ID: 1006201890

View in Genome Browser
Species Human (GRCh38)
Location 6:32300838-32300860
Sequence CTGGGCAAAGAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1024
Summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 942}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006201890 Original CRISPR CTGGGCAAAGAGAAGGGGGA AGG (reversed) Intronic
900117631 1:1035207-1035229 CTGGGCAAAGGGATGGGACAGGG + Intronic
900175242 1:1288622-1288644 CGGGGCAGAGACACGGGGGACGG - Intronic
900175526 1:1289818-1289840 CGGGGCAGAGACACGGGGGACGG - Intronic
900372011 1:2336386-2336408 CTGGGCCAGGAGGACGGGGAAGG - Intronic
900532623 1:3162187-3162209 CTGGGCACAGAGAGGGGTGATGG - Intronic
900838867 1:5031055-5031077 CTGGGAGAAGGCAAGGGGGAGGG - Intergenic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901061337 1:6473357-6473379 CTGGGCAGAGAGCAGCTGGAGGG + Exonic
901081181 1:6585216-6585238 CTGGGCAGAGAGAAGAGCCAGGG + Intronic
901347829 1:8562740-8562762 CTGGGCAAAAAAAAGGGGAGGGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902114772 1:14112407-14112429 GTGGCCAAAGAGGAGTGGGAGGG - Intergenic
902395917 1:16132494-16132516 GTGGGCACAGATATGGGGGAAGG + Intronic
902414058 1:16228617-16228639 CTGGTCAGAGAGCAGGTGGAGGG - Intergenic
902659245 1:17889980-17890002 CTGGGCAGAAAGAAGTGGGCTGG + Intergenic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903049217 1:20588596-20588618 TAGGGCAAAGAGAAGTTGGAAGG + Intergenic
903892189 1:26577286-26577308 CTGAGCAAAGATGAGGGGGTGGG + Intergenic
904462955 1:30691323-30691345 CTGGGATTAGAGGAGGGGGAGGG - Intergenic
905025583 1:34847243-34847265 CTGGGCAAACAAAACTGGGAGGG + Intronic
905499659 1:38426606-38426628 CTGGGCACAGAGACTAGGGAGGG - Intergenic
905664942 1:39757705-39757727 CTGAGCAAAGAAAAGGGAAATGG + Exonic
905677359 1:39836791-39836813 CTAGGTAAAGAGCAGGGGAAAGG + Intergenic
905902396 1:41590218-41590240 CTGGGCAAAGAGAGAGGCCAAGG + Intronic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906241715 1:44246293-44246315 CTGGGCAGAAAAATGGGGGAAGG - Intronic
906276885 1:44523367-44523389 CTAGGCAAAGAGGAGGTGAAAGG - Intronic
906416083 1:45622194-45622216 CTGGGGAGAGATAAGTGGGATGG + Intronic
906500882 1:46341258-46341280 ATGGGCAAGGGAAAGGGGGAGGG - Intronic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906744646 1:48213197-48213219 CTGGGCACAGAGACTAGGGAGGG + Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
909415503 1:75401630-75401652 CTGGGGCTAGAGAAGTGGGATGG + Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910105517 1:83627603-83627625 ATGGGTATAGAGAAAGGGGAAGG + Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
911281596 1:95936212-95936234 CTCGGCCATGAGATGGGGGAGGG - Intergenic
912430037 1:109624149-109624171 CTGGACAAAGGGAAGAGGGAGGG - Intronic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
914713875 1:150238222-150238244 AGGGGAAAAGAGAAGAGGGAGGG + Intergenic
914823767 1:151125961-151125983 CTGAGCTAACTGAAGGGGGAGGG + Intergenic
914999387 1:152574186-152574208 CCCTGCAGAGAGAAGGGGGATGG + Intronic
915356007 1:155255457-155255479 CGGGGACTAGAGAAGGGGGATGG + Intronic
915356616 1:155258913-155258935 CTGGACAAAAAGAAGGTAGAGGG + Exonic
915357827 1:155266896-155266918 CTGAGAAGAGAGATGGGGGAAGG + Intronic
915476200 1:156154198-156154220 TTGGGCTATGAGAAGAGGGAAGG + Intronic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917709046 1:177665932-177665954 CTGGCAAAAGAGCAGAGGGAAGG + Intergenic
918132267 1:181639875-181639897 ATGAGTAAAGAGAAGGGGGTTGG + Intronic
918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG + Intergenic
918322260 1:183375441-183375463 CTGGGCAAAGGCATAGGGGAGGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919097150 1:193051250-193051272 CTGGTCAGAAAGATGGGGGAAGG + Intronic
919476282 1:198036321-198036343 CTGGGCACAGAGACTAGGGAGGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920286778 1:204885366-204885388 CAGGGCAAAGGGGAGGGTGAAGG - Intronic
920397556 1:205658257-205658279 CTGGGCCAAGAGAAGAGGGGTGG + Exonic
920438194 1:205961669-205961691 CTGGGCCCAGAGCTGGGGGATGG + Intergenic
920608245 1:207411172-207411194 CGGGACTAATAGAAGGGGGAAGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
920962463 1:210675732-210675754 CTTGGCAAAGAGATGGGAGGGGG + Exonic
921178779 1:212615476-212615498 CGGGGCAGAGAGAACGGGTAGGG + Intronic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921565923 1:216719886-216719908 CTGGGCAGAGCTAAGGGTGATGG - Intronic
921604204 1:217136677-217136699 CTGGCCAAAAGGAAAGGGGAAGG - Intronic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922287641 1:224183592-224183614 CTGGGCGAGGAGCGGGGGGAGGG + Intronic
923036848 1:230290469-230290491 CTGAGCACAGAGAACGGAGATGG - Intergenic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
923962669 1:239102869-239102891 CTGGGCACAGAGACTAGGGAGGG - Intergenic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
924821557 1:247495957-247495979 CTGGTCAAAGAGAAGACGAAAGG + Intergenic
1062823489 10:551602-551624 CTGGGCTCAGAGAAAGGTGAGGG + Intronic
1062907318 10:1187571-1187593 CTCCGCAAAGAGAAAGGAGAGGG - Intronic
1063093833 10:2891485-2891507 CTGGGAAATGAGAAGAGTGAGGG + Intergenic
1063390266 10:5645712-5645734 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063390394 10:5646368-5646390 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063451533 10:6153550-6153572 CTCAGGAAAGAGGAGGGGGAGGG + Intronic
1063526718 10:6793693-6793715 GTTGGCAAAAAAAAGGGGGAGGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1063982504 10:11466007-11466029 CTGGGCAAAGCAAATGTGGAAGG + Intronic
1064409196 10:15090783-15090805 CTAGGCAATGAGATGGGGAATGG - Intergenic
1064532526 10:16324736-16324758 CTGGACAAAGAGAAGTTGAAGGG + Intergenic
1064918269 10:20486683-20486705 CTGGCCAGAGAGAAGAGGGGTGG + Intergenic
1065437516 10:25717933-25717955 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1066143813 10:32535610-32535632 CTAGGTAAAGAGAAGGGGCTTGG + Intronic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067292851 10:44957048-44957070 CTGGACGCAGAGATGGGGGAAGG - Intergenic
1067683457 10:48454233-48454255 GTGGGCAAAGAGAAGGGAGGTGG + Intronic
1067709822 10:48639099-48639121 CTGAGCTTAGAGAAGTGGGATGG - Intronic
1067835940 10:49641738-49641760 CTGGACTGTGAGAAGGGGGATGG + Intronic
1067838538 10:49657003-49657025 CAGGGCAAAGAGAACAGGAAAGG + Intronic
1068326908 10:55502322-55502344 CTGGGCAAAGAGGATGAGAAGGG - Intronic
1068403797 10:56564133-56564155 CTGGCCAAAAAGAAAGGGAAAGG + Intergenic
1069557308 10:69406778-69406800 CTGGGGCAAGAGAAGAGAGAAGG - Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070701901 10:78609928-78609950 CTGGGCAGAGAGAAATGAGAGGG - Intergenic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1070978886 10:80628540-80628562 GAGGGCAAAGTGAATGGGGAAGG + Intronic
