ID: 1006206139

View in Genome Browser
Species Human (GRCh38)
Location 6:32344845-32344867
Sequence AGCCCCAAAAAAAAAACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 352}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006206139_1006206151 14 Left 1006206139 6:32344845-32344867 CCTTAGGTTTTTTTTTTGGGGCT 0: 1
1: 0
2: 0
3: 31
4: 352
Right 1006206151 6:32344882-32344904 AGGGTTTCACTCTGTTGCCCAGG 0: 229
1: 6213
2: 36209
3: 142322
4: 324348
1006206139_1006206150 -5 Left 1006206139 6:32344845-32344867 CCTTAGGTTTTTTTTTTGGGGCT 0: 1
1: 0
2: 0
3: 31
4: 352
Right 1006206150 6:32344863-32344885 GGGCTGGGGTGGGGGGGACAGGG 0: 1
1: 3
2: 27
3: 471
4: 3269
1006206139_1006206152 28 Left 1006206139 6:32344845-32344867 CCTTAGGTTTTTTTTTTGGGGCT 0: 1
1: 0
2: 0
3: 31
4: 352
Right 1006206152 6:32344896-32344918 TTGCCCAGGTTGAAGTTCAGTGG No data
1006206139_1006206149 -6 Left 1006206139 6:32344845-32344867 CCTTAGGTTTTTTTTTTGGGGCT 0: 1
1: 0
2: 0
3: 31
4: 352
Right 1006206149 6:32344862-32344884 GGGGCTGGGGTGGGGGGGACAGG 0: 1
1: 2
2: 39
3: 579
4: 4203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006206139 Original CRISPR AGCCCCAAAAAAAAAACCTA AGG (reversed) Intronic
901127202 1:6938099-6938121 AGCCCCTAAATAAAAAGGTATGG - Intronic
903312487 1:22470567-22470589 AGCGTCAAAAGAAAAGCCTATGG + Intronic
903578969 1:24357052-24357074 CCCCCCAAAAAAAAAATCCATGG + Exonic
904555652 1:31361755-31361777 CTCCCCAAAAAAAACACCTATGG - Intronic
904659973 1:32076932-32076954 AGCCCCAAGGAAATACCCTAAGG - Intronic
905428858 1:37906877-37906899 AGAAAGAAAAAAAAAACCTATGG + Intronic
906438586 1:45819606-45819628 AGCTGCAAATAAAATACCTAGGG + Intronic
907362231 1:53927295-53927317 GGCCCTAGAAAAAAGACCTATGG - Intronic
908093396 1:60710528-60710550 AGCTTCAAATAAATAACCTAAGG + Intergenic
908277206 1:62486318-62486340 AGACCCAAATAGAAAACCTTGGG - Intronic
909727430 1:78852141-78852163 ATCACAAAAATAAAAACCTAAGG + Intergenic
910196008 1:84640243-84640265 AAACCCAAAATAAAATCCTAAGG - Intergenic
910204693 1:84737421-84737443 CTCCTTAAAAAAAAAACCTAGGG + Intergenic
910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG + Intergenic
910998852 1:93140412-93140434 TGCCACAGAAAAAAAACCAAAGG - Intergenic
911316507 1:96362462-96362484 AGCCCACAAATAAAAACCAAAGG + Intergenic
911719796 1:101178261-101178283 AATCCAAAAAAAAAAACCTTAGG - Intergenic
912041753 1:105398879-105398901 AGCCCCAAAAAAGCAACATTTGG + Intergenic
912146607 1:106801798-106801820 ATTCCCTAAAAAAAAACCTTTGG + Intergenic
912864068 1:113241190-113241212 ACCCCTAAAAAAAAAAACCAGGG - Intergenic
913718500 1:121565191-121565213 AGCACCAAAAAAAAAAGGTGGGG - Intergenic
914315000 1:146501665-146501687 AGCACAAAAATAAAAACCAAAGG - Intergenic
914499354 1:148231714-148231736 AGCACAAAAATAAAAACCAAAGG + Intergenic
915519321 1:156432184-156432206 AGGACAGAAAAAAAAACCTAGGG + Intergenic
915764665 1:158350788-158350810 AGCCTCAAAATTAAAAACTAGGG + Intergenic
916912833 1:169369277-169369299 AGTCTCAAAAAAAAAAATTAGGG - Intronic
917104775 1:171481320-171481342 CCCCGCAAAAAAAAAACCTTTGG - Intergenic
917502410 1:175597779-175597801 AGGCCCAAAAGAAAAACAGATGG + Intronic
