ID: 1006203112

View in Genome Browser
Species Human (GRCh38)
Location 6:32314442-32314464
Sequence TTGCACATGGGCCATATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006203112_1006203115 -9 Left 1006203112 6:32314442-32314464 CCAATTATATGGCCCATGTGCAA 0: 1
1: 0
2: 0
3: 13
4: 82
Right 1006203115 6:32314456-32314478 CATGTGCAAACATAGACATCTGG No data
1006203112_1006203116 12 Left 1006203112 6:32314442-32314464 CCAATTATATGGCCCATGTGCAA 0: 1
1: 0
2: 0
3: 13
4: 82
Right 1006203116 6:32314477-32314499 GGAATTTCCAGCTTCATTTCTGG 0: 1
1: 0
2: 0
3: 25
4: 217
1006203112_1006203117 13 Left 1006203112 6:32314442-32314464 CCAATTATATGGCCCATGTGCAA 0: 1
1: 0
2: 0
3: 13
4: 82
Right 1006203117 6:32314478-32314500 GAATTTCCAGCTTCATTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006203112 Original CRISPR TTGCACATGGGCCATATAAT TGG (reversed) Intronic
909058346 1:70849057-70849079 TTGCACATGTCCAATATAAGAGG - Intergenic
909809465 1:79913717-79913739 TTGCACATGAGACATACGATGGG - Intergenic
913441891 1:118907113-118907135 TTCCACTTGGGCCCTATCATGGG + Intronic
914263774 1:146020496-146020518 TTGCACAAGGGCCCTAAAAGTGG - Intronic
915674128 1:157515151-157515173 GTGCACATGGGACATGTGATGGG - Exonic
915920084 1:159969562-159969584 TTGCAGATGGGCAAAACAATGGG + Intergenic
916230730 1:162538897-162538919 ATACACATGCCCCATATAATAGG + Intergenic
916346755 1:163800927-163800949 TTGCACCTGGCTCATATAAGTGG + Intergenic
916369784 1:164079442-164079464 TTTGACATGGTCCCTATAATTGG - Intergenic
917922252 1:179760294-179760316 TTACACATTGGGCATACAATGGG - Intronic
918261124 1:182797301-182797323 TGGTCCATGGGCCATATGATGGG - Intronic
921601109 1:217107720-217107742 ATGCACAAGGGCCATAGGATTGG + Intronic
924805728 1:247360125-247360147 TTGCAAATGGACCATTTAAAAGG - Intergenic
1067154255 10:43762720-43762742 TTGCACATGGTGCATGGAATGGG + Intergenic
1068258731 10:54549564-54549586 TTAAAAATGGGCCATATACTAGG - Intronic
1078454831 11:11466915-11466937 TTGCACATAAGCCAAGTAATGGG - Intronic
1078605130 11:12768546-12768568 TTGCACATGGCCAATATAAATGG + Intronic
1079681640 11:23304447-23304469 TTGCAGATGGGCCATGTGATAGG + Intergenic
1081404333 11:42679084-42679106 TTGCAGAGGGGCCATAGAAGAGG - Intergenic
1085977769 11:81680425-81680447 TTACACACAGGCCATATATTTGG + Intergenic
1088226675 11:107627936-107627958 TTGCACATGGAACAGATATTAGG + Intronic
1090168541 11:124577727-124577749 TTACACAGGGTCCATGTAATTGG + Intergenic
1095200216 12:39375565-39375587 TTGCACAGCAACCATATAATAGG + Intronic
1099479068 12:83143741-83143763 TTGCACAGGGGCTATTTTATTGG - Intergenic
1100690778 12:97036636-97036658 TGTCAGATGGACCATATAATGGG - Intergenic
1106044884 13:26129684-26129706 TTGGACATGGGCAATATTCTTGG + Intergenic
1106194570 13:27482167-27482189 TTTCACAAGGGCCAAAGAATTGG - Intergenic
1113405500 13:110035356-110035378 TTGTAGATGGGGCATATAAGGGG + Intergenic
1114878881 14:26759164-26759186 TTGCAAATGGTGCATATGATAGG + Intergenic
1115189703 14:30733971-30733993 TGGTATATGGGTCATATAATTGG - Intronic
1126332728 15:47550937-47550959 GTGCACATTTGCCATAAAATAGG + Intronic
1127052981 15:55104018-55104040 GTGCACATGGGCACCATAATGGG - Intergenic
1127740079 15:61894947-61894969 CTGCACATGGCCCATATGGTAGG + Intronic
1130154052 15:81334406-81334428 TTCCACAGTGGCCATATTATTGG - Intronic
1130637829 15:85642044-85642066 TTACATATGGGTCATAAAATGGG + Intronic
1138950952 16:61912254-61912276 TTTCATTTGGGCCATAAAATAGG + Intronic
1150965025 17:69958455-69958477 TTCCACATGTGCCCTTTAATAGG - Intergenic
1154373606 18:13789960-13789982 TTGTAGTTGGGCCATATACTTGG + Intergenic
927743858 2:25597750-25597772 TTGCACTTGGACCACATAATAGG - Intronic
928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG + Intronic
931936750 2:67206710-67206732 TGACACATGGGTCATATAATTGG - Intergenic