1071289888 10:84181071-84181093 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1071289900 10:84181123-84181145 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1071289912 10:84181175-84181197 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1072252089 10:93589590-93589612 CTGGGCAAAGATTAGGGGGGGGG + Exonic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073446034 10:103580840-103580862 ATGTACAAAGAGAAGGGGGTAGG - Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074253980 10:111782195-111782217 CTGGGCAAAGAGGATGGAGGTGG - Intergenic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075655276 10:124156942-124156964 CCGGGCACACAGAATGGGGAAGG + Intergenic
1075996634 10:126882097-126882119 CTAGGCAAAGAAAGGGGTGACGG + Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076187184 10:128459092-128459114 CTGGGCAACGTGCAGGGGTAGGG + Intergenic
1076685097 10:132194994-132195016 CTGGTCAAGGAGAAGGGTGAGGG + Exonic
1076717892 10:132375762-132375784 CTGGGCAGGGAGCAGGGGAAAGG - Exonic
1076823391 10:132953456-132953478 TGGGTCAATGAGAAGGGGGAGGG + Intergenic
1077243288 11:1523199-1523221 CTGGGCTCAGAGACGGTGGATGG - Intergenic
1078172351 11:8937929-8937951 ATCGGGAAAGAGAAGGGGCAGGG + Exonic
1078473569 11:11611379-11611401 GTGGGCAAGGAAAATGGGGAAGG + Intronic
1078564584 11:12403425-12403447 CTGGGCACAGAGAAGGCTGGGGG - Intronic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079306939 11:19331607-19331629 GTTGGCAGAGAGAAGGGAGAAGG - Intergenic
1079727192 11:23891372-23891394 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1080028023 11:27633260-27633282 CTGGGCACAGAGACTGGGAAGGG + Intergenic
1080429593 11:32185942-32185964 CTGGCCCAAGGGAAGTGGGAAGG - Intergenic
1080642912 11:34168144-34168166 CTGGGCACAGGGCATGGGGAAGG + Intronic
1080807532 11:35668099-35668121 CTGGAGAGAGTGAAGGGGGAAGG + Intronic
1081290424 11:41318571-41318593 GTGGGCAAAGAGTTGAGGGATGG - Intronic
1081488252 11:43547888-43547910 CTGGGGGAAGAGAAGGGCGCGGG - Intergenic
1081684007 11:45028657-45028679 ATGGGAAAAGAGAAGGGGCTTGG - Intergenic
1081881471 11:46456500-46456522 ATGGGCAAAGAGAGGGGTGAAGG + Intronic
1082002826 11:47403103-47403125 CTGAGACAAGAGAAGGGGAATGG + Intergenic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082638934 11:55630748-55630770 TGGGGTAAAGAGTAGGGGGAGGG + Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082784677 11:57310356-57310378 ATGGGCAAGGAGCAGGGGAAGGG - Exonic
1082790367 11:57342771-57342793 CTGGGCAGAGGGAAAGGGGGAGG - Intronic
1082909488 11:58354126-58354148 CTGGGAAAAAAGAAATGGGAAGG - Intergenic
1083198690 11:61106376-61106398 CAGGGCAAAGGCAAGGGGGAAGG + Intronic
1083643395 11:64157982-64158004 GTGGGCAGAGACAAGGGGGCAGG - Intronic
1083970879 11:66074165-66074187 CTGGGAAGTGAGAAGAGGGATGG - Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084047047 11:66575118-66575140 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1084301270 11:68254191-68254213 ATGGGCAGAGAGCAGAGGGAAGG + Intergenic
1084405655 11:68971367-68971389 CTGGACAAAGAGGAAGGAGAAGG - Intergenic
1084456620 11:69271457-69271479 CTGGGCAAAGACAAGGGCCTGGG - Intergenic
1084613385 11:70218480-70218502 CTGGGCAGAGAGACTAGGGAGGG + Intergenic
1084942957 11:72623648-72623670 ATGGGCAAAGGCAAGGGGGAGGG - Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085167148 11:74413041-74413063 CTAGGCAAGAGGAAGGGGGAAGG + Intergenic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1085454348 11:76657231-76657253 CTGAGCACAGAGAAGGGGAGGGG + Intergenic
1085512447 11:77095284-77095306 CTGAGCTCAGAGAAGGGGGTGGG - Intronic
1086518765 11:87646102-87646124 AGGGGGAAAGGGAAGGGGGAAGG - Intergenic
1086685359 11:89727900-89727922 CTGGGAAGCGGGAAGGGGGATGG + Intergenic
1086911182 11:92474498-92474520 CTGGGCATACAGGAAGGGGAAGG + Intronic
1087119573 11:94559560-94559582 CTAGGCAAAGAGAAGGTTGTTGG - Intronic
1087123386 11:94598547-94598569 GTGGGCAAAACGGAGGGGGAGGG - Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1088115277 11:106305451-106305473 ATGGGGAAAGAGAGGGGGAAGGG + Intergenic
1088268259 11:108008285-108008307 CTGGACTAAGAGAAGAGGGATGG - Intergenic
1088545575 11:110955509-110955531 ATGTGCAATGAGGAGGGGGATGG + Intergenic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089772360 11:120812820-120812842 CTGGGCAGAGACAAGGGTGGAGG + Intronic
1089884540 11:121806928-121806950 CTGAGCGAAGAGCATGGGGATGG + Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1089987321 11:122826148-122826170 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1090350163 11:126102902-126102924 CTGGGCAAAGAGAAGAAAGGAGG + Intergenic
1090431958 11:126653679-126653701 CAGGGCAATGAGAAACGGGAGGG + Intronic
1090501217 11:127263241-127263263 CTGGGCAAAGGGCAGAAGGAGGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091044631 11:132314722-132314744 CTGGGCAAGAAGAGGGGAGAGGG + Intronic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1092203748 12:6603271-6603293 CTGGGCAAGGATAGGTGGGAAGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092474376 12:8806463-8806485 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1092626861 12:10337112-10337134 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1092971532 12:13700255-13700277 ATAGGCCAAGAGGAGGGGGATGG - Intronic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093316480 12:17657382-17657404 CTGGCCAAAGAGGAGTGGGGAGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1094280289 12:28729803-28729825 CTAGGCAAAAACAAAGGGGACGG + Intergenic
1095953751 12:47795343-47795365 CTGGGCAAAGTGGAAGGGCAAGG + Exonic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096653801 12:53075848-53075870 CTAGCCCAAGAGTAGGGGGAGGG + Intronic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096828995 12:54300277-54300299 CTGGGCACAGAGAAGAGAAAGGG + Intronic
1097237235 12:57548937-57548959 CTAGGCAAAGAGGAAGGGCAGGG - Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1098844922 12:75523328-75523350 CTGGCCAAAGAAAGGGGTGACGG - Intergenic
1099258995 12:80352639-80352661 CAGGGAAAAGAGAAAGGGAAGGG - Intronic
1099599448 12:84714157-84714179 ATGGGCAAAGAGTAGAAGGATGG + Intergenic
1099643387 12:85319518-85319540 GAGGACAAAGAGGAGGGGGAGGG - Intergenic
1099685023 12:85874174-85874196 CAGGGCAAAGAGGGGAGGGATGG + Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1100759817 12:97794907-97794929 CTGGGCAAAAGGCAGGGAGAGGG - Intergenic
1100972531 12:100086359-100086381 CTGGGAAAAAAAAAGGGGGGGGG + Intronic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101358823 12:104007294-104007316 ATCTGGAAAGAGAAGGGGGAGGG - Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101450455 12:104772820-104772842 AAGGGCAAAAAGAAGGGGAATGG - Intergenic
1102047619 12:109839835-109839857 CTGGGCTAAGGGGAGGGGGCGGG - Intergenic
1102188775 12:110970147-110970169 CTGGGCACAGAGAAGGGCCTCGG - Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102224487 12:111218169-111218191 CTGGGCAAAGTCGAGGGAGAGGG - Intronic
1102539559 12:113608847-113608869 TTGGCCAAAGATAAGGGGAATGG - Intergenic
1102551335 12:113694340-113694362 CTGGGACAAGAGGAGGGGAAGGG - Intergenic
1102813190 12:115841705-115841727 GTGGGAAGAGAGAAGGGGGAAGG - Intergenic
1103209793 12:119157781-119157803 CTGGGCAGAGGGGAGGGGGCTGG - Exonic
1104165073 12:126219903-126219925 TTGGGCAAAGAGTAGGGGAGGGG + Intergenic
