ID: 1006205583

View in Genome Browser
Species Human (GRCh38)
Location 6:32338843-32338865
Sequence TAGGGAATAAACAAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006205577_1006205583 -3 Left 1006205577 6:32338823-32338845 CCAGTTTATTAAGATAAGAATAG 0: 1
1: 0
2: 1
3: 17
4: 289
Right 1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG 0: 1
1: 0
2: 0
3: 29
4: 408
1006205575_1006205583 -1 Left 1006205575 6:32338821-32338843 CCCCAGTTTATTAAGATAAGAAT 0: 1
1: 0
2: 1
3: 30
4: 362
Right 1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG 0: 1
1: 0
2: 0
3: 29
4: 408
1006205576_1006205583 -2 Left 1006205576 6:32338822-32338844 CCCAGTTTATTAAGATAAGAATA 0: 1
1: 0
2: 0
3: 42
4: 438
Right 1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG 0: 1
1: 0
2: 0
3: 29
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006205583 Original CRISPR TAGGGAATAAACAAGGGGAA AGG Intronic
900753225 1:4414364-4414386 GAAGGAGAAAACAAGGGGAATGG - Intergenic
902178564 1:14670113-14670135 AAGGGAATGAAAAAGGGGAGGGG - Intronic
903915317 1:26759608-26759630 TAGAGAATGAACATGGGGCAGGG + Intronic
904220217 1:28961196-28961218 TAGGCAAAAAACAAAGGTAAAGG + Intronic
905596502 1:39212211-39212233 TGGGAAAAAAAGAAGGGGAATGG + Intronic
906189681 1:43889178-43889200 TAGTGAATAAAGAAGGGAACAGG + Intronic
906703500 1:47877074-47877096 TAGGGAATAATGATGGGGACAGG + Intronic
906882319 1:49605233-49605255 AAGAGAATAAACAAGGACAAAGG + Intronic
906897915 1:49799622-49799644 GAGTGAAAAAACAAGGGCAAAGG + Intronic
907446318 1:54510250-54510272 TGTGGAATAAACAAGAGGAGTGG - Intergenic
907556125 1:55345612-55345634 TGGGGAATAAATATGGGGAGGGG - Intergenic
907909636 1:58815022-58815044 TTGGGGCTAAACAAAGGGAAAGG - Intergenic
908440135 1:64145282-64145304 TATGGAACAAAGAAGGGGAAGGG + Intronic
908558914 1:65285426-65285448 CAGGGAATAAACTGTGGGAAAGG - Intronic
909045459 1:70704129-70704151 CAGGTAACAAACAAGTGGAAAGG - Intergenic
909641561 1:77873367-77873389 TAGGGAATTGATAAGGTGAATGG - Intronic
910840713 1:91558793-91558815 TAAAGAATGAATAAGGGGAAGGG - Intergenic
910921828 1:92356734-92356756 TAGAGAATAAAAAAGGAAAATGG - Intronic
911406837 1:97451856-97451878 TAGGGAGTAAAGCAGAGGAAAGG - Intronic
912187236 1:107292769-107292791 CAGGGAAGAATCAAGGGAAATGG + Intronic
912862124 1:113223266-113223288 GAGAGAATAAAAAGGGGGAAAGG + Intergenic
913197118 1:116466338-116466360 GATGGCATAAACAAGGCGAAAGG - Intergenic
913207104 1:116549289-116549311 TAGGGAACTAACAAGGGGTTAGG + Intronic
913571796 1:120127749-120127771 TAAGGGATCAACAAAGGGAAGGG + Intergenic
914292715 1:146289370-146289392 TAAGGGATCAACAAAGGGAAGGG + Intergenic
914553759 1:148740153-148740175 TAAGGGATCAACAAAGGGAAGGG + Intergenic
915943284 1:160132483-160132505 TAGGGCAGAAACAAAGGGAATGG + Intronic
916078050 1:161214543-161214565 TGGGGAATAGAGAAGTGGAAAGG - Intergenic
916385101 1:164258164-164258186 TAAGGAAAAAAAAAGTGGAAAGG + Intergenic
916630254 1:166605225-166605247 TAGGAAATAACCAAGAGAAAGGG + Intergenic
917766961 1:178230841-178230863 AAGGGAAGAATCAAAGGGAAAGG - Intronic
918238780 1:182604035-182604057 CAGGGAGAAAGCAAGGGGAAGGG - Intronic
918500622 1:185191244-185191266 GAGGGAAGAAGCAGGGGGAAGGG - Intronic
918710946 1:187729272-187729294 TACGGAATAAATGGGGGGAAAGG + Intergenic
918726287 1:187928599-187928621 GAGAGAAGAAACAAGGGGAGGGG - Intergenic
918766246 1:188487332-188487354 GAAGGAAGAAACTAGGGGAAGGG - Intergenic
920590750 1:207216331-207216353 TAGTGTATAAGCATGGGGAAAGG + Intergenic
921856881 1:219996134-219996156 TAGGTAAGAGACAAAGGGAATGG - Intronic
922550596 1:226491430-226491452 TAGGCAAGAAAGATGGGGAAAGG + Intergenic
922988159 1:229882782-229882804 TAGGGAGGAAACCAGGGTAACGG - Intergenic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923384135 1:233449665-233449687 AAGGGAACAACCAAGGGAAAGGG + Intergenic
923482973 1:234401993-234402015 TAGGGCAAAACCCAGGGGAATGG - Intronic
