ID: 1006205562

View in Genome Browser
Species Human (GRCh38)
Location 6:32338672-32338694
Sequence CCAGTAACACTCAAAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006205562_1006205567 -8 Left 1006205562 6:32338672-32338694 CCTCTTTCTTTGAGTGTTACTGG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1006205567 6:32338687-32338709 GTTACTGGGTTTTCTCACAGGGG 0: 1
1: 0
2: 0
3: 18
4: 144
1006205562_1006205566 -9 Left 1006205562 6:32338672-32338694 CCTCTTTCTTTGAGTGTTACTGG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1006205566 6:32338686-32338708 TGTTACTGGGTTTTCTCACAGGG 0: 1
1: 0
2: 0
3: 20
4: 213
1006205562_1006205565 -10 Left 1006205562 6:32338672-32338694 CCTCTTTCTTTGAGTGTTACTGG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1006205565 6:32338685-32338707 GTGTTACTGGGTTTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006205562 Original CRISPR CCAGTAACACTCAAAGAAAG AGG (reversed) Intronic
900757673 1:4448197-4448219 GCAGTTACTCTCAAAGAATGAGG + Intergenic
900909000 1:5580896-5580918 CTTTTAACAGTCAAAGAAAGAGG - Intergenic
902970680 1:20045959-20045981 CAAGTAAAACTCAAAAAAAAAGG - Intronic
903372903 1:22848335-22848357 CCAGCACCACTCAGAGATAGTGG + Intronic
906379668 1:45324553-45324575 ACAGTAAGAGTTAAAGAAAGAGG - Intergenic
911882016 1:103251817-103251839 CGACTACCACTGAAAGAAAGAGG - Intergenic
913502465 1:119483721-119483743 CCTGTAAGAGTTAAAGAAAGAGG + Intergenic
913995463 1:143648841-143648863 ACAGTAACACTCTCAGAGAGGGG - Intergenic
914360812 1:146934360-146934382 ACAGTAACACTCTCAGAGAGGGG + Intergenic
914491770 1:148156278-148156300 ACAGTAACACTCTCAGAGAGGGG - Intergenic
915922683 1:159988584-159988606 ACAGTACCAATCAAAGAAGGTGG + Intergenic
917736183 1:177922504-177922526 CCAGAACCACACATAGAAAGTGG - Intergenic
921079967 1:211731275-211731297 ACAGAAAGACTCAGAGAAAGGGG + Intergenic
922295763 1:224248609-224248631 CCAGTAGCAACCAAAGAAAGGGG + Intronic
924091441 1:240505563-240505585 CCAGTAACACTGAAAAAAGAGGG - Intronic
924293983 1:242566929-242566951 CCAGTAATGCTCTAAGAGAGAGG - Intergenic
924951687 1:248890349-248890371 CCTGTAAGAATTAAAGAAAGAGG - Intergenic
1062809828 10:454809-454831 CCTGGAACCCTCAGAGAAAGAGG + Intronic
1064233229 10:13548564-13548586 CCTGAAGCACTCAAAGAAAGTGG - Intergenic
1066513312 10:36126575-36126597 CCAATACCACTCATATAAAGAGG + Intergenic
1066521212 10:36221978-36222000 CCAGTGACAGTCAAAGCAGGTGG - Intergenic
1068087130 10:52388327-52388349 CCAGTAAATTTCAAAGTAAGTGG + Intergenic
1068515943 10:58025488-58025510 CTAGTAACCCCCAAAGATAGGGG - Intergenic
1068714504 10:60173658-60173680 ACAGAAACACTAAAAGGAAGAGG + Intronic
1069603380 10:69724229-69724251 CCAGAAACACGCAAACAAATAGG + Intergenic
1069653104 10:70065742-70065764 TCAGTAAGAGACAAAGAAAGGGG + Intronic
1073599362 10:104831678-104831700 CCCAAAACACTGAAAGAAAGAGG - Intronic
1075687962 10:124377188-124377210 CCAGAAGATCTCAAAGAAAGGGG - Intergenic
1076009897 10:126979531-126979553 CAAGTAAGATTCAAAGAAAAAGG - Intronic
1078947532 11:16086670-16086692 CCAGAAACTCTCAAAAAAACAGG + Intronic
1079844141 11:25443053-25443075 CCAGAAAGACTCAGAGAAAATGG + Intergenic