1104842604 12:131832053-131832075 CGGGGGGAAGGGAAGGGGGAAGG + Intronic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105069895 12:133227919-133227941 CTGGGCAGAGGGAGGGGGGCGGG + Exonic
1106197847 13:27509417-27509439 CTGGAGATAGAGAAGTGGGAAGG - Intergenic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1106672739 13:31923895-31923917 GTTGGCCAAGAGAAAGGGGAAGG + Intergenic
1108715402 13:53073363-53073385 CTGGGGAAACAGAAGAGGGCTGG + Intergenic
1109158862 13:58947340-58947362 CTGGGCAGAGATAAGGAGGGTGG - Intergenic
1109499178 13:63214651-63214673 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1110104358 13:71652538-71652560 CTTGGCAAAGAGAACAGTGAAGG - Intronic
1111362239 13:87190659-87190681 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1111394677 13:87649757-87649779 CTGGGCATAGATAAGGTGGATGG - Intergenic
1111538242 13:89632715-89632737 TTGGGCCAAGAGACTGGGGATGG + Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1112433537 13:99373889-99373911 CTGGACACAGAGGAGGGGGCAGG + Intronic
1112605394 13:100899863-100899885 CTGGGCAGACAGAAGTGTGAAGG + Intergenic
1112614563 13:100990089-100990111 TCAGGCAAAGAGAAAGGGGAGGG + Intergenic
1112696337 13:101953087-101953109 CTGGCCAAATAGTAGAGGGAGGG - Intronic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113564319 13:111309644-111309666 CAAGGCAAGGAAAAGGGGGAGGG + Intergenic
1113695708 13:112343806-112343828 CTGGACAGAGAGGAGGGTGACGG - Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1113839987 13:113353592-113353614 CTGGGCAAGGACACGGGGGTCGG + Intronic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114299723 14:21364358-21364380 GTGGGGGAAGGGAAGGGGGATGG + Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114648419 14:24268421-24268443 CTGGGGAAAGAGTAGGTGGTTGG + Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG + Intergenic
1115591862 14:34873698-34873720 CTGGGCAAGGGGAAGAGGAAGGG - Intronic
1116534893 14:46016587-46016609 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116832289 14:49733006-49733028 CTAGGGAAAGAGAAGAGGAAGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117017619 14:51534544-51534566 CTGGGCAAAGAAGAGAGAGACGG - Intronic
1117099676 14:52333575-52333597 GAGGGCAAAGGGAATGGGGAGGG - Intergenic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1118313032 14:64706820-64706842 CTGGGAGAAGAGAACGGGCAAGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118739319 14:68727597-68727619 CAGGTCAAAGTGTAGGGGGAAGG - Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119180216 14:72600332-72600354 CTGGGGACAGAGAGGAGGGAGGG - Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120674826 14:87408667-87408689 ATTGCCAAAGAGAAGGGTGAGGG - Intergenic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121404159 14:93708782-93708804 CTGGGCAAAGAAGAGGGAGTGGG - Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121961140 14:98261276-98261298 CTGGGAAGAGAGGAGGGGAATGG + Intergenic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122334593 14:100962567-100962589 CTGAGCAAAGGAAATGGGGAAGG + Intergenic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1122676204 14:103416266-103416288 CTAGGCACAGATAAGTGGGATGG + Intronic
1202832681 14_GL000009v2_random:53868-53890 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1124159646 15:27256502-27256524 CGGGGAGAAGAGAAGGGGGCTGG + Intronic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125095899 15:35850879-35850901 CTGGGCAAAGGAAATGGTGATGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125685486 15:41560939-41560961 CTGGGCGAAGGGAAGGGGCATGG - Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126300915 15:47195333-47195355 CTGGGCAGAGATAAAGGGCAGGG - Intronic
1126484281 15:49162141-49162163 CTGGGAAAAGTTAAGGGGGGAGG - Intronic
1127399871 15:58574926-58574948 CAGGGCCAAGAGATGAGGGAGGG - Intergenic
1127916351 15:63458857-63458879 CTGGCCAAGGAGCAGGGTGAGGG - Intergenic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128692819 15:69738146-69738168 TTTGGCAAAGAGAAGGTGGGTGG - Intergenic
1129144026 15:73632261-73632283 CTGGGTATAGAGATGGGGGTGGG - Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1129984181 15:79902417-79902439 CTGGGCGAAAAGAAGAGGGAAGG + Intronic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1130891512 15:88137564-88137586 GTCGGCAAAGAGAGAGGGGAAGG + Intronic
1130913845 15:88289781-88289803 CTTGGCAAAGAGAAGGGGGGGGG - Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131475119 15:92731813-92731835 CAGGGCTACTAGAAGGGGGAGGG + Intronic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131682019 15:94733567-94733589 CTGGGCAAAGAGGTGAGGTAGGG - Intergenic
1131684062 15:94752269-94752291 CTGGGCACAGAGACTAGGGAAGG - Intergenic
1131833393 15:96368367-96368389 CTGGGCAAAGGGGGTGGGGAAGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131965776 15:97840758-97840780 GTGGGCAAAGGGAAGAGGGCAGG + Intergenic
1132037571 15:98499502-98499524 CTGGGAAAAGAGAAGGGAAAAGG - Intronic
1132472263 16:111903-111925 CTGGCCAAAGAAAATGGAGATGG + Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1132770761 16:1561666-1561688 CGGGGAAAAGGCAAGGGGGAAGG + Intronic
1132945438 16:2529441-2529463 CCGGGCAATGAGTAGGGGGCAGG - Intronic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133152759 16:3849278-3849300 CTGGACTTGGAGAAGGGGGAAGG - Intronic
1133589821 16:7231243-7231265 CTGGGCAAAGAAATAAGGGAGGG + Intronic
1133594611 16:7279607-7279629 CTGGGAATAGAGAGGAGGGATGG + Intronic
1133651281 16:7816231-7816253 CTGGGCACAGAGACCGGGCAGGG - Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135708712 16:24696862-24696884 CAAGGCAAAAAGAAGGGGAATGG - Intergenic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1136045082 16:27609060-27609082 CTGGGCAACAAGAAAAGGGAAGG - Intronic
1136178517 16:28535111-28535133 CTGGGAAGTGAGATGGGGGAGGG - Intronic
1136187670 16:28597576-28597598 GTGGGCAGAGTGAAGGGGCAGGG + Intergenic
1136190149 16:28610556-28610578 GTGGGCAGAGTGAAGGGGCAGGG + Intronic
1136266981 16:29127656-29127678 CTAAGCAAAGAGCAGGGGCAGGG + Intergenic
1136294713 16:29295043-29295065 CTGGGCTGTGAGAAAGGGGAGGG - Intergenic
1136392420 16:29974016-29974038 CTCGGAAGAGAGAAGGGAGAGGG + Exonic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1137377829 16:47969174-47969196 CTGGGAAAAGAAAAGAGGGTGGG - Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138076692 16:54049729-54049751 GTAGGCAAAGGGAAGAGGGAGGG + Intronic
1138346198 16:56321731-56321753 CTGGGCAGAGAGGAGCGGGCAGG + Intronic
1138428606 16:56953029-56953051 CCAGGCTAAGAGATGGGGGATGG + Intergenic
1138482003 16:57309668-57309690 ATGGGCTGAGAGGAGGGGGAAGG + Intergenic
1138615023 16:58158354-58158376 CTGGGGAAAGAGACGGGAGGAGG + Intronic
1138984082 16:62305624-62305646 GTGGGCAGAGGGAATGGGGAAGG + Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140508312 16:75488587-75488609 CTGGGCATTTGGAAGGGGGAAGG + Intronic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1141058731 16:80843609-80843631 CTGGGCAAAGAAGAAGGAGAAGG + Intergenic
1141417909 16:83891050-83891072 CTGAGTAAAGAGAAGCGGAATGG - Intergenic