924011757 1:239672639-239672661 TAGGGGAGAAAGAATGGGAAAGG + Intronic
924144327 1:241058341-241058363 AAGGGAAGAAGCAAGGGAAAAGG + Intronic
1063369586 10:5512449-5512471 TAGGGAGGAAATAAGGGAAACGG - Intergenic
1064977060 10:21127735-21127757 AAGGGAATTAAAAGGGGGAAAGG + Intronic
1066589332 10:36976749-36976771 TAGGGAGAAAACAGGGGAAAAGG - Intergenic
1067165185 10:43860609-43860631 AAGGGAACAAACAAGAGGACAGG - Intergenic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1068941392 10:62684570-62684592 AAGGGAGTAAACACTGGGAAGGG - Intergenic
1069198456 10:65583345-65583367 TAAGGACTAAAAAAGGGGAGGGG - Intergenic
1069408331 10:68126418-68126440 TAGGGAAGTAACAAGATGAAAGG + Intronic
1070363682 10:75715163-75715185 AAGAGAATACACAAGGGGAATGG - Intronic
1070991197 10:80733513-80733535 AAGGGAAGAATCAAGGGAAAAGG + Intergenic
1072782841 10:98261937-98261959 TAGAGGATAAGCGAGGGGAAAGG - Intronic
1073712275 10:106057212-106057234 AAAGAAATAAAGAAGGGGAAAGG - Intergenic
1074617931 10:115088998-115089020 TAGGATAAAAATAAGGGGAATGG - Intergenic
1075570045 10:123534958-123534980 TAGGGAAGTCACAAGGGGGAGGG + Intergenic
1075633228 10:124013870-124013892 TGGGGCATAAACAAAGGGAGTGG - Intronic
1076453722 10:130575078-130575100 GAGGGAAGAAAGGAGGGGAAGGG - Intergenic
1078616557 11:12871274-12871296 TAGGGGCTAAACTAAGGGAAAGG - Intronic
1078802200 11:14658182-14658204 TAGGGGATAAATAAGTGAAAGGG + Intronic
1078953524 11:16163423-16163445 TAGAAAATAAACATGTGGAAAGG + Intronic
1080377336 11:31728214-31728236 TAGGGAATTAAGAATGCGAAGGG + Intronic
1080967857 11:37234508-37234530 AAGGGAAAAATCAAGGGAAAAGG - Intergenic
1081287911 11:41294775-41294797 AAGGGAATTAACAAGGATAAGGG + Intronic
1082046698 11:47735345-47735367 TAGGGAACAACCAAGTAGAAGGG - Intronic
1082728262 11:56763726-56763748 GAGGGAATTAGTAAGGGGAATGG - Intergenic
1085898743 11:80671197-80671219 TAGGGAGAAAACAGGGGGAGAGG + Intergenic
1088112047 11:106273459-106273481 TGGGGAATACAATAGGGGAAGGG - Intergenic
1088202160 11:107350251-107350273 TAGGGAATCAACAATGTGCAGGG + Intronic
1088404940 11:109464471-109464493 TACGGAATTAAGAAGGGTAAGGG + Intergenic
1088713596 11:112529398-112529420 TAGAGAAAAAAGAAGGGGAAAGG + Intergenic
1088720463 11:112587815-112587837 TAGGGAAGAAAAAAGGGGCTAGG - Intergenic
1089019537 11:115198466-115198488 AAGGGAAGAAACAGGAGGAACGG + Intronic
1091192653 11:133707596-133707618 AAGGGAAGAAAAAAGGGGAAGGG + Intergenic
1091705102 12:2688488-2688510 TAGGGAATGAGGCAGGGGAATGG - Exonic
1092497273 12:9009213-9009235 AAGGGAATGAACAATGGGTAAGG + Intronic
1092597564 12:10023929-10023951 TAAGGAATCAAAAAGGTGAAAGG - Intergenic
1093227889 12:16507501-16507523 TAGGGAATGAAGAGGAGGAATGG + Intronic
1093709584 12:22314717-22314739 TAGAGTACAAACAATGGGAATGG - Intronic
1095139715 12:38646588-38646610 GAGATAATAAACAAGGGCAAGGG - Intergenic
1095203930 12:39417752-39417774 TAGGGCAGCAACAAAGGGAATGG + Intronic
1095314771 12:40746631-40746653 AAGGGAAAAATCAAGGGAAACGG - Intronic
1095322380 12:40845205-40845227 TTAGGAATAAACAAGAGTAAAGG + Intronic
1096239771 12:49953584-49953606 TGGGGAATAGACAAGGGTTAGGG + Intronic
1096555127 12:52399168-52399190 AAGCAAATAAACCAGGGGAAGGG - Intronic
1096635800 12:52958327-52958349 TAGGGGGGAAACAAGGGGGAAGG + Intergenic
1097701780 12:62827804-62827826 TGGGGAACAACCAAGGAGAAGGG - Intronic
1097733355 12:63153442-63153464 TATGGATTAAACAAAGGGACTGG - Intergenic
1098684985 12:73408591-73408613 TGGGGATTAAAAAAGGGGCAAGG + Intergenic
1099102390 12:78459043-78459065 AAGGGAATAATCAAGGGAAATGG - Intergenic
1099896840 12:88659042-88659064 TAGGAAATAAAAAATGAGAAGGG - Intergenic
1100023542 12:90100101-90100123 TAGGGAATGAAAAAGAGAAAAGG + Intergenic
1100193062 12:92213448-92213470 TTTGGAATAAACAAGGGAGATGG + Intergenic
1100950992 12:99849029-99849051 TGGGAAATAAAGAGGGGGAAAGG + Intronic
1101008594 12:100426930-100426952 AAAGGAAAAAACAAGGGCAAAGG + Intergenic
1101101722 12:101400442-101400464 TAAAGAATAAAGAAGGGTAAAGG + Intronic