1079975382 11:27084300-27084322 CCAGAAACACTCATAGAAGATGG - Intronic
1080179268 11:29404046-29404068 CCAGTAACAATAAAAAAAAAAGG - Intergenic
1080567257 11:33522511-33522533 CCAGAAACACACAAGAAAAGTGG - Intergenic
1080997600 11:37622877-37622899 ACATCAACACTCAAAGAAAAAGG + Intergenic
1087047649 11:93856574-93856596 CAAATAAAACTCCAAGAAAGAGG + Intergenic
1090421467 11:126578326-126578348 TCAGTATCTCACAAAGAAAGAGG + Intronic
1092509453 12:9139750-9139772 CCTGTAAGAGTTAAAGAAAGAGG + Intergenic
1093758614 12:22880763-22880785 CCACTAACATTCAAAGGGAGAGG - Intergenic
1094478919 12:30864590-30864612 CTAGTAACCCTCAGAGAATGGGG + Intergenic
1094535971 12:31323704-31323726 CTAGAAACACACAAAGAAACTGG + Intronic
1095688012 12:45057593-45057615 TCAGTGATACGCAAAGAAAGTGG - Intergenic
1095814586 12:46407493-46407515 CCAGTAATACTCAAAGGCTGTGG - Intergenic
1098690339 12:73480195-73480217 CTGGTAACACTCAAAGTAAAAGG + Intergenic
1105559155 13:21474182-21474204 CCAGCCACACTCAAAAAGAGAGG + Intergenic
1107023560 13:35776782-35776804 CCAGTGAAACTGAAGGAAAGAGG - Intronic
1107404858 13:40102868-40102890 CCAGTACCAGTAAAAGAGAGGGG - Intergenic
1107827607 13:44343160-44343182 CAAGTAACACACACATAAAGAGG + Intergenic
1109243607 13:59924738-59924760 CCAATACCATTCAAAGACAGTGG - Intronic
1114740746 14:25094761-25094783 CCAGTTACAAGCAAACAAAGTGG - Intergenic
1114789662 14:25642801-25642823 CCAGTAATATTCAAAGCAACTGG - Intergenic
1116342357 14:43740053-43740075 CCAGTCACACTCACAGCAAATGG + Intergenic
1116977102 14:51128818-51128840 CTACTCACACTCAAAGGAAGGGG - Intergenic
1117347290 14:54845595-54845617 TCAGTAACAGTAAATGAAAGTGG + Intronic
1118936347 14:70292363-70292385 CAAGTAAAACTCCAAAAAAGAGG - Intergenic
1120030420 14:79634714-79634736 CCAGAAACAGTAAAGGAAAGAGG - Intronic
1121972167 14:98368225-98368247 CCAGTAACACTAGGAGAAGGTGG + Intergenic
1123757078 15:23405272-23405294 CCAGCCACACTCAAAGCAAGTGG - Intergenic
1126251329 15:46571513-46571535 CCTGTAACACAAAAATAAAGAGG + Intergenic
1127376122 15:58386363-58386385 CAAATAACACTCAAATGAAGTGG - Intronic
1130018780 15:80209519-80209541 TGAGTGACCCTCAAAGAAAGTGG + Intergenic
1131863653 15:96682432-96682454 CCATTCACAATCAAGGAAAGGGG - Intergenic
1131949747 15:97669139-97669161 CTAGTCACATTCAAAGGAAGGGG - Intergenic
1132223754 15:100124941-100124963 CCATCCACTCTCAAAGAAAGGGG - Intronic
1132511975 16:347555-347577 CCAGCAACACTCAGAGAGAAAGG + Intronic
1134459236 16:14417425-14417447 CCAGCCACACTCAAAGCGAGTGG + Intergenic
1135722373 16:24828604-24828626 CCAGTACCACTCTAAGAAGCAGG + Intergenic
1138175907 16:54898007-54898029 CCAGTAACACTTACAAAAACAGG - Intergenic
1138731260 16:59197596-59197618 CCAATAGCTATCAAAGAAAGAGG + Intergenic
1138984705 16:62314330-62314352 CCCAAAACACTGAAAGAAAGAGG - Intergenic
1140804691 16:78522345-78522367 TCAGAAACACTCAAAGAATTAGG - Intronic
1145235049 17:21202335-21202357 TCAGGAACACTCAAAGCAAAAGG + Intronic
1146090857 17:29876107-29876129 CCAGTGACATTCACAGAAATAGG + Intronic
1147300171 17:39520171-39520193 CCAGTAAGACCCAAATGAAGAGG + Intronic