1141602783 16:85136624-85136646 CTGCGCACAGAGCACGGGGAGGG - Intergenic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141647796 16:85376760-85376782 CTGGGCAGAGAGCAGGGGGCTGG + Intergenic
1141827071 16:86488045-86488067 ATGGGCACAGAGAAAGGGCACGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142070269 16:88087979-88088001 CTAAGCAAAGAGCAGGGGCACGG + Intronic
1142100616 16:88269087-88269109 CTGGGCTGTGAGAAAGGGGAGGG - Intergenic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143253515 17:5539371-5539393 CTGGGCAGAGGGAAGAGGGTTGG - Intronic
1143487400 17:7262344-7262366 CTAGGCAAACAAAAGGTGGAGGG + Exonic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144113499 17:12062891-12062913 CTGGGAAAAGGGAAGAGGGGAGG - Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144591533 17:16528319-16528341 ATGGGTAATGAGAAAGGGGAGGG + Intergenic
1144816963 17:18041079-18041101 AAGGGCAAAGGGAAGGGGAAAGG - Intronic
1145218988 17:21073179-21073201 CCAGGAAGAGAGAAGGGGGAAGG + Intergenic
1146456952 17:33015990-33016012 CTTGGCAAAGAGGAGGACGAAGG - Exonic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1147168510 17:38605444-38605466 CTGGGACCAGAGAAGGGGGCAGG - Intronic
1147437435 17:40425869-40425891 CTAGGCCACGAGATGGGGGAAGG - Intergenic
1147574902 17:41593431-41593453 ATGGGCAAGGTGAAGGGGGTGGG - Intergenic
1148022079 17:44559933-44559955 GTAGGGAAAGAAAAGGGGGAAGG - Intergenic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148610590 17:48962019-48962041 CTTGGCATAGAGCAGGGAGAAGG + Intronic
1148742133 17:49898822-49898844 CTGTGCACACAGAAGAGGGATGG - Intergenic
1148768411 17:50052885-50052907 TAGGGCACAGAGAAGAGGGAAGG + Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149285606 17:55160790-55160812 TTGGGTGCAGAGAAGGGGGAAGG - Exonic
1149446055 17:56714266-56714288 CTGGGCAAAGAGACATAGGAAGG + Intergenic
1150069694 17:62140279-62140301 CTGGGCAAAGAGACTGGAGAAGG - Intergenic
1150247794 17:63689264-63689286 CTGGCCAAAGGGAAGGTGTATGG - Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150584522 17:66505321-66505343 CTGGCCACAGGGAAGAGGGAGGG + Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1150983976 17:70174553-70174575 CTGGCCAAAAAGAAGGGAAAGGG + Intronic
1151576239 17:74953891-74953913 ATGGGCACAGGGATGGGGGAGGG - Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151718271 17:75842568-75842590 CTGGGCATTGAGCAGGGGGTAGG - Exonic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152100592 17:78299579-78299601 CTGGCAAAAGAGCAGGGGGTTGG - Intergenic
1152139565 17:78528563-78528585 CTGGACACAGAGAAGGGGAGAGG + Intronic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152427035 17:80223585-80223607 CTCGGGCAAGAGCAGGGGGATGG - Intronic
1152456049 17:80416772-80416794 CTGGGCACAGAGTGGGGGAAGGG - Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152686587 17:81696725-81696747 CTGGGCGTAGGGCAGGGGGAAGG - Exonic
1152840066 17:82561626-82561648 CGGGGAAAGGAGAAGGGCGAGGG + Intronic
1153327787 18:3839505-3839527 CTGGGCAAAGAGAAGAGAGGAGG + Intronic
1153851741 18:9101836-9101858 ATGGGCAAAAGGAAGGGGGTGGG + Intergenic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1155176368 18:23304814-23304836 CTGGGCTGAGAGTTGGGGGATGG - Intronic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155941428 18:31805305-31805327 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1156892688 18:42208241-42208263 GTGGGCAAAAAGAAAGGGGTTGG + Intergenic
1157080509 18:44519867-44519889 CTGGGCAAAGAAAATGAGCACGG + Intergenic
1157280977 18:46346120-46346142 CTGGGCAGAGAGAGAAGGGATGG + Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157439195 18:47697130-47697152 CAGGGCACAGAGAAGAGGGTGGG - Intergenic
1157500918 18:48190095-48190117 CAAGGCAGAGAGAAGAGGGACGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157884191 18:51350576-51350598 CAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158394760 18:57070809-57070831 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1159905991 18:74092917-74092939 GTGGGCCCAGAGAAGGGGGTGGG + Intronic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1160351830 18:78189228-78189250 CTGGGCAATGTGAAGGGGCCAGG - Intergenic
1160728564 19:629977-629999 CTGGGCAAAGATACTGGAGAAGG - Exonic
1161200951 19:3014515-3014537 CTGGGCACAGAGCAAGGGGTGGG - Intronic
1161357296 19:3826147-3826169 CGGGGCAGAGAAACGGGGGAAGG - Intronic
1162186338 19:8907730-8907752 CTGGGCAGAGTGAGGAGGGAAGG + Intronic
1162275456 19:9650478-9650500 ATGTGAAAAGAGAAGGGGGCGGG + Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1162875134 19:13615882-13615904 CTATGCAAAGATAGGGGGGAGGG - Intronic
1162876782 19:13626590-13626612 AAGGGGAAAGGGAAGGGGGAAGG + Intergenic
1163136653 19:15316292-15316314 CTGGGAATATAGAAGCGGGATGG - Intronic
1163156476 19:15442578-15442600 CTGGGGAATGAGAAGGGGACAGG - Intronic
1163308199 19:16495900-16495922 TTGGGCTAAGGGAAGGGTGAAGG + Intronic
1163444962 19:17340821-17340843 CGGGGCACAGTGCAGGGGGAAGG - Intronic
1163487164 19:17594924-17594946 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1163662580 19:18587657-18587679 ATGGACAAAAAGAAAGGGGAGGG + Intronic
1163879053 19:19901636-19901658 ATGGGGAAAAAGAAGGGGTAGGG - Intronic
1164548318 19:29187144-29187166 TTTGGCAATGAGAAGGGTGAAGG - Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1165051273 19:33142960-33142982 CTGGGCAATGACAAGGGGAGAGG + Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165489287 19:36114105-36114127 CTGGGCGAAGGGAGGAGGGAAGG - Intronic
1165494213 19:36142277-36142299 CTGCGAAGAGATAAGGGGGAGGG - Intronic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165816387 19:38645019-38645041 CCTGGGAAAGAGAAGGGGGTGGG + Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167115964 19:47489225-47489247 CTGGGAACAGAGAAAGGGAAGGG + Intronic
1167212642 19:48143018-48143040 ATGGGGACAGAGAAGGGGGCTGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167576533 19:50320472-50320494 TGGGGCCAAGGGAAGGGGGAAGG + Intronic
1167598075 19:50437731-50437753 CTTGGCACAGAGAGGGGAGATGG + Intronic
1168212234 19:54899094-54899116 CTGGGCATAGAGACTAGGGAGGG + Intergenic
1168311492 19:55463239-55463261 CTAGGCAGAAGGAAGGGGGAAGG + Intergenic
1202640000 1_KI270706v1_random:73863-73885 CTGGGAAATAAGAACGGGGAGGG - Intergenic
925321822 2:2976227-2976249 GTGGGAAAAGAGATGGGGAAAGG + Intergenic
925372931 2:3360909-3360931 ATGGGGAAAGGGGAGGGGGAAGG + Intronic
925379809 2:3416916-3416938 CAGGGCACAGTGAAGGGGCAGGG - Intronic
925542324 2:4979303-4979325 CTGGGCTCAGAGAAGCAGGAAGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
926926070 2:17988841-17988863 CTAGCCAAAGAAAAGGGTGACGG - Intronic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927844481 2:26464355-26464377 CTGGGCTGAGAGAAGGGTCAGGG + Intronic
928283434 2:29968554-29968576 CTGGCCAAAGAGAAGAAGGTGGG + Intergenic
928314302 2:30233785-30233807 CTGGGGCTAGAGAAAGGGGATGG + Intronic
929294031 2:40226177-40226199 CTGGGCAATGGGAAGGGCAAAGG + Intronic
929427127 2:41854945-41854967 CTTGGCAATGGGAAGGGGAAGGG - Intergenic
