ID: 1006205085

View in Genome Browser
Species Human (GRCh38)
Location 6:32333623-32333645
Sequence AACAGCTATCCCTCTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006205085_1006205090 14 Left 1006205085 6:32333623-32333645 CCCACAGCAGAGGGATAGCTGTT 0: 1
1: 0
2: 2
3: 16
4: 131
Right 1006205090 6:32333660-32333682 CAAACTGTGCTTCCTCCCTTAGG No data
1006205085_1006205087 -9 Left 1006205085 6:32333623-32333645 CCCACAGCAGAGGGATAGCTGTT 0: 1
1: 0
2: 2
3: 16
4: 131
Right 1006205087 6:32333637-32333659 ATAGCTGTTAATGCCCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006205085 Original CRISPR AACAGCTATCCCTCTGCTGT GGG (reversed) Intronic
900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG + Intronic
901153266 1:7118522-7118544 AACAGCCATCCCACTCTTGTGGG - Intronic
903176357 1:21583801-21583823 AAAAGAAATCCCTGTGCTGTGGG - Intergenic
904577499 1:31514369-31514391 GTCAGCTCTCCCTCTGCTGGTGG - Intergenic
905420695 1:37841462-37841484 AACTGCTATACCTCTGCCATGGG + Intronic
908739415 1:67311329-67311351 AACTGCTTTCCCTCTTCTATCGG - Intronic
909905434 1:81189235-81189257 AACATTTATCGCCCTGCTGTGGG - Intergenic
911721770 1:101198829-101198851 CACAACTATCCCTCAGTTGTTGG - Intergenic
912144809 1:106780405-106780427 GACAGCTATCCCTCAGATGCAGG - Intergenic
913073757 1:115323929-115323951 ACCAGGCATCCCTCTCCTGTGGG + Intronic
915725268 1:158012879-158012901 CACAGCTAACCCTTTGTTGTGGG + Intronic
916500676 1:165384230-165384252 CACACCTTGCCCTCTGCTGTGGG - Intergenic
918385790 1:184005960-184005982 AAAAGCTCTTCCCCTGCTGTTGG + Intronic
919587975 1:199463090-199463112 TACAGTTATCCAACTGCTGTGGG - Intergenic
920053469 1:203176952-203176974 AACAGCTGTCCCTCAACAGTGGG + Intergenic
923165314 1:231356010-231356032 AAATGCTATCCCCCTGCTGTGGG + Intergenic
1063488978 10:6446160-6446182 CACAGTTATCCCTCTCCTATAGG + Intronic
1065181990 10:23135714-23135736 CACTGCTAACCCTCTGCTATTGG - Intergenic
1065812437 10:29454756-29454778 AATATCTGTCCCTTTGCTGTCGG + Intergenic
1065959208 10:30720472-30720494 AATATCTGTCCCTTTGCTGTCGG - Intergenic
1067168872 10:43888177-43888199 AACAGTTAACTCTCTTCTGTGGG - Intergenic
1071508988 10:86249622-86249644 AACAGCTATCTTCCTGTTGTGGG - Intronic
1078564163 11:12399314-12399336 AAGAACTGCCCCTCTGCTGTAGG - Intronic
1080803285 11:35628989-35629011 CACACCTATCACTCTGCTTTTGG + Intergenic
1081533614 11:43982041-43982063 AACAGCTCCCCCTCTGCTCCAGG - Intergenic
1081686102 11:45044188-45044210 CACAGCTAAGCCTCTGTTGTTGG - Intergenic
1084544307 11:69806718-69806740 TACATCCATCCCTCTGCTGATGG + Intergenic
1086470993 11:87110114-87110136 ACCAGCTATACCTCTACAGTGGG - Intronic
1089300958 11:117498316-117498338 AACAGCCGTCCCTCAGCTCTAGG + Intronic
1089332449 11:117699421-117699443 AACACCAACCCCTCTGCTCTGGG - Intronic
