ID: 1006199190

View in Genome Browser
Species Human (GRCh38)
Location 6:32271342-32271364
Sequence ATGTATTTGCGTGGTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006199190_1006199193 12 Left 1006199190 6:32271342-32271364 CCTTTAAAACCACGCAAATACAT No data
Right 1006199193 6:32271377-32271399 ACCTGCTCCTGAATGATCATTGG 0: 124
1: 410
2: 742
3: 8596
4: 4939
1006199190_1006199195 13 Left 1006199190 6:32271342-32271364 CCTTTAAAACCACGCAAATACAT No data
Right 1006199195 6:32271378-32271400 CCTGCTCCTGAATGATCATTGGG 0: 125
1: 380
2: 705
3: 8195
4: 4820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006199190 Original CRISPR ATGTATTTGCGTGGTTTTAA AGG (reversed) Intergenic
No off target data available for this crispr