Intronic
1049620496 8:143596288-143596310 CAGAGGCAGGTCTAGGAGCCTGG + Intronic
1049665032 8:143839262-143839284 ACGGGGCAGGGGAAGGTGCCTGG - Intronic
1049676470 8:143891476-143891498 CAGTGGCTGGAGGAGGGGCCCGG - Intergenic
1049681004 8:143918190-143918212 CAGTGGCAGGAGCAGCTGGCCGG + Exonic
1050562361 9:6847487-6847509 CTGAGGCAGGAGAACGGCCCCGG - Intronic
1051139698 9:13965090-13965112 CAGAGGAAGGAGAAAGTTCTAGG + Intergenic
1051301020 9:15651013-15651035 CAGAGGCTGGAAAGGGTGTCAGG - Intronic
1051913920 9:22185343-22185365 CAGAGGCAGGGGCAGCTCCCGGG + Intergenic
1052850125 9:33373169-33373191 GAGAGGCCAGAGAAGGTGGCAGG + Intergenic
1053020311 9:34689892-34689914 CAGAGGGAGGAGACAGGGCCAGG + Intronic
1053174810 9:35915046-35915068 CAGAGGAAGCACAATGTGCCTGG - Intergenic
1053389537 9:37724381-37724403 CAGATGCAGGGCAAGATGCCTGG - Intronic
1053415534 9:37944840-37944862 GAGAGTCAGGAGAAGCTGCAGGG - Intronic
1054826910 9:69582555-69582577 CAGAGTCAGAAGCAGGTACCAGG - Intronic
1055554247 9:77459528-77459550 CTGAGGCAAGAGGCGGTGCCTGG - Intronic
1055656114 9:78452004-78452026 CAGAGGATGGAGAATGTTCCAGG - Intergenic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1057034708 9:91803389-91803411 CAGAGGCTGGAGGAGGGGACAGG + Intronic
1057457213 9:95225453-95225475 AAGAGGCATCAGAAGGGGCCTGG + Intronic
1058745821 9:107989623-107989645 CAGAGGCTGGAGAAGAAACCAGG - Intergenic
1059164894 9:112068256-112068278 CAGAGGCATGAGGTGGTGGCAGG + Intronic
1059167948 9:112096986-112097008 TACAGACAGGACAAGGTGCCAGG + Intronic
1059287517 9:113187852-113187874 TTAAGGCAGCAGAAGGTGCCTGG + Exonic
1059421743 9:114196533-114196555 CAGAAGCAGGAGTAGGACCCAGG - Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1061003787 9:127917030-127917052 CAGAGGCAGGGGGCGGGGCCGGG + Intronic
1061412139 9:130427553-130427575 CAGGTGCAGGAGAAGCGGCCGGG - Exonic
1061955852 9:133960956-133960978 CAGAGGCAGGAGGGCGTGCTTGG + Intronic
1062096584 9:134706925-134706947 CACAGGCTGGGGAAGGTGCTGGG - Intronic
1062273258 9:135719346-135719368 CAGAGTCTGCACAAGGTGCCTGG - Intronic
1062439504 9:136563419-136563441 CCTAGGCAGGAGAAGGCTCCAGG - Intergenic
1062450065 9:136611439-136611461 CTGAGGCTGGAGAACCTGCCTGG - Intergenic
1062504359 9:136865765-136865787 CAGAGGCAGGAGGTGGGGACGGG - Intronic
1062518993 9:136949915-136949937 CCGAGGCGGGAGGCGGTGCCCGG - Intronic
1062676974 9:137752415-137752437 CAGACGCAGGAGGAGGCGCTGGG - Intronic
1203579611 Un_KI270745v1:30339-30361 CAGAGGCTGTAGAATGTGCACGG - Intergenic
1185494554 X:544530-544552 CAGAGGCTGGAGCAGGTGACTGG + Intergenic
1185737941 X:2507311-2507333 CAGGGGCAGGAGATGCTCCCTGG + Intergenic
1185760512 X:2687158-2687180 CAGAGGCTGGAGATGGTCCAGGG + Intergenic
1186149332 X:6657594-6657616 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1186382449 X:9075011-9075033 CAGAGGCAGGAGAAGCAGGTAGG + Intronic
1186591135 X:10931261-10931283 CAGAGGCAGGACAAGCTTACAGG + Intergenic
1186687994 X:11945673-11945695 GAGAGAGAGGAGTAGGTGCCAGG + Intergenic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187207501 X:17197104-17197126 CAGAGGCAGTAGAGAGTTCCAGG + Intergenic
1187251817 X:17605718-17605740 CAGGGACAGGAGAAGATGCAAGG - Intronic
1187293914 X:17980943-17980965 GAGAGGCAGGAGAAGGGGCAGGG - Intergenic
1187397252 X:18929731-18929753 GAGAGGCAGGAGAAGGTCAGAGG - Intronic
1187660405 X:21540295-21540317 CATAGGCTTGAGAAGGTACCAGG - Intronic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1189321818 X:40091751-40091773 TAGAGCCAGGAGAAGCCGCCGGG - Intronic
1189880760 X:45489271-45489293 TAGAGGCAGGAAAATGTGGCGGG + Intergenic
1190888900 X:54552085-54552107 CAGAGGATGGCCAAGGTGCCAGG + Intronic
1191730736 X:64332526-64332548 CAGAAGCAGCAGTAGGTGCAAGG - Intronic
1192141133 X:68647821-68647843 GAGAGGGAGGAGCCGGTGCCCGG + Exonic
1192798517 X:74444271-74444293 CAGGGGCAGGATATGGTGCCAGG - Intronic
1192798544 X:74444416-74444438 CAGGGGCAGAATATGGTGCCAGG - Intronic
1193793065 X:85840521-85840543 CAGAGCCAGGATTAGGAGCCAGG - Intergenic
1194261794 X:91704605-91704627 CAGAGGCAGGAAAAAGTATCAGG + Intergenic
1194518350 X:94887696-94887718 CAGTGGCAGAAGAAGGTCCCAGG + Intergenic
1194825037 X:98551117-98551139 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1196060407 X:111402296-111402318 CAGAGGCAAGAGGAGGGGACTGG + Intronic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1196862444 X:120040829-120040851 CAGGGGCAGGAGGAGGTGACAGG + Intergenic
1196880658 X:120195515-120195537 CAGGGGCAGGAGGAGGTGACAGG - Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1199540590 X:148953735-148953757 CAGAGGTGAGTGAAGGTGCCAGG + Exonic