1101450455 12:104772820-104772842 AAGGGCAAAAAGAAGGGGAATGG - Intergenic
1102548609 12:113674664-113674686 GAGGGAAAAAACTAGGAGAAAGG - Intergenic
1102653512 12:114460868-114460890 TGGGGATTGAACAAGGAGAATGG + Intergenic
1103315259 12:120049263-120049285 TAGGGAAAGAACAAGGATAAAGG + Intronic
1104225768 12:126831811-126831833 AGGGGAATAGACAAGGAGAAGGG - Intergenic
1104638254 12:130451046-130451068 AAGGGAATTAACAGGGGCAAAGG + Intronic
1104885978 12:132108545-132108567 GAGGGAATATTCAAAGGGAAGGG - Intronic
1105790287 13:23791594-23791616 GGGAGAATAGACAAGGGGAAGGG - Intronic
1106220080 13:27739468-27739490 TATGGAAGAAAGAAGGAGAATGG - Intergenic
1106522520 13:30510351-30510373 TGGGGATTAAAAATGGGGAAAGG - Intronic
1106835649 13:33632246-33632268 TAGGGAGCAAGCAAGAGGAATGG - Intergenic
1107193637 13:37621125-37621147 CAAGGAATAAACAATGTGAAAGG - Intergenic
1107704583 13:43088055-43088077 TAGTGAATATAGAAGGGGAGAGG + Intronic
1108163943 13:47672308-47672330 TAGAGTAAAAACAAGGTGAAAGG + Intergenic
1108477104 13:50831137-50831159 GAGGGAAAAAGAAAGGGGAAGGG + Intronic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108808311 13:54187057-54187079 TAGGGAAGAATAAAGGGAAAAGG + Intergenic
1108904975 13:55457709-55457731 CTAGGAATAAACAATGGGAAGGG - Intergenic
1109069164 13:57741203-57741225 TAAGGAATAAACAAATTGAATGG - Intergenic
1109486144 13:63022779-63022801 GAGGGAAAAAAAAAGTGGAAAGG + Intergenic
1110079460 13:71292318-71292340 AAGGGAAGAATCATGGGGAAGGG - Intergenic
1111351804 13:87041201-87041223 TAGGGAAAAATGAAGGGAAAGGG - Intergenic
1111405421 13:87797951-87797973 TAAGGAATTAAAAAGGGTAAAGG + Intergenic
1111632307 13:90858078-90858100 AAAGGAATATAGAAGGGGAAAGG - Intergenic
1112045645 13:95594855-95594877 TGGGGAATAAAAAAGGGATAGGG - Intronic
1112115102 13:96343691-96343713 CAGGAAATAAATAAGGGAAATGG - Intronic
1112124544 13:96450047-96450069 TAAGGCATAAATATGGGGAAAGG - Intronic
1112478309 13:99752261-99752283 TAGGGAATGTTCAAGGAGAAAGG - Intronic
1112703922 13:102044313-102044335 TAGGGGAGAAACAATAGGAAAGG - Intronic
1112746976 13:102537464-102537486 CAAAGAATAAATAAGGGGAATGG + Intergenic
1114357569 14:21928772-21928794 TATGGAATGAACAAGGTGATTGG + Intergenic
1114391804 14:22317174-22317196 TAGAGAATAAAGAAGAGGTAGGG + Intergenic
1115515396 14:34180165-34180187 TAGAATATAAACAAAGGGAAAGG + Intronic
1115802049 14:37005389-37005411 GAGGGAATCAATAAGGGAAACGG - Intronic
1115863501 14:37715621-37715643 TAGGGGAAAAACAAGTTGAATGG + Intronic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116246576 14:42421700-42421722 GAGGGAATATACTAGAGGAATGG - Intergenic
1116403061 14:44532845-44532867 CTGGGAATAAAAAGGGGGAAAGG + Intergenic
1116437199 14:44909124-44909146 TAGGGCATCAACAAAGGAAAAGG - Intergenic
1116877589 14:50128288-50128310 TAGGAAAGAAAGAAGGGAAAGGG + Intronic
1117387031 14:55225760-55225782 AAGGGAATAAAATAGAGGAAGGG - Intergenic
1118166818 14:63344819-63344841 CAGGGAATAAAGCAGGGTAAGGG - Intergenic
1118462605 14:66000556-66000578 TAGGGAAGAGAAAAGAGGAAAGG + Intronic
1118755295 14:68838699-68838721 TAGGGCAGCACCAAGGGGAAAGG + Intergenic
1119130866 14:72171998-72172020 TAGGGAATGACCAAGAGGCATGG - Intronic
1120128037 14:80770405-80770427 AAGTGAATATACAATGGGAAGGG - Intronic
1120482888 14:85074733-85074755 TAGGTAAAAAACATGGAGAAAGG - Intergenic
1121031555 14:90662551-90662573 TAGGGAATACACAACCTGAATGG + Intronic
1121593336 14:95137401-95137423 AAGGGAAAGAAAAAGGGGAAGGG + Intronic
1121593377 14:95137531-95137553 AAGGGAAAGAAAAAGGGGAAGGG + Intronic
1121593383 14:95137549-95137571 AAGGGAATGGAGAAGGGGAAGGG + Intronic
1123133024 14:106002187-106002209 TAGAGAATAAAAAAGAGTAATGG - Intergenic
1123204203 14:106695749-106695771 TAGAGAATAAAAAAGAGCAATGG - Intergenic
1123583054 15:21732633-21732655 TAGAGAATAAAAAAGAGTAATGG - Intergenic
1123619704 15:22175230-22175252 TAGAGAATAAAAAAGAGTAATGG - Intergenic
