ID: 1006205594

View in Genome Browser
Species Human (GRCh38)
Location 6:32339039-32339061
Sequence GACTCAAGGGTGTTTATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006205590_1006205594 29 Left 1006205590 6:32338987-32339009 CCTGCAGTTCTGGCTAAAATACA 0: 1
1: 0
2: 4
3: 22
4: 215
Right 1006205594 6:32339039-32339061 GACTCAAGGGTGTTTATCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006205594 Original CRISPR GACTCAAGGGTGTTTATCTC AGG Intronic
905234603 1:36537241-36537263 GACTTAAGGGTGTCTATATATGG + Intergenic
910472224 1:87566951-87566973 GTCTCAATGGTGTTCATGTCAGG - Intergenic
911365627 1:96934250-96934272 GACTCAAGTGTGTTTGGCACAGG + Intergenic
913204729 1:116527514-116527536 GACTAAGTGGTATTTATCTCAGG - Intronic
923477803 1:234352885-234352907 GACCAAATGGGGTTTATCTCAGG + Intergenic
923570015 1:235104993-235105015 AACTCAAGGGTGTGTGTGTCAGG + Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1064908836 10:20378237-20378259 AACTCAAGTGGGTTTATCTGGGG - Intergenic
1065426604 10:25611633-25611655 GACTAAATGGGATTTATCTCAGG - Intergenic
1065461880 10:25975721-25975743 GACTGAATGGAGTTTATTTCAGG + Intronic
1065869536 10:29944728-29944750 GAGTCAGGTGTGTTTACCTCCGG - Intergenic
1067194617 10:44105699-44105721 GACTGAATGGTCTTTTTCTCAGG - Intergenic
1071323919 10:84492792-84492814 GACTAAAGGGGGTTTATTTCAGG - Intronic
1074243109 10:111658832-111658854 ACCTCATGGGTGTGTATCTCAGG - Intergenic
1075475188 10:122728198-122728220 GACTTAAGGGTCTCTATTTCAGG + Intergenic
1076320005 10:129571294-129571316 GACTTAGGGGTGTTTATTACAGG - Intronic
1078339798 11:10490598-10490620 AACTCAAGGGTGATTATTTTAGG - Intronic
1078725251 11:13924275-13924297 GTCTCAATGTTGTTTATCACAGG - Intergenic
1082277310 11:50235880-50235902 GACCCATGGGTGTTAATTTCTGG + Intergenic
1087336892 11:96854800-96854822 CACTACAGGGTGTATATCTCTGG + Intergenic
1087452057 11:98336901-98336923 GACTAAATGGTATTTATTTCTGG - Intergenic
1094696767 12:32827143-32827165 AACTCCGGGGTGTTTATTTCGGG + Intronic
1098700948 12:73625060-73625082 GACTCATGGATGTTTCTCCCTGG - Intergenic
1100590816 12:96027011-96027033 AACTCAATGGTGGTTACCTCTGG + Intronic
1103887790 12:124215886-124215908 AACTCAAGCGTGTTTCCCTCTGG + Intronic
1104077292 12:125401198-125401220 GAATGAAGGGTCTTTATCTAAGG - Intronic
1105446445 13:20461759-20461781 GTCTCAAGAGTGTTTCTTTCTGG - Intronic
1105653955 13:22413939-22413961 CACTCAAGAGTTTTTATTTCTGG + Intergenic
1106467923 13:30029260-30029282 GAATCAAGGATGTTTGTTTCTGG + Intergenic
1108236542 13:48413761-48413783 AACTCAAGAATGTTTATCTTTGG + Intronic
1108588122 13:51889079-51889101 TGTTCAAGGGTGTTTATCACAGG - Intergenic
1109489319 13:63075296-63075318 GAGTACAGGCTGTTTATCTCAGG + Intergenic