929440316 2:41961011-41961033 TTGGGCAAAGAGACTGGGGATGG - Intergenic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930222213 2:48756125-48756147 TTGGTGAAAGAGAAGGGGAAAGG - Intronic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930395216 2:50814375-50814397 TTGGGGAATGAGAAGGGGTAAGG - Intronic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931609047 2:64079383-64079405 CTGGGCACAGAGACTAGGGAGGG + Intergenic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
933475625 2:82786453-82786475 ATGGAGAAAGAGAAGGGGGGCGG + Intergenic
933655992 2:84887422-84887444 GTGGGCACAGAGAAGAGAGAAGG + Intronic
933784797 2:85829977-85829999 GTGGGCAGAGAGATGGGAGAGGG + Intergenic
934652386 2:96099921-96099943 AAGGACAAAGAGGAGGGGGAGGG + Intergenic
935208790 2:100920786-100920808 CTTGGCCAAGCGAAGGGGCAGGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937038679 2:118803824-118803846 CTGGGGAAGGAGCAGCGGGAGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937341028 2:121090621-121090643 AGAGGCAGAGAGAAGGGGGAAGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937914420 2:127092040-127092062 CTGGGCCAAGAGCCTGGGGAAGG - Intronic
938623609 2:133084046-133084068 CTGAGCACAGAAAACGGGGAAGG + Intronic
938635032 2:133214798-133214820 CTGGGCAAAGAGAAGACTAAGGG - Intronic
938705432 2:133920523-133920545 CTGGGGAAAGAAAAGGGATATGG + Intergenic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
939083260 2:137687151-137687173 CTGGGCACAGAGACTAGGGAGGG + Intergenic
939589875 2:144051808-144051830 AAGGGCAAAGAAAAGGCGGAGGG + Intronic
940008129 2:149028372-149028394 CTGGGCATGGGGAAGGGTGAAGG - Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940495855 2:154427439-154427461 CTTGGCAAAGCGGAGTGGGAAGG + Intronic
940775015 2:157876091-157876113 CGGGGGAAAGAGCCGGGGGAGGG + Intergenic
941004734 2:160236322-160236344 CTGGCAAAAGAGAAGGGAAATGG + Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941095011 2:161229142-161229164 TTGGGCAAAGAGTAATGGGAGGG + Intronic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941295504 2:163734523-163734545 CTGGGCAAAGGGGAGAGGGCAGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944570677 2:201041945-201041967 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
944614611 2:201447789-201447811 CTGGGCAGAGAAAAGGGGAAGGG - Intronic
944635192 2:201669168-201669190 TTGGGCATGGAGAAGGGGAAAGG + Intronic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945185760 2:207137843-207137865 CTGGGGAAAGATGAGGGAGAGGG + Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945711974 2:213307994-213308016 CTTGGGAAAGAGAAGGCGAAAGG + Intronic
945854955 2:215058147-215058169 CTGGGCTAATAGAAGGCTGAAGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946748885 2:222872757-222872779 CTGATCTAGGAGAAGGGGGATGG + Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946886378 2:224226817-224226839 CTGGGCACAGAGACTAGGGAGGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947614806 2:231548964-231548986 CTGGGCAAAGAGCCAGGGAAAGG - Intergenic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
947918374 2:233849188-233849210 CTGGGCAAAGGGATGTGGCAAGG + Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948170199 2:235895313-235895335 CTGGGGCAAGAGCAGGGGCACGG - Intronic
948495870 2:238349470-238349492 CTCCGCTAAGAGAAGGGGGAGGG + Intronic
948618406 2:239216676-239216698 CAGGGCAGAGTGAAGGCGGAGGG - Intronic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
948990288 2:241550632-241550654 CTGGGAAAAGTGAATGGGGAGGG + Intergenic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1169796819 20:9471749-9471771 GTGGGCAAAGATATGGGGAAAGG + Intronic
1169801238 20:9514729-9514751 CGGGGGACAGAGAAGGGGGAGGG - Exonic
1170010657 20:11719036-11719058 CTGGGCATAGAGAATGGTGTAGG + Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170645158 20:18191230-18191252 CCAGGCAAAGAGAAGGGGCTGGG - Intergenic
1170800533 20:19586523-19586545 CCTGGCAAAGGGTAGGGGGAAGG - Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171293886 20:23999762-23999784 CTGGGATGAGAGAATGGGGAGGG + Intergenic
1171853396 20:30324125-30324147 GTGGGCAATGAGAAGAGGGCAGG + Intergenic
1172448039 20:35003284-35003306 CTGGGCAAAGAGGGAGGGGCTGG + Intronic
1172645548 20:36467064-36467086 CAGGGCCGAGAGAAGGGGGGGGG - Intronic
1172692129 20:36797281-36797303 CTGGGCTAAGTGAGGGGGTAGGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173164811 20:40680412-40680434 CCAGGCAAAGAGATGGGTGATGG - Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1174358269 20:50012450-50012472 AGGGGCAAAGAGAAGGGCCAAGG - Intergenic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1174582101 20:51579378-51579400 CTGGGCCCAGGGAAAGGGGAAGG + Intergenic
1174591441 20:51648393-51648415 ATGTGCAGAGAGAAGGTGGAAGG + Intronic
1174741466 20:53018469-53018491 AGGGGCTAACAGAAGGGGGAGGG + Intronic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175172729 20:57091570-57091592 ATGGGGAAAGAGATGAGGGAAGG - Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1175420485 20:58829349-58829371 CTGGCCACAGAGTACGGGGATGG - Intergenic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1175681814 20:60994790-60994812 CTGGGCAGTGGGATGGGGGAGGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176062941 20:63180109-63180131 CTGGTCCTAGAGAAGGGGAAGGG + Intergenic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1177862699 21:26473563-26473585 CTGAGCACAGTGAAGGGGGTGGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1179215866 21:39366817-39366839 AAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1179625172 21:42645195-42645217 CTGCGCAAAGGGGATGGGGAGGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180959757 22:19757201-19757223 CTGGTCAACCAGAAGGGCGACGG - Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1181960736 22:26619860-26619882 GTGGGGGCAGAGAAGGGGGATGG + Intergenic
1182353207 22:29710446-29710468 CTGGGCACAGGGAAGAGGGCTGG - Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1183131036 22:35836357-35836379 TTGGGAGAAGAGAAGAGGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183740314 22:39665225-39665247 CTGGGCACAGTGAGGGGTGAGGG + Intronic
1183742499 22:39676669-39676691 CTGGCCATAGAGAGGAGGGAAGG - Intronic
1183929440 22:41227657-41227679 CTGGGCAATGAGGAGAGGGCGGG - Intronic
1184110027 22:42389090-42389112 CTGGTCACAGAGAAAAGGGAGGG + Intronic
1184148980 22:42627689-42627711 CTGGGGAGAGAGAAGGGGTGAGG + Intronic
1184192618 22:42904869-42904891 CTGGGCACAGTGCAGGGGGGCGG - Intronic
1184468933 22:44684668-44684690 CTGGGCAGAGAGCTGGGGGCGGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185333092 22:50260375-50260397 CTGGGCCCAGACCAGGGGGAGGG + Intronic
949642514 3:6054205-6054227 ATGGGCAAAGAGAAGTAGGGTGG - Intergenic
949960015 3:9304295-9304317 CTGGGGAAAGAAAGGAGGGAGGG - Intronic
950569591 3:13791897-13791919 CAGGGCACGGAGAAGGGTGAAGG - Intergenic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
951575245 3:24106849-24106871 GTGGTGAAAGAGAAAGGGGAAGG + Intergenic
951802675 3:26613675-26613697 CTGGGAAGAGAGGAGAGGGATGG + Intergenic
951909099 3:27730604-27730626 CTGGGAAAAGATACGGGGGTAGG + Intergenic
952515987 3:34105122-34105144 ATGGGCCAGGAGAAGGGGGGGGG + Intergenic