1147839705 17:43362451-43362473 CCTGTAAGAGTTAAAGAAAGAGG + Intergenic
1148468367 17:47878230-47878252 CAATTAGCACTCAAATAAAGGGG + Intergenic
1148528200 17:48363478-48363500 CCAGTAGCATTCAAATAAAATGG - Intronic
1151341478 17:73473754-73473776 CCAGTAACACTTAAAAAAGTGGG + Intronic
1153103610 18:1502220-1502242 GCAGTTACACTCATATAAAGTGG - Intergenic
1153462768 18:5354921-5354943 CCAGTTAGAATCAAAGAGAGGGG + Intergenic
1153554476 18:6296688-6296710 CCAGTAACATTCTAGGGAAGGGG + Intronic
1156209781 18:34927078-34927100 CCAGTAACAAATAAAGAAATAGG + Intergenic
1157843327 18:50979609-50979631 CCAGCCACACTCAAGGAGAGGGG + Intronic
1158864502 18:61625041-61625063 ACTGTAACAGTTAAAGAAAGAGG - Intergenic
1159459150 18:68700656-68700678 CCAGTAACACAAAAGAAAAGAGG + Intronic
1159680658 18:71347666-71347688 CCAGGAAGACTGAAAAAAAGTGG + Intergenic
1161897883 19:7096357-7096379 CCAGTCACCCTCAAAACAAGAGG + Intergenic
1163804450 19:19387066-19387088 CCAGGGCCCCTCAAAGAAAGCGG - Intronic
1164530249 19:29043012-29043034 ACAGAAACACTCAGAGCAAGTGG + Intergenic
1164841591 19:31397205-31397227 CCAGTAACAGCCAAGGAAAAGGG - Intergenic
928941456 2:36731212-36731234 CCAGTAGTACTTAAAGAGAGGGG - Intronic
929178729 2:39009598-39009620 CCAATAATACACAAAGAAGGTGG + Intronic
929348756 2:40921259-40921281 CCTGTAACACTCGTAGAGAGTGG - Intergenic
929882454 2:45848869-45848891 CCAGGAAAACTTCAAGAAAGAGG + Intronic
930661444 2:54058609-54058631 CCTGTAAGAGTTAAAGAAAGAGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935519355 2:104084940-104084962 CCAGTAAAACAGAAAGAAAGGGG - Intergenic
939519349 2:143210111-143210133 CCAGTGACAGGCAAAGAACGAGG + Intronic
939847273 2:147262725-147262747 GCAGTAACACTCCAGGACAGTGG - Intergenic
940448307 2:153804475-153804497 CCAGTAAAATTCTAACAAAGGGG + Intergenic
942526092 2:176854508-176854530 CAAGTAACAAAGAAAGAAAGGGG + Intergenic
944457737 2:199912226-199912248 CCAGTAACCCTAAAAAAGAGTGG + Intronic
945359074 2:208874258-208874280 CCAGTATCAGGCAAAGAATGTGG - Intergenic
947129954 2:226911470-226911492 CCACAAAGAATCAAAGAAAGTGG - Intronic
948486587 2:238285184-238285206 ACAGTCAGACTCAAAGAAAGAGG + Intronic
1169821085 20:9710820-9710842 CCAGTATCACTTTAAGAGAGGGG - Intronic
1170215543 20:13886994-13887016 CCAAAAAGACTCAAGGAAAGGGG + Intronic
1170970121 20:21107758-21107780 CCACTAACACACAAAGAGATGGG + Intergenic
1173940391 20:46905875-46905897 CCAGGAGTACTCAAAGAAAGGGG + Intronic
1178684734 21:34702187-34702209 CCGGAAACCCTCATAGAAAGGGG + Intronic
1181574937 22:23787544-23787566 CCAGTCAGACGCAAAGAAACGGG + Intronic
949239535 3:1853495-1853517 TCAGTATCACTCAGAGAAAAAGG + Intergenic
952855484 3:37767080-37767102 CCTGTCACACGCAAAGGAAGAGG + Intronic
953356357 3:42259545-42259567 TCAGTAAGACTCAAAGAAGGGGG + Intronic
953708041 3:45245893-45245915 CCAGTCACACAGATAGAAAGAGG + Intergenic
953892029 3:46757974-46757996 CCTATAATACTCAAAGAAACAGG + Intronic
954942754 3:54389965-54389987 CCAGAAAAAATCAAAGAATGAGG - Intronic
956259212 3:67318774-67318796 CAAGTTAAACTCAAAGCAAGCGG - Intergenic
957339849 3:78881717-78881739 ACAGCAACACTCAAAGGAAAGGG + Intronic