1090108956 11:123884192-123884214 ATCAGGTATCTCTCTGCTCTGGG - Exonic
1091761278 12:3088815-3088837 AACAGCTCACCCTCTCCTGCAGG - Intronic
1091875270 12:3928536-3928558 AAGGGCAATCCCTCTGCTCTGGG + Intergenic
1093598424 12:20990782-20990804 AATAGTTATCCCTCAGCTTTTGG + Intergenic
1097105496 12:56620881-56620903 AACAGCTACTCCTCAGCAGTAGG + Intronic
1098932196 12:76431909-76431931 AACATGTATTCTTCTGCTGTTGG - Intronic
1103482735 12:121261420-121261442 AACTGCTATCTCTCTTCTTTGGG + Intronic
1104801145 12:131555961-131555983 AACAGCTGTCCCACTCCTGATGG - Intergenic
1106009921 13:25810102-25810124 AACAGCTTTCCTTCAGCTTTTGG + Intronic
1106586005 13:31056563-31056585 GACAGCTGTCCTTCTGCTGATGG + Intergenic
1109299368 13:60574990-60575012 AACACCTCTCCCTCTCCTCTTGG - Intergenic
1110750103 13:79103569-79103591 AACTGCTATCCCTGTGGTGTTGG + Intergenic
1113900390 13:113793680-113793702 GACAGCTCTTCCTCTGCTGAAGG + Intronic
1121725173 14:96142073-96142095 CACTGCTATCCCACTGCAGTGGG + Intergenic
1126950210 15:53872544-53872566 AACAGTTGTCCCTGTGGTGTAGG + Intergenic
1128455959 15:67831569-67831591 CACATCTATCCCTCTGGAGTTGG + Intronic
1129123610 15:73419203-73419225 AATGGCTATCTCTCTGCTGCAGG + Intergenic
1130660634 15:85829173-85829195 AACAGCCATCCATGTGCTGTAGG + Intergenic
1130911310 15:88272686-88272708 CACAGCTCTGCCTCTCCTGTTGG - Intergenic
1131123595 15:89838993-89839015 ACCAGATAATCCTCTGCTGTGGG + Intronic
1131937953 15:97527926-97527948 AACAGTTATTCTTCTGCTTTGGG - Intergenic
1133699531 16:8296034-8296056 AACAGCTATAACTCTTCTGTTGG + Intergenic
1134771809 16:16815622-16815644 AAGAGCAATCCTTCTGCTGTTGG + Intergenic
1135856509 16:26016026-26016048 GGCAGCTATCTCTTTGCTGTTGG - Intronic
1136144195 16:28306208-28306230 CACAGCTGTGCCGCTGCTGTGGG + Intronic
1139046005 16:63061097-63061119 AACAGCTAAATCTCTGCTGTTGG + Intergenic
1143700966 17:8659809-8659831 ACCAGCTATCCCTCTGTTGTGGG + Intergenic
1148824896 17:50385426-50385448 AACAGCCATCCTTCTGCTCCTGG + Intronic
1152171404 17:78751759-78751781 TACAGGTATCTCTCTGCTATTGG + Intronic
1152572418 17:81126653-81126675 AGCTGCTGTCCCTCAGCTGTGGG - Intronic
1154004353 18:10514129-10514151 CCCAGCTTTCCCTGTGCTGTTGG + Intergenic
1156075672 18:33275814-33275836 AACAGAAATCCCTCTGTTTTAGG - Intronic
1157305307 18:46512566-46512588 ATCAGCTATCTCTGGGCTGTGGG + Intronic
1157332463 18:46713824-46713846 AACAGATGCCCCTCTGCCGTAGG + Intronic
1164868240 19:31622959-31622981 ATCACCTCTCCCTCTGCTGCTGG + Intergenic
1165259420 19:34599217-34599239 ACCATAGATCCCTCTGCTGTGGG - Intronic
1167820863 19:51926747-51926769 AAGGGCCTTCCCTCTGCTGTAGG - Intronic
926909623 2:17839678-17839700 AACAGCTGTCGCACTGCTGATGG - Intergenic
930101201 2:47604729-47604751 AAAAGCTATTCCTCTCCTATAGG - Intergenic
932802349 2:74752121-74752143 CCCAGCTGTCCCTCTGCTGTGGG + Intergenic