952663574 3:35878534-35878556 CTGGGCACAGAGACTAGGGAGGG + Intergenic
952881913 3:37990836-37990858 CTGGGCAGAGAGTTGGGGGGCGG + Intronic
953022868 3:39127088-39127110 CTGGGCCTTGAGAAGGGAGAAGG - Intronic
953077251 3:39581980-39582002 CTGGGCACAGAGACTAGGGAGGG + Intergenic
953196550 3:40739516-40739538 CAAGGCAAAGAGGAGAGGGAAGG - Intergenic
953443128 3:42936760-42936782 CGGGTCAAAGACAAGGGGGCTGG - Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
953860648 3:46541506-46541528 AAGGGCAAAGAGAAAGGGAAAGG + Intronic
953876550 3:46670006-46670028 CAGGGCAAAGCGTAGGGAGAGGG - Exonic
954370332 3:50166717-50166739 CTGGGCCCAGGGGAGGGGGAGGG + Intronic
954537510 3:51372343-51372365 CAGGGCAGAGGGCAGGGGGAGGG + Intronic
955756822 3:62233352-62233374 CTGGGGAGAGAGCATGGGGAAGG - Intronic
955849249 3:63202414-63202436 ATGGGAGAAGAGAAGGGGAAGGG + Intergenic
956541290 3:70342833-70342855 CTGGCCAAAGAAAAAGGGCAAGG - Intergenic
956686956 3:71838638-71838660 CAGGGCAACTAGAAGTGGGAGGG - Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
958766314 3:98372453-98372475 ATGGTCAAAGGGAAGGGGAAGGG + Intergenic
958899848 3:99872839-99872861 CTGGGCAAACAAAAATGGGAAGG - Intronic
959444394 3:106420511-106420533 ATAGGGAAAGAGAAGGGTGAGGG + Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960092058 3:113650818-113650840 CTGGGGAAAGAGAAAGGAGGGGG - Exonic
960902144 3:122564167-122564189 GTGGGCGGGGAGAAGGGGGACGG - Intronic
961001532 3:123377378-123377400 CTGGGCAAAGAAAGGTGGGGTGG - Intronic
961096427 3:124160412-124160434 CTGTGCAGAGAGAAGGGTGATGG + Intronic
961714195 3:128847568-128847590 CTGGGCAGGGAGGAAGGGGAAGG + Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
962290825 3:134134978-134135000 CTGGGCATGGAGCTGGGGGAGGG - Intronic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
962354358 3:134681069-134681091 CTGGGGAGAGCCAAGGGGGAGGG + Intronic
962403393 3:135080321-135080343 AGGGCCAGAGAGAAGGGGGAGGG + Intronic
962424516 3:135257987-135258009 CTAGTCAAAGAAAAGGGTGATGG - Intronic
962432299 3:135330470-135330492 CGAGGCAATGAGAAAGGGGAGGG - Intergenic
962847825 3:139286880-139286902 ATGGGCGGAGGGAAGGGGGAAGG - Intronic
963425097 3:145114475-145114497 CTGGGCACAGAGACTAGGGAGGG - Intergenic
963454067 3:145521733-145521755 CAGGGCAACTAGAAGGGGGGTGG + Intergenic
964310526 3:155386953-155386975 CTGGGAAAAGGGAAGTGGGGAGG + Intronic
964718529 3:159748554-159748576 CTGGGCACAGTGAAGGAGGGTGG - Intronic
965105345 3:164346335-164346357 CTGGGCACAGAGACTAGGGAGGG + Intergenic
965689798 3:171343451-171343473 CTGGGGAAAGAGAAGCCTGAAGG + Intronic
965863276 3:173172675-173172697 TTGGGCATAGAAAAGGGAGAAGG + Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966331746 3:178822378-178822400 ATGGGAATAGAGAAGAGGGAAGG - Intronic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966916613 3:184587770-184587792 CTTGGCAGAGAGAAGGAGAAAGG + Intronic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
967658229 3:192075264-192075286 CTGGGCACAGAGACTAGGGAGGG + Intergenic
967687800 3:192437856-192437878 GTGGGCAAAGAGTAGGAGGCAGG - Intronic
968215858 3:196889767-196889789 CTGGGCAAAAAGTAGAGGGAAGG + Intronic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
970041975 4:11807790-11807812 CTGGGCACAGAGACTAGGGAGGG - Intergenic
970549732 4:17167162-17167184 ATGGGCAAAGGCAAGGGGAAGGG - Intergenic
970652890 4:18197954-18197976 CTGGGAAAAGAGAATGGAGAGGG - Intergenic
970955835 4:21810361-21810383 TTGGGCAAAAAGAAGGTGGGAGG - Intronic
971146431 4:23981555-23981577 CTGACCAAAGAGAAGGGGCCAGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971454980 4:26835708-26835730 CAGGGCAAAGAATAGGGTGAAGG - Intergenic
973604285 4:52571204-52571226 CTGGGCAAGGAGAGAGGGCAGGG - Intergenic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
975732010 4:77346641-77346663 CTGGGCATAGAGCAGGGCAAAGG + Intronic
976204204 4:82609245-82609267 CTTGGCAAAGGCAACGGGGAAGG - Intergenic
976205618 4:82620772-82620794 TTGGACAATGAGAAGGGAGATGG + Intergenic
976842810 4:89451541-89451563 ATGGGGAAAGAGTAGGGGCAGGG + Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
978102337 4:104857551-104857573 CAGGGGAAAGATAAGGGGGTGGG + Intergenic
978486987 4:109265948-109265970 CTGAGAAAAGAGAAGGGCTATGG - Intronic
978721179 4:111911457-111911479 CTGCGGAGAGAGAAGGGAGATGG + Intergenic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979542791 4:121905273-121905295 CTGGGCCAAGGGTAGGGAGAAGG + Intronic
979999246 4:127469446-127469468 CTTGGTAAAAAGAAGAGGGAGGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981618991 4:146672692-146672714 CTGGGAAAAAAGCAGAGGGAGGG + Intergenic
981720635 4:147797929-147797951 CAGGACAAAGAGGAGAGGGATGG - Intronic
981952187 4:150422894-150422916 CTGAACCAAGAGAAAGGGGATGG + Intronic
981993522 4:150953375-150953397 CCGTGCAAAGAGGGGGGGGAGGG - Intronic
981994664 4:150963174-150963196 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
982117230 4:152107746-152107768 CTGGACAAAAGGAAGGGGCAGGG + Intergenic
982181678 4:152753600-152753622 GTGGGCAAAGAGGAGTGGGAAGG + Intronic
982497226 4:156107650-156107672 CTGGGCACAGAGACTAGGGAGGG + Intergenic
982710691 4:158755956-158755978 CAGGCCAGAGAGGAGGGGGAGGG - Intergenic
984133343 4:175905536-175905558 CTGGCACAAGAGAAGGGAGAAGG + Intronic
984276173 4:177612628-177612650 CTGGGCAAAAGGAACTGGGAAGG + Intergenic
984488828 4:180406439-180406461 ATGGTCAGAGAGAAGGAGGAAGG + Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
984724745 4:183009876-183009898 CTGGGCAAAGGGAAGAGGAGAGG - Intergenic
984748887 4:183252833-183252855 ATTGCCAAAGAGAAGGGGCAGGG - Intronic
985448373 4:190041129-190041151 CTGCGGCAAGAGCAGGGGGACGG - Intergenic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985790920 5:1926471-1926493 CTGGGACAAGAGCAGGGGAAGGG - Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
986193422 5:5517098-5517120 CTGGGCACAGAGATGAGGAAGGG - Intergenic
986210187 5:5664760-5664782 ATGGCCAAGGAGAAGAGGGAGGG + Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986596599 5:9429236-9429258 CTTGGCTAAGAGAAGAGGAATGG - Intronic
986773519 5:10994377-10994399 CCGGGGAAAGAGGAGGGGGGCGG + Intronic
986872678 5:12068414-12068436 TTGGGTAAAGGGAAGGGGAAGGG + Intergenic
987281921 5:16421534-16421556 CTGGGCACAGAGACTAGGGAGGG - Intergenic
987487390 5:18539849-18539871 CTGGGCACAGAGACTAGGGAGGG - Intergenic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988728893 5:33950565-33950587 CTAGGTAAAGGGAAGGGGAAGGG + Intronic
988773188 5:34452048-34452070 GTGGGGAAATAGAAGGGTGAAGG - Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
988913457 5:35869263-35869285 CTCTGCTAAGAGAAGTGGGAAGG - Intronic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
989116635 5:37960534-37960556 CTGGGCAAAGAGCTTGGAGAAGG + Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989663631 5:43825349-43825371 CCGTGCAAAGGGTAGGGGGAGGG + Intergenic
989809233 5:45652808-45652830 CTGGGCAGAGAGAAGAGTCAGGG - Intronic
990846735 5:60148943-60148965 CAGGGCAAAGTAAAGGGAGATGG + Intronic
991329847 5:65482187-65482209 CTTGGAAAAATGAAGGGGGAGGG + Intergenic