918096399 1:181338501-181338523 AGCCACAAAAAAAAAAAAAATGG - Intergenic
918369448 1:183844563-183844585 AGTTCCAAAAAAAACTCCTATGG - Intronic
918814537 1:189166097-189166119 AGCCAAAAAAAAAAAAAGTAGGG - Intergenic
919047284 1:192469355-192469377 ATCCTCAAAAAACAAATCTAAGG - Intergenic
923396031 1:233565039-233565061 AGCTACAGAAAAAAAACCTAAGG + Intergenic
923857819 1:237863770-237863792 AGCCCCAAAGAGAAAACCCAAGG - Intergenic
923875662 1:238044197-238044219 AAACCCAAAAAAAAAAACTTAGG + Intergenic
924222511 1:241892849-241892871 AAACAAAAAAAAAAAACCTATGG + Intronic
924503853 1:244662414-244662436 AGCCCAATTAAAAAAATCTATGG - Intronic
1063397576 10:5704961-5704983 AGCCCCAAAACAAAACCTAATGG - Intronic
1063403119 10:5767189-5767211 AGGCCAAAAAAAAAAAACTCTGG + Intronic
1063986690 10:11512102-11512124 TGCCCCCAAAAAATAAGCTAGGG + Intronic
1064233296 10:13549003-13549025 CCCCCCTAAAAAAAAACCTAAGG - Intergenic
1066679255 10:37920834-37920856 AGCCACAAAAAGAATACCTAGGG + Intergenic
1068243947 10:54340764-54340786 TGCCCCAAAAGAAAAATCAAGGG - Intronic
1068647893 10:59489567-59489589 AGCCATAATAAAAAAAACTATGG - Intergenic
1070852481 10:79577472-79577494 ACCCCCAAAATAAAATACTAGGG + Intergenic
1070935551 10:80291982-80292004 CCCCCCAATAAAAAAACATAAGG - Intergenic
1072206478 10:93209738-93209760 CCCCCCAAAAAAAAAACCTGGGG + Intergenic
1072293853 10:93991612-93991634 AGCCCCAAGAAACAATCCTGTGG - Intergenic
1073092281 10:100952239-100952261 ATCTCAAAAAAAAAAACCTTAGG + Intronic
1073271280 10:102266233-102266255 TGTCTCAAAAAAAAAAACTAAGG + Intronic
1073823148 10:107289121-107289143 AACTTCAAATAAAAAACCTAAGG - Intergenic
1074634399 10:115296677-115296699 AGACGTAAAAAAAAAACTTAAGG - Intronic
1074968565 10:118516215-118516237 AGACCGAAAAAAATAACTTAAGG + Intergenic
1077085963 11:751042-751064 ACCCCAAAAACAAAAACCCAAGG - Intronic
1078279302 11:9883850-9883872 AGCCTCCAAAAAATAACTTAGGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079878974 11:25899765-25899787 GAGACCAAAAAAAAAACCTAGGG + Intergenic
1080302122 11:30796441-30796463 AGCCCCAAAATAAAGATCTGGGG - Intergenic
1080699166 11:34629853-34629875 AGCAAGAAAAAAAAAACCTTGGG - Intronic
1082646212 11:55729826-55729848 AGCACCAGGAAAAAATCCTAAGG + Intergenic
1083714181 11:64566246-64566268 AGGAAAAAAAAAAAAACCTAAGG + Intronic
1084619777 11:70261904-70261926 CGTCTCAAAAAAAAAAGCTAGGG - Intergenic
1085608707 11:77926806-77926828 AGCCTCAAAAAAAAAAAAAAAGG + Intronic
1087006226 11:93474804-93474826 ACTTCCAAAAAAAAAACCTGAGG + Intergenic
1087335357 11:96837380-96837402 AGATTAAAAAAAAAAACCTAGGG + Intergenic
1087564093 11:99831608-99831630 TGCACCAAAAAAAAAAGTTATGG - Intronic
1089457278 11:118632990-118633012 AGCTCCAAAAAAAAAAAAAAAGG - Intronic
1090577891 11:128128517-128128539 ACACCCAAAAAAAATGCCTATGG + Intergenic
1090879241 11:130818973-130818995 AACCCTTAAAAAAAAACATAGGG - Intergenic
1091375656 12:23173-23195 ATCCCCAACAAAAAAGCCCACGG + Intergenic
1091642083 12:2244970-2244992 AGCCCCAGAGAAAAACCCTGTGG - Intronic
1093335595 12:17901158-17901180 AACCCCAGAAAAAAAATCTTGGG - Intergenic
1093760860 12:22907974-22907996 AACCACAAAGCAAAAACCTATGG + Intergenic