933059591 2:77720917-77720939 AAAAGATATCCCTCTGATTTAGG - Intergenic
934625328 2:95844226-95844248 AACAGGTACACTTCTGCTGTTGG - Intronic
934808244 2:97257072-97257094 AACAGGTACACTTCTGCTGTTGG + Intronic
934829265 2:97500114-97500136 AACAGGTACACTTCTGCTGTTGG - Intronic
936951926 2:117986245-117986267 AACAGCTCTGCCTCTACCGTGGG + Intronic
940348082 2:152648259-152648281 AACATCAATGCATCTGCTGTGGG + Exonic
940706264 2:157108319-157108341 ATCAGCAATCCCTCTGATGGGGG - Intergenic
940773386 2:157862117-157862139 AGCAGTTATCTCTGTGCTGTGGG - Intronic
946105437 2:217365273-217365295 AACTACCATCCCTCTGGTGTGGG - Intronic
948549609 2:238761488-238761510 AACAGCGAACCCCCTGCTGCTGG + Intergenic
1169415402 20:5411851-5411873 ACCAGCTATCCCTCCCCTGGGGG - Intergenic
1169636860 20:7702055-7702077 AAGAGCTCTCCCTCTGTTGGGGG - Intergenic
1169968138 20:11239731-11239753 AACAGCTAAACCTCTTATGTGGG - Intergenic
1171211105 20:23317524-23317546 AACTGCCAACCCTGTGCTGTAGG + Intergenic
1171334034 20:24367227-24367249 CACAGCTCATCCTCTGCTGTTGG + Intergenic
1175185268 20:57175724-57175746 AAAAGCAATCCCTCTGTTGTGGG - Intronic
1175990216 20:62784988-62785010 AACAGCTGTCTCTATGCTGATGG - Intergenic
1178988687 21:37332840-37332862 AACAGCTATACCACTATTGTAGG - Intergenic
1179314519 21:40230755-40230777 TACAGCTATCTTTCTGCTATTGG + Intronic
1179684570 21:43046329-43046351 AACAGCCACCCATCTGCAGTCGG + Intergenic
1180714194 22:17860392-17860414 CACAGCTAATCCTCTCCTGTTGG + Intronic
1184823042 22:46925845-46925867 AACATGTATCCTGCTGCTGTTGG - Intronic
1185175075 22:49321771-49321793 ATCAGCCTTCCATCTGCTGTGGG + Intergenic
950577078 3:13838404-13838426 AAAACCTCTTCCTCTGCTGTGGG - Intronic
955395211 3:58552399-58552421 AAAAGCAATACCTCAGCTGTGGG + Intergenic
958064352 3:88524128-88524150 AATAGCTACTCCTCTGCTTTTGG + Intergenic
960011844 3:112842133-112842155 ACCAGTTTTCCCTCTGATGTTGG - Intronic
960148752 3:114230899-114230921 AACTGCTCTCCCTCAGCTGAGGG - Intergenic
960790439 3:121424438-121424460 TACTGCTTTCCCTCTGCTGTTGG + Exonic
961611699 3:128144801-128144823 AACAGCTCTCCATTTCCTGTAGG + Intronic
966171628 3:177087986-177088008 AACATCTATCCCTCTATTGTGGG + Intronic
968673896 4:1866692-1866714 AAAGGCTGTGCCTCTGCTGTGGG + Intergenic
970213634 4:13736237-13736259 AACATATTTCCCTCTGCTCTAGG - Intergenic
976622968 4:87147780-87147802 TACAGTTGTCCCTCTGTTGTTGG - Intergenic
980322858 4:131302264-131302286 AATACCCATCACTCTGCTGTAGG + Intergenic
988715890 5:33827865-33827887 ACCATCTATCCATTTGCTGTGGG + Intronic
993838486 5:92845883-92845905 AACTGCTATCAGTCTGATGTGGG - Intergenic
996435553 5:123429757-123429779 ACCAGCTCTTCCTCTGCTATTGG - Intergenic
996799172 5:127383777-127383799 AACAGTTAAGTCTCTGCTGTGGG + Intronic
997064195 5:130543393-130543415 AACTGCTATGCATGTGCTGTGGG - Intergenic