991985726 5:72284487-72284509 ATGGAAAAAGAGAAGGGGGGAGG + Intronic
992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG + Intergenic
992424608 5:76643840-76643862 GTGGGCCAAGAGGAAGGGGATGG + Intronic
992457502 5:76929233-76929255 CATGGCAGAGAGAAGGGTGAAGG + Intergenic
992830699 5:80590698-80590720 CAGGGCAAGGAGAAAGGTGATGG + Intergenic
992888813 5:81185304-81185326 CTGGGCAAAGTGAAGAGTGGTGG + Intronic
993499756 5:88651989-88652011 CTGAGCAAAGGGAAGGGGTCAGG - Intergenic
994324317 5:98431774-98431796 GGGGGCAAAGAGATGGGGGTAGG - Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995555093 5:113319545-113319567 CTGGACCAAGAGAAGATGGAAGG + Intronic
995899487 5:117050550-117050572 CTGGGCACAGAGACTAGGGAGGG + Intergenic
996457111 5:123697189-123697211 ATGGGCAAAGAGAAAGAGAATGG + Intergenic
996496361 5:124161689-124161711 ATGGTCCAAGAGAAGGGAGATGG - Intergenic
996509788 5:124305301-124305323 CTGGGCACAGAGACTAGGGAGGG - Intergenic
996702512 5:126464588-126464610 TTGGTAAAAGAGAAGGTGGAAGG - Intronic
997518301 5:134506234-134506256 CTGGGCACAGGGAAGAGGGCTGG - Intergenic
998005333 5:138653202-138653224 CTGGGGCAAGAGAAGGGTGAAGG - Intronic
998158955 5:139802288-139802310 CTGGGCAGACAGAAGGGAGGAGG + Intronic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
999154802 5:149450559-149450581 CTGGGCACAGAGAGGAGAGAAGG + Intergenic
999195002 5:149775819-149775841 GTGGAGAAAGAGAAGGGGGTAGG - Intronic
999262614 5:150247071-150247093 CTTTGCAGAGAGAAGGGGAAGGG - Intronic
1000071451 5:157744102-157744124 GTGGCCAAAGAGGAAGGGGACGG + Exonic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1000675662 5:164119828-164119850 TTGGGCAAAAAGCAGGGGAAAGG + Intergenic
1000736947 5:164915413-164915435 TTGGGCAGAGAGTAGGAGGAAGG + Intergenic
1001106080 5:168855807-168855829 TTAGGCAAAGAGAGTGGGGACGG - Intronic
1001106179 5:168856568-168856590 TTAGGCAAAGAGAATGAGGACGG + Intronic
1001331569 5:170766201-170766223 CTGGGCACAGAGACTAGGGAGGG + Intronic
1001437530 5:171711894-171711916 GTTTGCAAAGAGAAGGGAGACGG + Intergenic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1003193768 6:3896870-3896892 CTGGCCAAAGAGAAAGGGACAGG - Intergenic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1004106143 6:12668910-12668932 CTGGGCACAGAGACTGGGGAGGG - Intergenic
1004631669 6:17427235-17427257 CTGGGAAAAGATAAGGGAGAGGG + Intronic
1004768698 6:18758249-18758271 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1004855373 6:19744140-19744162 CAGGGCAAAGAAAAGTGGGTAGG + Intergenic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006801058 6:36759847-36759869 ATGGGCAGAGGGAAGGGGCAGGG + Intronic
1007042123 6:38732394-38732416 CTTAGCAAAGAAAAAGGGGAGGG + Intronic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1009343491 6:62587469-62587491 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1013273161 6:108560789-108560811 CGGGGCGGGGAGAAGGGGGAGGG - Intronic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014747227 6:125214240-125214262 CTGGGCACAGAGAAGGGTAGAGG + Intronic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015119137 6:129682298-129682320 CTTGGCAAAGAGAAAGGCGTGGG - Intronic
1015570977 6:134621212-134621234 CTAGGCAAAGAAGAGGGAGAAGG - Intergenic
1015802679 6:137076664-137076686 CTGGGCACAGAGATGGCTGAGGG - Intergenic
1016154334 6:140784825-140784847 ATGGGAAAAGACAAGGGGGAAGG + Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017388757 6:153914913-153914935 CTGGGCAAGGACTAGGGGCAGGG + Intergenic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1018205733 6:161435956-161435978 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205744 6:161435983-161436005 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205755 6:161436010-161436032 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019635368 7:2072752-2072774 CTGGCCAGAGAGAAGGGTAAGGG + Intronic
1020129288 7:5550483-5550505 CAGGGCAGAGAGAAAGGGGTAGG - Intronic
1020201922 7:6086675-6086697 AAGGGGAAAGGGAAGGGGGAAGG - Intergenic
1020209786 7:6150060-6150082 CTGGGCAAGGAGAATGGGATTGG + Exonic
1020577731 7:9955454-9955476 CTGGGGAAAGAAAAGGGAGAAGG + Intergenic
1021131386 7:16916585-16916607 CTGAGCCAAGAAAAGGGAGAAGG + Intergenic
1021510417 7:21427687-21427709 CTGGGAAATGAGTAGGGGGCGGG + Intergenic
1021530586 7:21640638-21640660 CTGGGCAAAGAGACTCGGCAGGG - Intronic
1022289416 7:28986582-28986604 GTGGGTAAAGAGAACAGGGAAGG + Intergenic
1022482366 7:30752436-30752458 CTGCCCAAAGAGAGGGGGCAGGG - Intronic
1022643853 7:32212783-32212805 ATGGGCAAAGATCTGGGGGATGG - Intronic
1023242982 7:38168673-38168695 CCTGGCTAAGAGAAAGGGGATGG + Intergenic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1024249547 7:47495874-47495896 CTCGGCAGAGGGAAGGGGTAAGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024665977 7:51547727-51547749 CTTGGTAAAGAGAAAGGGTAAGG - Intergenic
1026228364 7:68462663-68462685 CTGGGGAAAGAGGAGGGGAGGGG - Intergenic
1026772391 7:73210838-73210860 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1026815130 7:73505043-73505065 CTGGCAAGAGAGAAGAGGGAGGG - Intronic
1027013259 7:74764237-74764259 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1027074781 7:75181797-75181819 ATGGGGAAAGAGGAAGGGGACGG - Intergenic
1027218362 7:76198557-76198579 CTGGGCAAAGGAAGAGGGGAGGG + Intergenic
1027465202 7:78506538-78506560 CTGGTAAAAGAGAAGAGGAAAGG + Intronic
1028638340 7:93016043-93016065 CCCAGCAAAGGGAAGGGGGAGGG - Intergenic
1028690059 7:93641390-93641412 CTGGGCACAGAGACTAGGGAGGG - Intronic
1028920949 7:96309554-96309576 CATGGCAAAGTAAAGGGGGAAGG - Intronic
1029419976 7:100467371-100467393 CTGGGCAAAGTCAAGGGTGGAGG + Intronic
1029917824 7:104230661-104230683 CTGACCAAAGAGGAGGGGGCAGG + Intergenic
1030675919 7:112385166-112385188 CTGGGCATAAAGAAGGGAGTGGG - Intergenic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031364864 7:120889828-120889850 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1031422578 7:121568199-121568221 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1031881704 7:127205800-127205822 CTGGGTGAAGAGAAAGGTGAAGG - Intronic
1031967525 7:128037764-128037786 ATGAGCCAAGAGAAGGGGGCAGG + Intronic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1032842507 7:135725494-135725516 TTGGGCAAGAAAAAGGGGGAAGG + Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1034446806 7:151117868-151117890 CTGGGAAAAGAGTAGGGGCTTGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035138284 7:156729767-156729789 TTGGGAAAATAGAAGGGGGCTGG - Intronic
1035389934 7:158497187-158497209 AGGGGCACAGGGAAGGGGGAAGG - Intronic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036405458 8:8450896-8450918 ATGGGAGATGAGAAGGGGGAGGG + Intergenic
1036462153 8:8962986-8963008 CTGGGCAAAGAGAGGATGCATGG + Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037116534 8:15236100-15236122 CTGGGCAAAGGGAAGTAGGGAGG - Intronic
1037584914 8:20269648-20269670 ATGGGCAAGGAGAAGGGGAGTGG + Intronic
1037860064 8:22398776-22398798 CTGGACCAAGTGAAGGGTGACGG + Intronic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1039920180 8:41888220-41888242 CTTGGGAAAGAGGAGGGGGACGG - Intronic