1124556377 15:30729509-30729531 TTGGCAATAAGGAAGGGGAATGG + Intronic
1124674896 15:31676261-31676283 TTGGCAATAAGGAAGGGGAATGG - Intronic
1124897597 15:33791480-33791502 TTGGGAATGAAGATGGGGAAAGG + Intronic
1126235865 15:46383409-46383431 TAGGGAATAACCAACAGGTAGGG + Intergenic
1127776923 15:62270836-62270858 AAGGGAAAAAAAAAAGGGAAAGG + Intergenic
1127852137 15:62923163-62923185 TAGAGAATAAACAAAGTGGAAGG - Intergenic
1128147153 15:65337989-65338011 GAGGAAATATACAAGGGAAAGGG + Intronic
1128724861 15:69981033-69981055 TAGGCAAAAGACAATGGGAAGGG - Intergenic
1129362094 15:75030364-75030386 AAGGACATGAACAAGGGGAAAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132119268 15:99162676-99162698 GAGGGACTACACAAGGGCAAGGG - Intronic
1134851055 16:17479395-17479417 TAGAAAAAAAACAATGGGAATGG - Intergenic
1137832202 16:51554636-51554658 TAAGGAATAAGGCAGGGGAAAGG + Intergenic
1137889980 16:52149291-52149313 AAGGAAATACACAAGAGGAAAGG - Intergenic
1138011490 16:53385031-53385053 TAGGGATTTGAAAAGGGGAAGGG - Intergenic
1138717910 16:59045402-59045424 TAGAACATAAACAAGGAGAAAGG + Intergenic
1139004237 16:62551436-62551458 AAGAGAATAAAAAAGGGGAGGGG - Intergenic
1139483696 16:67244805-67244827 TAGGGCAGAAATAAGAGGAAGGG - Intronic
1143787687 17:9268390-9268412 TAGGAAATACACAAGAGCAAAGG + Intronic
1143970331 17:10790707-10790729 CAAGGACTAAACAAAGGGAATGG - Intergenic
1144448489 17:15354536-15354558 TTGGGTAGAAGCAAGGGGAATGG - Intergenic
1144774381 17:17777688-17777710 TGGGGAATTACCAAGGGGAAAGG + Intronic
1144801124 17:17928222-17928244 AAGGAAATAAATAAGGGGGAAGG + Intronic
1145881505 17:28356150-28356172 TAGGGAAGAAACAAGGGCAGGGG - Intronic
1146252607 17:31362532-31362554 AAGGAAATAAAGAAGGAGAAGGG - Intronic
1147438065 17:40430143-40430165 GACTGAAGAAACAAGGGGAAGGG + Intergenic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1147888585 17:43701256-43701278 TTGAGAGTAAACAAGGGGACAGG - Intergenic
1147988461 17:44319649-44319671 TAAGGAATTAACAAGGGTCAGGG + Exonic
1148712260 17:49690422-49690444 CAGGAAATTAACAGGGGGAAGGG - Intergenic
1149136077 17:53366250-53366272 TAAGGAAAACAAAAGGGGAAGGG - Intergenic
1149258102 17:54849783-54849805 AAGGGAAGAATCAAGGGGGAAGG + Intergenic
1149379759 17:56081698-56081720 AAGGGAAGAATCAAGGGAAATGG - Intergenic
1149632798 17:58141066-58141088 TAGGGAATAAAACAGAGGAGAGG + Intergenic
1150881657 17:69035971-69035993 TAGGCAATAAACAAGTAGAGAGG + Intronic
1151248507 17:72815210-72815232 TATGGAATCACCCAGGGGAAGGG + Intronic
1152719333 17:81915180-81915202 AAGGGAATCACAAAGGGGAAAGG + Intronic
1153742140 18:8139797-8139819 TAGAGAAAAATCAAGGGGAGTGG - Intronic
1155620685 18:27775377-27775399 TAGGTAATAAACAGAGGGATAGG - Intergenic
1155712630 18:28902276-28902298 TAGGAAAAAAACAATAGGAAGGG + Intergenic
1155818961 18:30351115-30351137 TAGGGAATGAGCCAAGGGAATGG + Intergenic
1156076623 18:33286922-33286944 TAGACAATAAACATGGGAAAGGG + Intronic
1156723351 18:40097320-40097342 TATGGATAAAACAAAGGGAATGG - Intergenic
1157234092 18:45947109-45947131 TACTGAATAAAAAAGGGTAATGG + Intronic
1157465781 18:47943717-47943739 AAGGGAATAAACCAGTAGAAAGG + Intergenic
1159529686 18:69639722-69639744 TGGGGAGGAAATAAGGGGAAAGG + Intronic
1161267736 19:3372594-3372616 CGGGGATCAAACAAGGGGAAGGG + Intronic
1161426133 19:4204261-4204283 TAGGTAATAAAAAAGGAGAAGGG - Intronic
1161913884 19:7214772-7214794 GAGGGAAGAAAAAAAGGGAAGGG - Intronic
1162228249 19:9242844-9242866 GAGGGAAGAAAGAAGAGGAAAGG - Intergenic
1162459151 19:10803932-10803954 TAGGGGATAGACTATGGGAAAGG + Intronic
1166363735 19:42268330-42268352 CAGCCAATCAACAAGGGGAAAGG + Intergenic
1168304612 19:55428801-55428823 CAGGGAATTAATTAGGGGAAGGG + Exonic
1168320514 19:55506826-55506848 TAGGGAGCAAAGCAGGGGAAGGG + Intronic
1168334842 19:55591886-55591908 CAGGGAATGAAAAAGGGGAAAGG + Exonic
926898405 2:17721553-17721575 TAGGGAATAAAGAGGGAAAATGG - Intronic
927387959 2:22558285-22558307 GAGGGAAAAAACAAAGGGTAGGG + Intergenic