1112032063 13:95465993-95466015 GACTAAATGGGATTTATCTCAGG - Intronic
1115056771 14:29137468-29137490 GACTAAATGGGGTTTATCTCAGG - Intergenic
1116495733 14:45557886-45557908 GGCTAAATGGTGTTTGTCTCAGG + Intergenic
1120031300 14:79644468-79644490 GACTGAAGGAAGTTTATCTGAGG + Intronic
1123124305 14:105934745-105934767 GACTAAATGGGGTTTGTCTCAGG + Intergenic
1127026229 15:54810053-54810075 GACTCAAGGGTTTTTCTGCCAGG - Intergenic
1128899073 15:71402724-71402746 GGCTCATAGGTGTTTATTTCTGG - Intronic
1129423896 15:75451346-75451368 GACTCGAGGGTGTGTATTTTGGG - Intronic
1130463712 15:84178711-84178733 CACTCAAGGGTTTTTTTCTCAGG + Intronic
1130500554 15:84494831-84494853 CACTCAAGGGTTTTTTTCTCAGG - Intergenic
1132182944 15:99775483-99775505 GACTAAATAGAGTTTATCTCAGG - Intergenic
1134384750 16:13761172-13761194 AGATCAAGGGTGTTTATTTCAGG + Intergenic
1136019537 16:27431147-27431169 GACTCATGGGCATTTTTCTCTGG + Intronic
1138210249 16:55157348-55157370 GACTCAATGGAGTTTGGCTCTGG - Intergenic
1144182423 17:12764589-12764611 GAACCCAGGGTGTTTATCCCAGG - Exonic
1144435598 17:15237262-15237284 GACTTAAGGGTTCTTATCTCTGG + Intronic
1146834478 17:36099192-36099214 GACTCAACTGTTTTTAGCTCAGG - Intergenic
1147542495 17:41372278-41372300 GACACAAGGATACTTATCTCTGG - Intronic
1149110514 17:53022841-53022863 GCCTCAAGGGTGTTTCTCCCAGG + Intergenic
1149778069 17:59373748-59373770 GACTCAAAGCTGTTTTGCTCAGG + Intronic
1151047321 17:70936525-70936547 GACTCATGGTTTCTTATCTCAGG + Intergenic
1157509267 18:48257707-48257729 GACTAAGTGGTATTTATCTCAGG + Intronic
1161673687 19:5629651-5629673 CACACAAAGGTATTTATCTCTGG - Intronic
1161936526 19:7375819-7375841 GACTCAAGGGTGTCTCTCTGGGG + Exonic
1166182507 19:41118919-41118941 GTCTCAGATGTGTTTATCTCTGG - Intronic
1167137515 19:47626038-47626060 GAGTCAAGTGTGTGTTTCTCTGG - Intronic
926882335 2:17560232-17560254 GACACAAGGGTTTTTATTTTAGG + Intronic
926898013 2:17716417-17716439 GACTCCAGACTGTTTTTCTCTGG - Intronic
929057649 2:37892208-37892230 GACTCAAAGGACTCTATCTCAGG + Intergenic
929774880 2:44923330-44923352 GGCTCAAGGGTGTTTCTGTTGGG - Intergenic
935690971 2:105732265-105732287 TACTCAGGGGAGTTTGTCTCCGG - Intergenic
938621718 2:133061838-133061860 GGCTCAAGTGTGTTGATCTAAGG - Intronic
947213727 2:227730993-227731015 GACTCAAGTGTGTTTCTGTAGGG + Intergenic
1177066870 21:16448999-16449021 GACTAAATGGGATTTATCTCAGG - Intergenic
951363630 3:21753641-21753663 GATACAAAGTTGTTTATCTCTGG + Intronic
953784406 3:45899808-45899830 GACTCAAGGGCTTACATCTCAGG + Intronic
960896053 3:122506639-122506661 GATTCATAGGTGTTCATCTCTGG + Intronic
978109406 4:104944651-104944673 GACTCTTGGGTGTTAATCTGGGG - Intergenic
981648193 4:147023974-147023996 CACTCCAGGTTGTTTGTCTCAGG + Intergenic
986012555 5:3729210-3729232 CACTCAAGGGTGCTTATCCCTGG - Intergenic