957945972 3:87063500-87063522 CCAGCAAAGCTCGAAGAAAGGGG - Intergenic
959864583 3:111251903-111251925 GCAGTAACTTGCAAAGAAAGAGG - Intronic
962288040 3:134105038-134105060 CCAGCAACACCAAAAGAATGTGG + Intronic
964547118 3:157846657-157846679 TCAGTAACACTCATAGAAATGGG - Intergenic
968477652 4:819993-820015 CAAGTAACAATCAGAGGAAGAGG - Intronic
971433828 4:26598007-26598029 AAAATAACACACAAAGAAAGGGG - Intronic
973209089 4:47595673-47595695 CCAGCTACACTAAAAGAAAATGG - Exonic
973740682 4:53916637-53916659 CCAGCAACACACAATGAATGAGG - Intronic
973876503 4:55225182-55225204 CCAGAAATACTTAAAGAATGAGG - Intergenic
973934559 4:55829957-55829979 CCAGGTAGAATCAAAGAAAGTGG - Intergenic
974810815 4:66943607-66943629 GCAATAATACTTAAAGAAAGGGG + Intergenic
974879412 4:67735565-67735587 CCAATCATGCTCAAAGAAAGGGG + Intergenic
974991086 4:69091772-69091794 CCAGATAAACTCATAGAAAGGGG + Intronic
975471808 4:74778389-74778411 CTTGTAACTCTCAAATAAAGTGG - Intronic
975739909 4:77419706-77419728 CCAAGAACACTCAAAGTGAGAGG - Intronic
976437110 4:85030614-85030636 CCTGTAAGAGTTAAAGAAAGAGG - Intergenic
977030153 4:91873319-91873341 CCAGTTACACTCCAGCAAAGAGG + Intergenic
977988058 4:103408654-103408676 ACAGTAAGGCTCGAAGAAAGAGG - Intergenic
978660841 4:111124234-111124256 CCAGCACAACTCAAGGAAAGAGG + Intergenic
980093101 4:128462648-128462670 CAAGTAACTCACCAAGAAAGTGG - Intergenic
986330885 5:6714899-6714921 CAAGTAACAGTCCAAGAAAAGGG + Intronic
986433859 5:7709060-7709082 CCAGTAACACTGAAGGAATAAGG + Intronic
986664579 5:10089300-10089322 CCACCCACACTCAAAGAGAGGGG + Intergenic
987270417 5:16302757-16302779 CCAGAAACACTCAGAGGAAGGGG + Intergenic
988190329 5:27922275-27922297 CCAGAAACAGTCACAGAAATAGG - Intergenic
989454119 5:41622396-41622418 CAAATAACACTCAAAGACTGAGG + Intergenic
993647602 5:90478989-90479011 CAGGTCCCACTCAAAGAAAGGGG + Intronic
995272179 5:110234110-110234132 CCTGTAACACGGAAAGGAAGGGG + Intergenic
996933177 5:128915853-128915875 CCAGTGTTACTCAAATAAAGGGG + Intronic
997848578 5:137310652-137310674 CCTGTTCCACTCAAACAAAGTGG + Intronic
999373149 5:151068443-151068465 CCAGAAACACTCAATGGATGAGG + Intronic
1000946204 5:167426455-167426477 CCTGTAAGAATTAAAGAAAGAGG - Intronic
1001097171 5:168784655-168784677 CCAGGAACTCTTCAAGAAAGAGG - Intronic
1002347617 5:178558670-178558692 CCAGTAACACTCAGAAAGAGGGG + Intronic
1003910541 6:10740044-10740066 CCAGTGACACCCAAAGAGTGGGG + Intergenic
1005131166 6:22510056-22510078 GCAGGAACACCAAAAGAAAGTGG + Intergenic
1006205562 6:32338672-32338694 CCAGTAACACTCAAAGAAAGAGG - Intronic
1008854356 6:56063814-56063836 CCACTCACCCTCAGAGAAAGAGG + Intronic
1010796122 6:80118823-80118845 CCTGAAGAACTCAAAGAAAGTGG - Intronic
1012046637 6:94283846-94283868 CCAGTGACCCTCAAAGTAGGTGG - Intergenic
1013391114 6:109687361-109687383 CCACTCCCACTCAAAGGAAGAGG - Intronic
1016413434 6:143808048-143808070 ACTGTAACCCTGAAAGAAAGGGG - Intronic
1016988092 6:149910039-149910061 CCAGAAACAGACCAAGAAAGAGG - Intergenic
1017866892 6:158451667-158451689 CCTGTAACATTCAATGAAAGAGG + Intronic
1018742634 6:166742185-166742207 CCATTAACACTGAAATAAATAGG + Intronic