1093868074 12:24252500-24252522 AGGCCAAAAAAAAAAAGTTAAGG + Intergenic
1094274273 12:28653679-28653701 AACCACAAAGCAAAAACCTATGG - Intergenic
1095733631 12:45533030-45533052 CGCCCTAAAAATAAAACCTTAGG - Intergenic
1098119116 12:67216941-67216963 AGCAAAAAAAAAAAAATCTATGG - Intergenic
1098307257 12:69114638-69114660 AGCCCCAAAAGACAAACCACTGG - Intergenic
1098610542 12:72452184-72452206 ATCTACAAAAAAAAAACCTCAGG - Intronic
1100342476 12:93693065-93693087 AACCATAAAACAAAAACCTATGG + Intronic
1100978227 12:100143576-100143598 ACACCAAAAACAAAAACCTAAGG - Intergenic
1101004787 12:100391042-100391064 AGCCCCAGAAAAAAGATCCATGG - Exonic
1101167898 12:102057667-102057689 AGCTACAAAAAAAATACATAGGG + Intronic
1101349605 12:103916642-103916664 AGCTCAGAAAAAAAAAACTATGG + Intergenic
1101599871 12:106199933-106199955 AGCCCCAAAAACAAAAAGAATGG + Intergenic
1101655868 12:106719673-106719695 AGCCTGAAAAAAAAAGACTAAGG + Intronic
1102461153 12:113100293-113100315 ACCCCCAAAAAAAGAAGCTAAGG - Intronic
1102818662 12:115889189-115889211 ATCTCAAAAAAAAAAATCTAGGG + Intergenic
1105275802 13:18924238-18924260 ATCTCCAAAAAGAAAAACTAAGG - Intergenic
1106611660 13:31288682-31288704 AGCACCAAAAATAAAAGCCAAGG + Intronic
1107522500 13:41197311-41197333 AGCTTCAAAAAGAAAACATAGGG + Intergenic
1108480294 13:50863008-50863030 AACCCCTAGAAGAAAACCTAGGG + Intergenic
1108841361 13:54620490-54620512 AGCCACAAAAACAAACCCTAAGG - Intergenic
1109830505 13:67781025-67781047 CTCCCCAAAAGAAAAACCTGAGG - Intergenic
1110566431 13:76961582-76961604 ACCCTCAAAAAAAAATCCAAAGG + Intergenic
1111164076 13:84434513-84434535 AGACCCAATAAAAAATCCAATGG - Intergenic
1111865856 13:93767981-93768003 AAGCACTAAAAAAAAACCTAAGG + Intronic
1112522068 13:100105120-100105142 GGCCCAAAAAAAAGAATCTAAGG - Intronic
1112814773 13:103259521-103259543 AGCTACAGAAAAAAAAACTAAGG - Intergenic
1112818030 13:103296355-103296377 AGCAAAAAAAAAAAAAACTAAGG + Intergenic
1112985087 13:105438866-105438888 TGCCTGAAAAAAAAAAACTATGG + Intergenic
1113358278 13:109603829-109603851 AGCCCCAAAATCAAAACCCTTGG + Intergenic
1114784359 14:25578392-25578414 AACAACAACAAAAAAACCTAAGG + Intergenic
1115202292 14:30867973-30867995 AGCCACAAATAAAAAACCAATGG + Intergenic
1117661623 14:58012077-58012099 TGCCCCTAAAAATAAACCAATGG + Intronic
1119629627 14:76216652-76216674 AGCTCCAGAAAAAAAACTGATGG - Intronic
1120248715 14:82036135-82036157 AGCCCAAAAAAAACAATATAAGG - Intergenic
1120669382 14:87346793-87346815 AGCCCCAAACCAGAGACCTAGGG - Intergenic
1121182959 14:91943206-91943228 TGCTTCAAAAAAAAAAGCTAAGG + Intronic
1121364850 14:93299773-93299795 AGCCCCAAAAAGAAAGCCCTAGG + Intronic
1121856513 14:97275316-97275338 AGCAGGAAAAGAAAAACCTATGG - Intergenic
1122221895 14:100244584-100244606 TGCCTCAAAAAAAAAAAGTAAGG - Intronic
1202832981 14_GL000009v2_random:57357-57379 CGTCCCAAAAAAAAAACCCAGGG + Intergenic
1123690501 15:22834884-22834906 AGCCTCAAAAAAAAAAAAAAAGG - Intergenic
1124609789 15:31200603-31200625 ATCCCTAAAAAAGAAACCAATGG - Intergenic
1125048264 15:35268520-35268542 AGCTCTAAAAAAAAAAACAATGG + Intronic
1125375436 15:39024030-39024052 AGAAAAAAAAAAAAAACCTAAGG - Intergenic