986429028 5:7663566-7663588 GAATTAAGGGTGTTTATTCCAGG + Intronic
990910506 5:60846787-60846809 GACTCCAGGGTGTTTGCCTTGGG + Intergenic
992133105 5:73714824-73714846 GTCTAAATGGTGTTTATCTTTGG - Intronic
994578403 5:101609935-101609957 GGCACAACGGCGTTTATCTCAGG - Intergenic
995951832 5:117723842-117723864 GACTAAATGGGGTTTATTTCTGG - Intergenic
999616898 5:153434398-153434420 GACTCAAGGGTCTGTGTCACTGG + Intergenic
1006205594 6:32339039-32339061 GACTCAAGGGTGTTTATCTCAGG + Intronic
1014635360 6:123839747-123839769 GATTCATGGGTATTTATCTAGGG + Intronic
1019452336 7:1106283-1106305 GACTCAAGGGTGTGTGTGTCTGG + Intronic
1021816790 7:24454836-24454858 GCATCAAGGGTGTCTACCTCTGG - Intergenic
1022552568 7:31255163-31255185 GTCTCTAGGGGGTTTCTCTCTGG - Intergenic
1024247066 7:47478384-47478406 GACTCATGCATGTTCATCTCAGG + Intronic
1032772715 7:135075572-135075594 AACTCCTGGGTTTTTATCTCAGG - Intronic
1034205365 7:149309880-149309902 GACTCAAGTCTTTTTCTCTCTGG + Intergenic
1035753634 8:2013442-2013464 GACTAAAGGGGATTTATCCCAGG - Intergenic
1040602897 8:48901925-48901947 GATTTTAGTGTGTTTATCTCTGG + Intergenic
1040904993 8:52459258-52459280 GATTCTAGGATGTTTATCTAAGG - Intronic
1042993753 8:74669914-74669936 GACTCCAGTGTGTCTATATCTGG + Intronic
1048546969 8:135396344-135396366 GAATCAAGGGTGTTAACCTGGGG + Intergenic
1049014347 8:139908878-139908900 GAGTTACCGGTGTTTATCTCTGG - Intronic
1049289687 8:141795220-141795242 GACTCAAGAGTTTTGTTCTCTGG - Intergenic
1049975234 9:855103-855125 GTCTCAATTTTGTTTATCTCAGG + Intronic
1052198832 9:25752459-25752481 CACTGAATGGTGTTTATTTCTGG - Intergenic
1057228764 9:93306197-93306219 GACTCGAGGGTTTCTATCTAGGG - Intronic
1058515435 9:105768267-105768289 GACTAAATGGGGTTTATCACAGG - Intronic
1189763903 X:44349678-44349700 GAGTCAGGGGTTCTTATCTCTGG - Intergenic
1190424465 X:50319947-50319969 GACAAAATGGGGTTTATCTCAGG - Intronic
1190797613 X:53759613-53759635 GATTCAAGGGTGGGTGTCTCAGG - Intergenic
1190931335 X:54951481-54951503 GATTCAAGGGTGGGTCTCTCAGG + Intronic
1190939153 X:55024278-55024300 ATCTCAAGGGTGATTATCTTGGG + Intronic
1193085078 X:77441786-77441808 GTCTCAATGGTGTATATCTAGGG - Intergenic
1193649051 X:84108634-84108656 GATTCAAGGGGGTTTACCTATGG - Intronic
1194167546 X:90538274-90538296 ATCTCAAGGGTTTTTCTCTCTGG - Intergenic
1196097934 X:111819420-111819442 GACTCAAGGATTTACATCTCTGG - Intronic
1196720491 X:118849152-118849174 GACTCAAAAATGTTTATCTTTGG - Intergenic
1196817982 X:119680175-119680197 AAATTAAGAGTGTTTATCTCTGG - Intronic
1198034246 X:132784987-132785009 GACTCAGGGGTCCATATCTCTGG - Intronic
1198517061 X:137420280-137420302 GTCTCAAGGGTGTTAAACACTGG + Intergenic
1200513805 Y:4116053-4116075 ATCTCAAGGGTTTTTCTCTCTGG - Intergenic