928590121 2:32805889-32805911 TAGGTCATGAACATGGGGAAGGG - Intronic
929613650 2:43291078-43291100 TGGGGAAAAAACAAGGGGTTTGG + Intronic
929947109 2:46380003-46380025 GAGGGGATAAACATGGGGGAAGG + Intronic
931156234 2:59633948-59633970 TAGGGAATACACAAGGCAAGTGG - Intergenic
931485931 2:62691543-62691565 TAGAGAAGAAAAAAGGAGAATGG + Intronic
933505350 2:83170328-83170350 TAGGAAAAAAAGAAGGAGAAGGG - Intergenic
935903258 2:107815213-107815235 TAGGGAATAACCCAGGTGAGAGG - Intergenic
936548564 2:113414291-113414313 TAGGGAAGAAAAATGAGGAAGGG - Intergenic
938940205 2:136163083-136163105 TCGGCAATAAACAGGGGTAATGG + Intergenic
939160452 2:138582741-138582763 GAGGGAAGAAACATGGGAAAAGG - Intergenic
939414599 2:141878497-141878519 TAGGCAATAAACAAATAGAATGG + Intronic
943272320 2:185822229-185822251 TAGGCAAGAAAAAGGGGGAAAGG + Intronic
943402127 2:187427010-187427032 TAGGCCACAAACAAGGGGACAGG - Intronic
944957445 2:204828635-204828657 TTGGAGATAAACCAGGGGAATGG - Intronic
944986958 2:205188322-205188344 CAGGGAAGAATCAATGGGAAGGG + Intronic
947077292 2:226359134-226359156 AAAGGAATAAACATGGAGAAAGG - Intergenic
947501487 2:230674460-230674482 TAGGATATAAACAAGGTGGAGGG + Intergenic
947502095 2:230678461-230678483 TAGCCCACAAACAAGGGGAAGGG + Intergenic
948003947 2:234592082-234592104 TAGAGACTGAACAAGGAGAAAGG + Intergenic
948153572 2:235764366-235764388 AAAGGAATAAACATGGGCAACGG - Intronic
948441709 2:237995504-237995526 TGGGGAATTAACAAGAGGGAAGG + Intronic
948512185 2:238475909-238475931 AAGAGAAAATACAAGGGGAAAGG + Intergenic
1170137805 20:13094482-13094504 CAGGGAAAAATGAAGGGGAAGGG - Intronic
1171854476 20:30332123-30332145 TAGGAAATAAAGAAGAGGGAGGG - Intergenic
1172689918 20:36783232-36783254 TGGGAAATAAACTGGGGGAAAGG + Exonic
1173168891 20:40706376-40706398 TAGTTAATAGACAAGGAGAAGGG - Intergenic
1173787492 20:45805038-45805060 TAAATAATAGACAAGGGGAAGGG + Intronic
1173975213 20:47181688-47181710 TAGAGAAAAAACAATGGAAAAGG - Intronic
1173995944 20:47338757-47338779 TAGGGAATCATTGAGGGGAAGGG - Intronic
1174298988 20:49568405-49568427 TGGGGAGTGATCAAGGGGAAAGG + Intergenic
1174735818 20:52964772-52964794 GAGGCAATAGACAAGAGGAAAGG + Intergenic
1179367421 21:40771364-40771386 TTGGGAATAAACAAGAGTGAAGG + Intronic
1181976862 22:26736556-26736578 CAGGGAAGAAATAAGGGGAAGGG - Intergenic
1182329778 22:29543040-29543062 AAGGGAATAAAGAAGGGGATGGG + Intronic
1182527543 22:30930709-30930731 TAGAGAAAAGACAATGGGAATGG - Intronic
1183722014 22:39568129-39568151 AAGTAAATAAACAAGGGGAAAGG - Intergenic
949460047 3:4281685-4281707 GGGGGAAAAAACAGGGGGAAAGG + Intronic
949761874 3:7479759-7479781 TAGGCAATAAATAAGTGGAGTGG + Intronic
950396303 3:12736725-12736747 TGGGGAATGCACAAGGGGGATGG - Intronic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
952315863 3:32231784-32231806 TAAGGAAAGAACAAGGGGACAGG - Intergenic
952777788 3:37062852-37062874 AAGAGAATAAATAAGGAGAAAGG + Intronic
952894306 3:38066976-38066998 TAGGGAATAGAATAGGGAAAAGG + Intronic
953329764 3:42043259-42043281 AAGGGAAGAAAGAACGGGAACGG - Intronic
953484194 3:43279354-43279376 TAGGGATTATACAAGGGCAAGGG + Intergenic
953707844 3:45244734-45244756 TAAAAAATAAATAAGGGGAAAGG + Intergenic
953788567 3:45929367-45929389 TAGGGACTGAGCAAGGGGAGAGG + Intronic
954499927 3:51002735-51002757 AAGGGAATAAACAAGTAGGAGGG - Intronic
955246916 3:57233704-57233726 TATAGTATAAAGAAGGGGAAAGG - Intronic
955542714 3:59994842-59994864 TAGTGCATAGACAAGGTGAAAGG - Intronic
956701133 3:71959742-71959764 TAGAGAATAAAACAGTGGAAAGG - Intergenic
956897066 3:73673178-73673200 AAGGGAAGAGACAAGGTGAAGGG - Intergenic
957218981 3:77357792-77357814 TAGGAAATAAAGTAGGGAAATGG + Intronic
957239453 3:77639393-77639415 TGGGGAAAAAACAAAGGGAAGGG + Intronic
957320878 3:78628585-78628607 TAGAGAATGAACAAGGGAAATGG - Intronic
957591388 3:82204253-82204275 TAGGAAATAAAAAAAGAGAACGG + Intergenic
958603745 3:96331874-96331896 AAGGGAATAATCATGGGAAAGGG + Intergenic
