ID: 1006199630

View in Genome Browser
Species Human (GRCh38)
Location 6:32276618-32276640
Sequence TGGTGGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006199625_1006199630 2 Left 1006199625 6:32276593-32276615 CCACTTTCAATCATATGCCAATC No data
Right 1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG No data
1006199623_1006199630 12 Left 1006199623 6:32276583-32276605 CCACTTATACCCACTTTCAATCA No data
Right 1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG No data
1006199622_1006199630 13 Left 1006199622 6:32276582-32276604 CCCACTTATACCCACTTTCAATC No data
Right 1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG No data
1006199624_1006199630 3 Left 1006199624 6:32276592-32276614 CCCACTTTCAATCATATGCCAAT No data
Right 1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006199630 Original CRISPR TGGTGGGTTAATGCAAATTG AGG Intergenic
No off target data available for this crispr