1040101180 8:43507345-43507367 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1041342753 8:56863399-56863421 GGGGAAAAAGAGAAGGGGGAGGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041720033 8:60967432-60967454 CTTGGCAGAGGGAAGGGGAACGG + Intergenic
1042816904 8:72887826-72887848 CTGGGCAGAGAGAAAGTGTAGGG - Intronic
1042817562 8:72894297-72894319 CTGGTCAAGGTGGAGGGGGAAGG + Intronic
1043097902 8:75999191-75999213 ATGGGGAAAGACAAGGTGGAAGG - Intergenic
1043766856 8:84146368-84146390 CTGGACAGAGGGAGGGGGGAAGG + Intergenic
1044002415 8:86899957-86899979 ATGGGCAGAGAGGAGGGGTAGGG - Intronic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044992221 8:97806351-97806373 CTGGGGATAGAGAACAGGGAAGG + Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045423894 8:102043737-102043759 ATGGGGAAAGGGAAGGGGAAGGG + Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045649585 8:104329575-104329597 CTGGGCACAGGGAAGGGGTGTGG + Intergenic
1045757077 8:105556670-105556692 GGGGGAAAAGGGAAGGGGGAAGG - Intronic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1047410663 8:124621843-124621865 CTGGGGAAAGAGATAGGGGCTGG - Intronic
1047494746 8:125401641-125401663 CCAGGCAAAGAGACGGGGAACGG - Intergenic
1048055002 8:130854899-130854921 GGGGGAAAAGAAAAGGGGGAGGG - Intronic
1048259345 8:132932378-132932400 CTGGGCAAATACAGGGGGAAGGG + Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1048842379 8:138577285-138577307 CCTGGCAAAGAGAAGAGGGGAGG - Intergenic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1048935917 8:139356994-139357016 CTGGGCAGAGAACAGGGTGAAGG - Intergenic
1049154230 8:141057092-141057114 TGGGGCAGAGAGAAGGGGGTGGG - Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1050137462 9:2481803-2481825 CTGGAAAAAGGGAAGGGTGAGGG - Intergenic
1050309719 9:4340495-4340517 CCGGGCAAGGAGAACAGGGATGG - Intronic
1050574126 9:6975017-6975039 CTATGCAAAAAGAAGGGGAATGG - Intronic
1051735884 9:20198690-20198712 TTGGGGAGAGAGAAGGGGGTGGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053145429 9:35708485-35708507 CTGGGAAGAGAAAAGGGGGTGGG + Intronic
1053313249 9:37032663-37032685 GAGGGCACAGAGATGGGGGAAGG + Intronic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1053791198 9:41687424-41687446 GTGGGCAATGAGAAGAGGGCAGG + Intergenic
1054153955 9:61627348-61627370 GTGGGCAATGAGAAGAGGGCAGG - Intergenic
1054179546 9:61899118-61899140 GTGGGCAATGAGAAGAGGGCAGG + Intergenic
1054473740 9:65558468-65558490 GTGGGCAATGAGAAGAGGGCAGG - Intergenic
1054657992 9:67681703-67681725 GTGGGCAATGAGAAGAGGGCAGG - Intergenic
1054745771 9:68852616-68852638 CAGGGCACAGAGCAGGGTGAAGG + Intronic
1054784925 9:69201363-69201385 CCTGACAAAGAAAAGGGGGAGGG - Intronic
1055131940 9:72785709-72785731 CTGGGCAGGGTGAAGTGGGAAGG + Intronic
1056164135 9:83925316-83925338 CTGAGAAAAAAAAAGGGGGAGGG + Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056587162 9:87936188-87936210 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1056609713 9:88116755-88116777 CTGGGAAATAAGAACGGGGATGG + Intergenic
1056925218 9:90828709-90828731 GTGTGCTCAGAGAAGGGGGAAGG - Intronic
1057292462 9:93815355-93815377 CTGGGCACAGATAAGAAGGAGGG - Intergenic
1057374187 9:94503689-94503711 ATAGGCAAGGAAAAGGGGGAGGG - Intergenic
1057414166 9:94846603-94846625 CTGGGCAAAGAGAAAGAAGCTGG + Intronic
1059054082 9:110960442-110960464 CTGGGCAAAGAGGAGGCTAATGG + Intronic
1059269127 9:113061204-113061226 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059270263 9:113066653-113066675 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059271399 9:113072103-113072125 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059272530 9:113077547-113077569 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059273665 9:113082989-113083011 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059274801 9:113088435-113088457 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059915128 9:119091083-119091105 CTGGACAAAGATGAGAGGGAGGG - Intergenic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060943763 9:127558047-127558069 CCAGGAAAAGAGGAGGGGGAAGG - Intronic
1061189043 9:129071156-129071178 CTGGGCTCATGGAAGGGGGATGG - Exonic
1061498701 9:130990248-130990270 CTGGCCCAAGAGCACGGGGAGGG - Intergenic
1061546617 9:131308325-131308347 CTGGCCCTAGAGAAGGGGCAGGG + Exonic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1061848259 9:133400286-133400308 GTGGGTGAATAGAAGGGGGAAGG - Intronic
1061923617 9:133795382-133795404 CTGGGGGAAAAGCAGGGGGAGGG + Intronic
1061935139 9:133853318-133853340 CTCGGCCAAGAGAGGGTGGAAGG + Intronic
1062443450 9:136583698-136583720 CTGGGCAAAGGCCAGGGGGCAGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062510939 9:136905655-136905677 CTGGGAACAGAGAAAGGGAATGG - Intronic
1062596186 9:137300813-137300835 CGGGGAGAAGGGAAGGGGGAGGG + Exonic
1062727037 9:138080255-138080277 CTGGGGACAGAGGAGGGTGAGGG + Intronic
1203768183 EBV:37235-37257 CCGGGGACAGAGCAGGGGGAGGG + Intergenic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1203548114 Un_KI270743v1:144594-144616 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186225324 X:7393064-7393086 CTGGGAAAAGAGGAAGGGAAAGG - Intergenic
1186632929 X:11369749-11369771 CTGGGCAGAGAAAACGGGGGAGG - Intronic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187707088 X:22019678-22019700 ATGTGAAAAGAGAAAGGGGATGG + Intergenic
1189353326 X:40293599-40293621 CCAGGAAAAGAGAAGGGGGTCGG + Intergenic
1189551259 X:42095978-42096000 CTCTGCAAAGAGCAGGGAGAAGG + Intergenic
1190246069 X:48691213-48691235 GTGGGCACAGAGCAGGTGGAGGG - Exonic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1191996390 X:67100211-67100233 CTGGGTAAATATAAGGGTGAGGG + Intergenic
1192843339 X:74880381-74880403 ATGGCCTAAGAGAAGAGGGAAGG + Intronic
1193783650 X:85733840-85733862 CTGGTCAAAGAAAGGGGTGATGG + Intergenic
1193885816 X:86983332-86983354 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1194503103 X:94703002-94703024 TTGGGCACAGAGACTGGGGAGGG + Intergenic
1194736203 X:97515284-97515306 CTGGTCAAAGAAAGGGGTGACGG - Intronic
1195134197 X:101887444-101887466 CTGGTCAAAGATAAAGTGGAAGG - Intronic
1195543635 X:106090153-106090175 CTGGTCAAAGATCAGGTGGATGG - Intergenic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1198598335 X:138260312-138260334 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1199351722 X:146809939-146809961 TGGGGCAAAGAGAAGGGGTTTGG - Intergenic
1199352185 X:146814554-146814576 TGGGGCAAAGAGAAGGGGTTTGG + Intergenic
1199532614 X:148867376-148867398 CTGGTAAAAGAGATGAGGGAAGG + Intronic
1199712269 X:150477734-150477756 GTGGGCAGAGAGGAGGGGGAAGG + Intronic
1199713352 X:150488127-150488149 CTTCCCAGAGAGAAGGGGGAGGG - Intronic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200089732 X:153628818-153628840 CAGGGCCAAGAGCCGGGGGAGGG + Intergenic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201463597 Y:14255652-14255674 ATGGTCAAAGAGCAGGGGGAGGG - Intergenic
1201479825 Y:14427608-14427630 GTGGGGAAAGAGCAGGGAGATGG + Intergenic