958832829 3:99110338-99110360 TATGGAATAAGGAAGGGGCATGG - Intergenic
959729450 3:109584192-109584214 TAGGGATTTTAAAAGGGGAAAGG - Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
959928350 3:111950867-111950889 CAAGGAAGAAACAAGGAGAATGG + Intronic
960356184 3:116656196-116656218 GAGGGAATAAAGAAGGGAGAGGG - Intronic
960584837 3:119311122-119311144 TAGGGCAGAAACACTGGGAACGG - Intronic
961996749 3:131253535-131253557 TAGGGAAGGAAGAAGAGGAAAGG - Intronic
963071375 3:141308149-141308171 TAATGAAGAAACAAGGGGAAAGG - Intergenic
964248165 3:154678902-154678924 CTGGGATTAAACAAGGGAAATGG + Intergenic
964491206 3:157238211-157238233 CAGGGACTAAACAAGGGCAGAGG - Intergenic
965123325 3:164591920-164591942 GAGGGAATAAACAAGGTATATGG + Intergenic
965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG + Intergenic
966207738 3:177422082-177422104 TAGGAAAGAAACAATGTGAAAGG - Intergenic
966679550 3:182626861-182626883 AAGGAAATGAACAAGGGGGAGGG + Intergenic
967183615 3:186927748-186927770 TAAGGAGAAAACAAGGGAAAAGG - Intergenic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
968679519 4:1907283-1907305 TATAGAAGAAACCAGGGGAATGG - Intronic
969085812 4:4655617-4655639 CAGGGAATAAGCATGGGCAAAGG + Intergenic
970260795 4:14222427-14222449 AAGGGAAGATCCAAGGGGAAAGG - Intergenic
970758922 4:19459674-19459696 AAGAGAAAAAACAAGTGGAAAGG - Intergenic
972009983 4:34166898-34166920 AAGGGAATAATGAAGGAGAACGG + Intergenic
972668626 4:41192612-41192634 TAGAGAATAAAACAGTGGAATGG + Intronic
973723621 4:53750544-53750566 AGGGGAATAAAAAAAGGGAAGGG + Intronic
973751747 4:54026681-54026703 TAGGAAATAAAAAAGGTGAAGGG - Intronic
974230870 4:59111994-59112016 TAGGGATTTTAAAAGGGGAAGGG - Intergenic
974531513 4:63114287-63114309 TAGGGAATAAGAAAGGGAGAAGG + Intergenic
975630870 4:76400844-76400866 AAGAGAATAATAAAGGGGAAAGG + Intronic
975731771 4:77344350-77344372 TAGGCAAGAAAGAAGGGGTAAGG + Intronic
976475332 4:85475918-85475940 GAGGAAACAAACAAGGGGAAGGG - Intronic
976804689 4:89033812-89033834 TCAAAAATAAACAAGGGGAAAGG + Intronic
977247903 4:94655607-94655629 TTGGGAACAAAGAAGTGGAATGG + Intronic
977869223 4:102070269-102070291 TAGGGAAGAATGAAGGGAAAGGG - Intronic
977890861 4:102309747-102309769 TAGGTAGTGAACAAGGGTAATGG - Intronic
978236283 4:106464995-106465017 TTAGGAATGAACAAGGGAAAGGG - Intergenic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
980867340 4:138568176-138568198 TAGGGGAGAAACAAAGGGGAGGG + Intergenic
980953151 4:139401408-139401430 TAGGGACAAAGCAAGGTGAAGGG + Intronic
981119001 4:141026783-141026805 TAGGGAAAAATCAAAGGAAATGG + Intronic
981190405 4:141855894-141855916 TAGGGATTTTAGAAGGGGAAGGG - Intergenic
981561998 4:146058181-146058203 GAGGAACTAAACAAGGAGAATGG - Intergenic
982479402 4:155891002-155891024 TAGGGATTTCAAAAGGGGAAGGG + Intronic
984352477 4:178613312-178613334 AAGGGAAGAAAAATGGGGAATGG + Intergenic
984477456 4:180255376-180255398 TAGTGAATAAAAAGGGGGACAGG + Intergenic
986496848 5:8351087-8351109 TGGGGAAGAAACAACTGGAAAGG + Intergenic
987815712 5:22899257-22899279 TAGGGTATAAAAAAGGAGATAGG + Intergenic
988090326 5:26531126-26531148 TAGTGAATTAACAAGGGATATGG - Intergenic
988893445 5:35645769-35645791 TAGGGAACAAATAAGGCAAAAGG + Intronic
989061378 5:37415230-37415252 TGTGGAATAGAAAAGGGGAAAGG - Intronic
990444490 5:55881490-55881512 AAGGGAAGAATCAAGGGAAATGG - Intronic
991369439 5:65902963-65902985 TAGGGAATTTACTAGGGTAACGG - Intergenic
991617179 5:68509018-68509040 TAAAAAATAAACAAGAGGAAGGG + Intergenic
993358666 5:86946201-86946223 TAGGGAGTAGACAATGAGAAGGG + Intergenic
995661167 5:114484781-114484803 TAGGGAATTAGAAAGGGGATGGG + Intronic
996003864 5:118397321-118397343 TAGGTACTGAAAAAGGGGAAAGG + Intergenic
996065607 5:119075669-119075691 TAGGAAATTAACAAGGAAAAAGG - Intronic
996126820 5:119735401-119735423 TAGAGAATAAACAAATGCAAAGG - Intergenic
996953480 5:129156089-129156111 AAGGGAAGAAACATGGGAAAGGG - Intergenic