1021892157 7:25196267-25196289 CCTGTAAGAATTAAAGAAAGAGG + Intergenic
1024091210 7:45941565-45941587 GTAGTAATATTCAAAGAAAGAGG - Intergenic
1024176102 7:46842555-46842577 CAAGTTACAGTCAATGAAAGTGG + Intergenic
1026646595 7:72176222-72176244 CCTGTAAGAATTAAAGAAAGAGG - Intronic
1029125210 7:98290849-98290871 CATGTAACATTCAAAGAAAACGG - Intronic
1031971359 7:128067313-128067335 CCAGCAACAATCACAGCAAGCGG - Intronic
1033265064 7:139877987-139878009 CAAGAAACACTCAAGAAAAGTGG - Intronic
1034279499 7:149842868-149842890 CAAGCTCCACTCAAAGAAAGTGG - Intronic
1034761984 7:153681173-153681195 AAATTAAGACTCAAAGAAAGAGG - Intergenic
1034934134 7:155187675-155187697 CCAGTGCCACTGAAAGAAGGGGG + Intergenic
1035991080 8:4490841-4490863 CCTGTAACACTATAAGCAAGAGG - Intronic
1037356283 8:18023114-18023136 CCAGTATTACTGAGAGAAAGGGG - Intronic
1037714706 8:21387360-21387382 CCAGTAAGACTCAGAGAAAGTGG + Intergenic
1038646044 8:29363234-29363256 TAAGTAACACTCACAGAAAGGGG - Intergenic
1042067182 8:64891212-64891234 CAAGTCACCCACAAAGAAAGAGG + Intergenic
1042078782 8:65026313-65026335 CCAGATACTCTCAATGAAAGTGG - Intergenic
1042490183 8:69388635-69388657 CAAGTTAAACCCAAAGAAAGTGG - Intergenic
1042770949 8:72381981-72382003 CTAGTACCACACAAAGAAAAGGG - Intergenic
1045744661 8:105404368-105404390 CCATTAAATCTCAAACAAAGAGG - Intronic
1047426079 8:124748236-124748258 CCAGGAACAATCAAAAGAAGGGG + Intergenic
1048213189 8:132474122-132474144 TCACTAACAGGCAAAGAAAGGGG + Intronic
1049093438 8:140534139-140534161 CCAGTCACACGCCAGGAAAGGGG - Intronic
1052240082 9:26261368-26261390 CCTGTAAGAGTTAAAGAAAGAGG + Intergenic
1052418459 9:28208576-28208598 CCAGATACAGTGAAAGAAAGGGG - Intronic
1052841986 9:33299677-33299699 CCTGTAACTTTCACAGAAAGAGG + Intronic
1053048666 9:34940453-34940475 CCTGTAAGAATTAAAGAAAGAGG - Intergenic
1056556964 9:87697650-87697672 CCACTAAGAAACAAAGAAAGAGG + Intronic
1058389545 9:104479455-104479477 CCATAAACACTCACAGAAAGAGG - Intergenic
1062070059 9:134550484-134550506 CCAGCAAGACCCAAAGAAAGGGG - Intergenic
1186984885 X:15001607-15001629 ACAGTAAAATTCTAAGAAAGGGG + Intergenic
1187225378 X:17371253-17371275 CCAGCAAAACTAAAGGAAAGAGG + Intergenic
1189691863 X:43625135-43625157 CAAGTAAAACTCCAAGAAAAGGG + Intergenic
1190390851 X:49930138-49930160 TCAGTAGCAGTCAAATAAAGGGG + Intronic
1190843206 X:54165872-54165894 CCAGTAACACCCCCAGAAAACGG + Intronic
1190886056 X:54531548-54531570 ACACTAACACTGAAAGAAATAGG - Intronic
1190956561 X:55200814-55200836 CAAGTAAAACTCCAAAAAAGAGG + Intronic
1192326213 X:70134373-70134395 CCAGTTTCACTCAATGAAAGTGG - Intronic
1194951639 X:100134526-100134548 CTGGTAAACCTCAAAGAAAGTGG + Intergenic
1197383462 X:125774616-125774638 CCTTTATAACTCAAAGAAAGGGG - Intergenic
1197563802 X:128056025-128056047 TCACTAACAGTCATAGAAAGAGG + Intergenic
1199382041 X:147182491-147182513 CCAGCAAAACTCAATGAGAGGGG - Intergenic
1199540271 X:148950973-148950995 GCAGTAACATTCACAGTAAGAGG - Intronic
1200093182 X:153645153-153645175 CCAGGAACACACTGAGAAAGGGG + Intronic
1201236369 Y:11915829-11915851 CCAGAACCACTCAAGGAAGGAGG - Intergenic