998724889 5:145000492-145000514 CCCAGCAATCCCTCTACTGTTGG - Intergenic
999174108 5:149619524-149619546 AGCAGCTATTCCTCAGCTCTGGG + Intronic
1003669386 6:8142047-8142069 AACAGGCCTCCCTGTGCTGTAGG - Intergenic
1003816190 6:9843342-9843364 AAAGGCTATTCCTCTGCTGAGGG - Intronic
1005615196 6:27566209-27566231 TACAGCTCCCCCTCTGCTGTCGG + Intergenic
1006205085 6:32333623-32333645 AACAGCTATCCCTCTGCTGTGGG - Intronic
1009253726 6:61347644-61347666 CACAGGTATCCCTCTGCAGGTGG - Intergenic
1009258412 6:61449465-61449487 CACAGGTATCCCTCTGCAGGTGG - Intergenic
1014683100 6:124458446-124458468 TACAGCTCTCTCTCTGCTGTTGG + Intronic
1016017637 6:139202467-139202489 CACAGCTTTCACTATGCTGTAGG + Intergenic
1019908107 7:4080094-4080116 AACAGCTTTCCCACAGCTGGAGG - Intronic
1020086032 7:5311296-5311318 AACAGCTAACCCACTGCTGCAGG + Intronic
1020941699 7:14547167-14547189 CAGAGCTATGCCTCTGCTTTTGG + Intronic
1022614744 7:31917835-31917857 AATATCTATACCTCTGCTCTGGG + Intronic
1023262088 7:38368383-38368405 ATCTGCACTCCCTCTGCTGTGGG - Intergenic
1023534938 7:41198428-41198450 ACCAGCTCTCTCTCTGCTATGGG + Intergenic
1024211431 7:47209124-47209146 AGCAGCTATCGCCCTGCAGTCGG - Intergenic
1025208274 7:57005776-57005798 AACAGCTATCCCACTGCTGCAGG - Intergenic
1025210253 7:57016265-57016287 AACGGCGCTCCCTGTGCTGTGGG - Intergenic
1025663678 7:63571102-63571124 AACAGCTAACCCACTGCTGCAGG + Intergenic
1025986305 7:66455564-66455586 AAGAGCTTTCTCTGTGCTGTGGG - Intergenic
1027638198 7:80702183-80702205 AACAAAAATCCCTCTGCTATTGG + Intergenic
1029199785 7:98831211-98831233 AGCAGCTATCACTATGGTGTTGG + Intergenic
1033656438 7:143378170-143378192 AACCTCTATCCATCTGCAGTTGG + Intergenic
1034003002 7:147437153-147437175 ATCAGCAATCCCTCTGGTGTTGG - Intronic
1035152200 7:156883986-156884008 ATCAGCTTCCCCTCTGCGGTAGG - Intronic
1038101757 8:24385857-24385879 AACAACTGTGCCTGTGCTGTCGG + Intronic
1038634700 8:29276277-29276299 AGCAGCTGTCCCTCTGTTCTGGG - Intergenic
1042383701 8:68149511-68149533 AACAGCATTCCCTGTCCTGTAGG - Intronic
1042436979 8:68777231-68777253 ATCAGCTATCCCTCTTGTGGAGG - Intronic
1047995142 8:130327614-130327636 AGCAGCTATTCCACTGCTGTTGG - Intronic
1049307023 8:141909409-141909431 AACTGCCCTCCCTGTGCTGTGGG - Intergenic
1049510311 8:143024002-143024024 CCCAGCTCTCCCTCTGCTCTGGG + Intergenic
1053071494 9:35104713-35104735 AACTGCTTTCCCTCAGCTGAGGG - Exonic
1185836664 X:3350920-3350942 ATCACCTATGGCTCTGCTGTTGG - Intergenic
1186334852 X:8575214-8575236 AACACCTCTTCCTCTGGTGTAGG + Intronic
1188677225 X:32956492-32956514 AACAGATTTCTCTCTGTTGTTGG + Intronic
1188781307 X:34289382-34289404 AGCACCTCTCCCTCTGCTTTAGG + Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1201239952 Y:11949131-11949153 ATCACCTATGGCTCTGCTGTTGG + Intergenic