997284054 5:132665704-132665726 TCGGGACGAAACAAGGGGAGGGG + Intergenic
997992493 5:138557104-138557126 TAAGGTATAAACAACGGGGAAGG + Intronic
998082833 5:139291215-139291237 TAGGCAATTAACTAGGTGAAGGG - Intronic
998364610 5:141621169-141621191 CAGGGAAGAAATAAGGGGCAAGG + Exonic
1000963235 5:167625550-167625572 TAAGGAATAAACAAAGGTAGAGG + Intronic
1001335833 5:170795803-170795825 AAGGGAAGAAATAAGGGCAATGG + Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1004238883 6:13900918-13900940 AAGGTAACAAACAAGTGGAAGGG + Intergenic
1004699577 6:18066398-18066420 TAGGAAATTAACAAGGGCTATGG - Intergenic
1005025168 6:21455709-21455731 TCGGGAATAAGCAAGGGAAGAGG - Intergenic
1005741608 6:28796121-28796143 TAGGGAATTAACAATGGAATTGG - Intergenic
1005891360 6:30141493-30141515 CAGGAGAAAAACAAGGGGAATGG + Intronic
1005933548 6:30501135-30501157 TAGGGTCTGGACAAGGGGAAGGG + Intergenic
1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG + Intronic
1006452453 6:34112989-34113011 GAGGGAATGACCAAAGGGAATGG - Intronic
1008117698 6:47571381-47571403 AGGGGAAAGAACAAGGGGAAAGG + Intronic
1008138063 6:47800105-47800127 TACTGATTAAATAAGGGGAATGG + Intronic
1010653059 6:78478368-78478390 AAGGGAAGAATCATGGGGAAGGG - Intergenic
1011220344 6:85048472-85048494 TAGGAAATAAACTAGTGGAGTGG - Intergenic
1012135791 6:95554259-95554281 TAGGCAAGAATCAAGGGGAGAGG - Intergenic
1013959111 6:115876571-115876593 AAGGGAATAAAAAAGAGGAAAGG + Intergenic
1014584082 6:123177020-123177042 TGGAGAATAAAAAAGGGGAGAGG - Intergenic
1014603289 6:123443017-123443039 TAAGGAATAAACAGGTGAAAGGG - Intronic
1014984267 6:127982595-127982617 TAGGGAAGAGCAAAGGGGAAAGG - Intronic
1015238935 6:131002351-131002373 GAGAGAAGAAAGAAGGGGAATGG + Intronic
1017028338 6:150199976-150199998 TGGGGAATAAACAACGAGGAAGG + Intronic
1017089260 6:150743917-150743939 GAGGGAATCAATAAGGGTAATGG + Intronic
1017596002 6:156029210-156029232 TGGGGGATAAAGATGGGGAAGGG - Intergenic
1017930012 6:158943835-158943857 GAGGGAAGAAAGAAAGGGAAGGG - Intergenic
1018219622 6:161565312-161565334 GAGGGAATAAACTTGGGAAATGG - Intronic
1018438484 6:163785615-163785637 TAGGACATATAGAAGGGGAAAGG + Intergenic
1018805257 6:167254367-167254389 TAGGAAAGAAGGAAGGGGAATGG + Intergenic
1019838271 7:3412932-3412954 TAGGGAATCAGCAAGGAGCAAGG + Intronic
1019877878 7:3831071-3831093 GAGGGCACAAACAAGGGGGATGG + Intronic
1020446675 7:8276150-8276172 TAGGCAATGAACACTGGGAAGGG - Intergenic
1020581352 7:10006772-10006794 AAAGGAACAAAGAAGGGGAAAGG - Intergenic
1020770777 7:12391228-12391250 TAGGAAATAAAGAACAGGAATGG - Intronic
1021506365 7:21389825-21389847 AAGGGAAGAATCAAGGGAAAAGG + Intergenic
1021516635 7:21496080-21496102 TAGGGCATAAGCAAGGAGGAGGG + Intronic
1021550389 7:21865486-21865508 TAGGAAATCAACCAGGGGATGGG + Intronic
1021950511 7:25769569-25769591 GAGGGAGGAAAGAAGGGGAAGGG + Intergenic
1022166245 7:27765590-27765612 TAGTGAAGATACAAGGGGAAAGG + Intronic
1022487851 7:30794220-30794242 TAAACAAAAAACAAGGGGAAGGG - Intronic
1022891968 7:34710325-34710347 TAGGGAAGAAAGCAGAGGAAAGG + Intronic
1022925191 7:35049681-35049703 CAGTGAATAAACTAGGTGAAGGG - Intergenic
1023507362 7:40914140-40914162 TAGGGACTGAAAGAGGGGAAGGG - Intergenic
1023954674 7:44874853-44874875 TAAGGTATAAAGAAGGGAAAAGG - Intergenic
1025856598 7:65285785-65285807 GAGGCAATAAACAAGAGGAGAGG + Intergenic
1026048674 7:66926197-66926219 TAGGGATTAAAAAATGGGCAAGG - Intronic
1027235453 7:76295063-76295085 TGGGCAATGAAGAAGGGGAAGGG + Intergenic
1028288171 7:89030659-89030681 TAGGAAAAAGACAAGGGAAATGG - Intronic
1028474399 7:91237914-91237936 TAGAAAAGAAAGAAGGGGAAAGG - Intergenic
1028876255 7:95826675-95826697 AAGGAAATAAAGCAGGGGAAAGG + Intronic
1029936871 7:104434236-104434258 TAGGGCATAAAAAAGGGAAGCGG + Intronic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1030415770 7:109240833-109240855 AAGGGATTAAAAAAGGGAAAAGG + Intergenic