933455315 2:82512250-82512272 TTGCGTATGTGCCAAATAATGGG - Intergenic
938840221 2:135154044-135154066 TTGCAAATAGGGCAAATAATAGG + Intronic
940693377 2:156947826-156947848 TTGAAGAAGGCCCATATAATAGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946569592 2:221008740-221008762 TTATACATGGACCATATATTGGG + Intergenic
1172841449 20:37904679-37904701 TTGCACAAAGGCCAGATAATTGG + Intronic
1175236757 20:57518774-57518796 TTGCACATGGAACATTTAAAGGG + Exonic
1175617849 20:60417757-60417779 TTCAACATAGACCATATAATAGG - Intergenic
1178043150 21:28663557-28663579 TTGCCGATGGGCCATGTGATGGG - Intergenic
1179504982 21:41834332-41834354 TCGCACATGGGCCATGTGAGAGG - Intronic
1183000398 22:34852637-34852659 TTTCACATGAGACATGTAATTGG + Intergenic
949344590 3:3065067-3065089 ATGCACATGGGCCATATGGGCGG + Intergenic
953624033 3:44555909-44555931 GTGCACATGGCACACATAATTGG - Intronic
959209228 3:103355282-103355304 TTGTACAAGGGTCATTTAATAGG + Intergenic
963883214 3:150551305-150551327 TTGAACATTGGCGAAATAATAGG - Intronic
965880727 3:173384870-173384892 TCGAAAATTGGCCATATAATTGG + Intergenic
969675594 4:8612678-8612700 CTGCACAGGAGCAATATAATGGG + Intronic
971596079 4:28530632-28530654 TTTCTCATGGGCCAAATGATAGG + Intergenic
976228962 4:82820720-82820742 TTGTAACTGGGCCATATAAAAGG + Intronic
977031603 4:91891242-91891264 TGCCACTTGGGCCATATGATCGG + Intergenic
977112263 4:92973110-92973132 TTGCACATGTGCCAAGTAATGGG + Intronic
978950233 4:114549364-114549386 TTTCACATGGGCTTTTTAATTGG + Intergenic
988248582 5:28723497-28723519 TTGCACATGGCAAATATATTGGG + Intergenic
988248756 5:28726219-28726241 TTGCACATGGCAAATATATTGGG - Intergenic
994301479 5:98153248-98153270 TTGCACAGAAGCCATATAATTGG + Intergenic
995405662 5:111792554-111792576 TTGCACATGGGTCCTGTAAAAGG - Intronic
999015761 5:148103004-148103026 TGGCACATGGGAAATAAAATGGG - Intronic
999841940 5:155437615-155437637 TTGCACTTTGGGCATGTAATGGG - Intergenic
999844100 5:155459403-155459425 TTGCACATCAGCCATTTACTAGG - Intergenic
1003190396 6:3869545-3869567 TTTCACCTGGGCCAGATAATGGG + Intergenic
1003485628 6:6575550-6575572 TTCCACATGGGCGATGTGATGGG - Intergenic
1004441118 6:15655488-15655510 TGGCACATTGGCCATTTATTTGG - Intronic
1006203112 6:32314442-32314464 TTGCACATGGGCCATATAATTGG - Intronic
1006954297 6:37853703-37853725 TTGCTCATGAGCAATGTAATAGG + Intronic
1014772776 6:125475891-125475913 TTTCACATGTGCCAGGTAATTGG + Intergenic
1024320935 7:48068521-48068543 TTGGCCATAGGCCATATAATAGG - Intergenic
1030325973 7:108218435-108218457 TTGAAGATGGACCATATGATAGG + Intronic
1033535198 7:142305936-142305958 TTGAACATGGGTCATATTTTTGG - Intergenic
1034405384 7:150899343-150899365 ATGGACATGGGACATATATTTGG - Intergenic
1036810511 8:11865165-11865187 TTCCACATGGTCCATGTAAAGGG - Intronic
1044085051 8:87933928-87933950 TTGGGCATGGGCAATATAAATGG + Intergenic
1044752059 8:95425882-95425904 TTACACATGGGCTATATACTTGG - Intergenic
1044998163 8:97856771-97856793 GTGCCCATGGCCCATATAAAAGG + Intergenic
1046291475 8:112167564-112167586 TTGCACATGGGCCTTTTCTTTGG + Intergenic
1047003335 8:120594775-120594797 TTGCACATGAGCTATAGAAAGGG - Intronic
1052569561 9:30201926-30201948 TTTCACATTTGCCATATAATAGG - Intergenic
1186590396 X:10924617-10924639 TTGCCCCTGGGTCATATAACTGG - Intergenic
1186590517 X:10925379-10925401 TTGCCCCTGGGTCATATAACTGG + Intergenic
1189576524 X:42359514-42359536 GTGCACCTGGTCCAAATAATTGG + Intergenic
1189617107 X:42795079-42795101 TTGCACAGGAGCCATGTATTTGG + Intergenic
1196674019 X:118400295-118400317 TTGCAGGTGGGCCATACTATTGG - Intronic
1197059973 X:122166035-122166057 TTTCACATGGGCTTTTTAATTGG + Intergenic
1199366161 X:146986426-146986448 TTGCAAATGGGTGATATAATGGG + Intergenic
1199392901 X:147302213-147302235 AGGCACATGAGCCATATCATTGG - Intergenic
1201017867 Y:9623935-9623957 GTGCACATGGGTCATCGAATGGG - Intergenic