1031067269 7:117118534-117118556 TATGGAATAAGTAAGGGTAAAGG + Intronic
1031404073 7:121362075-121362097 TAGGGAATATATAAATGGAATGG + Intronic
1031698227 7:124888068-124888090 TCTGGAATAAAACAGGGGAAAGG - Intronic
1034009622 7:147515035-147515057 GAGTGAGCAAACAAGGGGAAGGG - Intronic
1034085488 7:148318421-148318443 TAGGCAGTAAACAAGAGGAAGGG + Intronic
1034740670 7:153470817-153470839 GAGGGAATAAACTAAGGGAAGGG + Intergenic
1035446911 7:158949423-158949445 CAGGGAGTAGACAAGAGGAAGGG + Intronic
1035585718 8:771809-771831 TATAGAATAAACAATGGAAAGGG + Intergenic
1036916844 8:12812387-12812409 AAGTGAATAATCAATGGGAAGGG - Intergenic
1037988487 8:23304316-23304338 TTCAGAATAAACAAGGGAAACGG + Intronic
1038517960 8:28203062-28203084 AAGTGAATAAACCACGGGAAAGG - Intergenic
1040499410 8:47993677-47993699 TAGGGATTTTAAAAGGGGAAGGG + Intergenic
1040901668 8:52423455-52423477 TTGGGAAGCATCAAGGGGAACGG - Intronic
1041605625 8:59779602-59779624 TAGGGAAGAATGAAGGGAAAGGG + Intergenic
1045842000 8:106591468-106591490 GAGGTAGGAAACAAGGGGAAAGG + Intronic
1047153975 8:122296346-122296368 AAGGGGATAAAGAAAGGGAAGGG + Intergenic
1047584443 8:126254528-126254550 TAGTGAATAAAATAGGGCAAAGG - Intergenic
1047782330 8:128120206-128120228 TAGGGAATAAATAATGGAATGGG - Intergenic
1049904432 9:202881-202903 TAGGGAAGAAAAATGAGGAAGGG + Intergenic
1050052109 9:1613365-1613387 TAGGGAATAAAGAAGAGAGAAGG - Intergenic
1050387287 9:5104205-5104227 GAGGGAATAAAAAATGGTAAAGG + Intronic
1050984414 9:12064018-12064040 TTTGGCAAAAACAAGGGGAAAGG + Intergenic
1051830558 9:21271274-21271296 GAGGAAACAAACAAGTGGAAAGG - Intergenic
1052137207 9:24927526-24927548 TAGAGGATAAACAGGAGGAAGGG + Intergenic
1052362654 9:27576840-27576862 TAGGGAAGGACCAAGGGAAAGGG - Intergenic
1052797623 9:32938060-32938082 TGGGGAATAGAAAATGGGAAAGG - Intergenic
1053144436 9:35702977-35702999 TAAGGAATAAACAAGTGGGTAGG + Intronic
1053727004 9:41014455-41014477 TAGGGAAGAAAAATGAGGAAGGG + Intergenic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1057541814 9:95980756-95980778 AAGAGAATAAACAAAGAGAAAGG + Intronic
1057810485 9:98253443-98253465 TAGAGAAGAAACTAGGGGAAGGG - Intronic
1057959557 9:99441239-99441261 AAGTGAATAAACTGGGGGAAAGG - Intergenic
1060045798 9:120339159-120339181 GAGGGAAGAAAAAAGAGGAAGGG + Intergenic
1060321638 9:122567255-122567277 TAGGAAATATTCATGGGGAAAGG + Intergenic
1186256199 X:7723221-7723243 TAAGGAATAAACAAGGACATTGG + Intergenic
1187295617 X:17997372-17997394 TAGGGACTAAACAAGGGAACAGG + Intergenic
1189548888 X:42072589-42072611 TGGGGAAGAGACAAGGGGAAGGG + Intergenic
1190692902 X:52926688-52926710 TTGGGAATATTCAAGGGAAAAGG + Intronic
1192192296 X:68998643-68998665 GAGGGAATAACCAAGTGCAATGG + Intergenic
1192234204 X:69285725-69285747 TAAGGAAGAAAGGAGGGGAAAGG + Intergenic
1193318463 X:80092486-80092508 TGGGGATTAAATAAGGGGTAAGG + Intergenic
1193601168 X:83509574-83509596 AAGGGAAAGAAAAAGGGGAAAGG - Exonic
1193946341 X:87740573-87740595 GGGGGAATAAAAAAGGAGAAAGG + Intergenic
1194494682 X:94599912-94599934 CAGGAAATGCACAAGGGGAAAGG + Intergenic
1194527460 X:94994958-94994980 TAGGGATTTTAAAAGGGGAAGGG + Intergenic
1194726444 X:97403515-97403537 TAGGGACTAAAAAAGAGAAATGG - Intronic
1194992950 X:100564183-100564205 AAGGGGAAGAACAAGGGGAATGG + Intergenic
1195117013 X:101709351-101709373 GAGGGAATAAAGAAGTGGGAAGG + Intergenic
1195981464 X:110582754-110582776 TAGGGATTTCAAAAGGGGAAGGG - Intergenic
1196428764 X:115599992-115600014 TAGGGAATAAACAAGTGCCTGGG - Intronic
1197263512 X:124341667-124341689 AAGGGAAAAAAGAGGGGGAAAGG + Intronic
1199265191 X:145820186-145820208 GAGGGAATCAACCAGGGAAAAGG - Exonic
1199899024 X:152154865-152154887 GAGGGAAAAAACAGGGGAAACGG - Intergenic
1200250390 X:154550645-154550667 TAGGGAGGAAACCAGGAGAAGGG + Intronic
1201352281 Y:13057030-13057052 TATGGTATAAAGAAGGGGACCGG + Intergenic
1201745481 Y:17367886-17367908 GACAGAATAAACAAAGGGAAGGG + Intergenic