1126203218 15:46013301-46013323 AGCCCTACAAGAAAAACTTAAGG - Intergenic
1127011728 15:54638342-54638364 AACTACAAAACAAAAACCTATGG + Intergenic
1127080611 15:55374961-55374983 GGCCCCAAAACAAAAACTTTTGG + Intronic
1127159130 15:56162581-56162603 AGCCCCAAAAAAATAAGTTCTGG - Intronic
1128826054 15:70718387-70718409 ATCCCCAAAGCAATAACCTAGGG - Intronic
1128969065 15:72090566-72090588 AGCCCCTAAATAAAAGCCTAGGG + Intronic
1129095828 15:73206498-73206520 TGTCCCAAGAAAAAAAGCTAGGG + Intronic
1130233724 15:82115540-82115562 AGCCCCAACATCATAACCTATGG + Intergenic
1130706700 15:86239627-86239649 AGACCCAAATAAATAGCCTATGG - Intronic
1130937159 15:88480211-88480233 AAAACCAAAATAAAAACCTATGG - Exonic
1130990029 15:88870716-88870738 ACCCCCAAAATAAAAAGCCAGGG + Intronic
1132033760 15:98461882-98461904 AGCTGCAAAAAAAAAAACTTAGG + Intronic
1132212590 15:100035500-100035522 AACCCCAAAACAGAAACATAAGG - Intronic
1132303708 15:100793077-100793099 AGCCAGAAAAAAAATACATATGG + Intergenic
1132369898 15:101288606-101288628 AGCAAAAAAACAAAAACCTATGG + Intronic
1133802391 16:9093677-9093699 ACCACCATAAAACAAACCTATGG - Intronic
1133914715 16:10098935-10098957 CCCCCCCCAAAAAAAACCTATGG + Intronic
1135870219 16:26142904-26142926 TGCCCTAGAAAAAAAAGCTATGG - Intergenic
1136286883 16:29249373-29249395 AGCCCCAAAAAATAAGCCCACGG - Intergenic
1137528199 16:49255569-49255591 AGATCAAAAAAAAAAACCCAAGG + Intergenic
1139113186 16:63917702-63917724 AGCCACAAGAAAAAAACCCAAGG + Intergenic
1139246666 16:65451537-65451559 AACAACAAAAAAAAAACCTATGG + Intergenic
1139659781 16:68412633-68412655 AGCCCAAAAGAAAAACTCTAAGG + Intronic
1139721992 16:68863605-68863627 AGTCTCAAAAAAAAGACTTATGG + Intronic
1140311066 16:73848944-73848966 AGCCTCAAAAGAAAACCCTTGGG - Intergenic
1141106006 16:81234352-81234374 ACCCCCACAAAAAAAACTAATGG - Intergenic
1141245200 16:82300826-82300848 AGCCCCCAACAAAAAACCCAGGG - Intergenic
1142092483 16:88222008-88222030 AGCCCCAAAAAATAAGCCCACGG - Intergenic
1143683741 17:8496946-8496968 AGCCCCTAATAAAAACCCTGGGG + Intronic
1147032249 17:37648551-37648573 AGCACCAAGCAAAAAACATAAGG - Intergenic
1149616083 17:58000581-58000603 AGCCACAAGAAAAAAAGGTATGG - Intronic
1152114394 17:78376507-78376529 AGTCTCAAAAAAAAAAGATATGG - Intergenic
1152972453 18:176154-176176 CCCCCCAAAAAAAAAACATTTGG + Intronic
1153562984 18:6390845-6390867 AGCACCAACAACAAAACCTAGGG + Intronic
1154147579 18:11879157-11879179 AGCATTAAAAAAAAAACTTATGG - Intronic
1155864486 18:30947867-30947889 AGCCCTAAAGAAACAACATAAGG - Intergenic
1156141102 18:34112366-34112388 CCCCCCAAAAAAAAAAGATATGG + Intronic
1157683716 18:49626716-49626738 CCCCCCAAAAAAAAATCCTCTGG + Intergenic
1157866733 18:51194423-51194445 AGCCCTCAAAAGAAAAACTAAGG + Intronic
1158964168 18:62609118-62609140 AAAACCAAAAAAAAAACCTCAGG + Intergenic
1162171732 19:8795095-8795117 AGCCACAACAACAAAACCTGGGG + Intergenic
1162409442 19:10496497-10496519 ACCCCCAAAAAAAAAAAAAAGGG + Intronic
1162438188 19:10675940-10675962 AGTCTCCAAAAAAAAACCAATGG - Intronic
1163915319 19:20236168-20236190 AGGCCCAGAAAAAAAACTGAAGG + Intergenic
1163958677 19:20666845-20666867 AGGCCCAGAAAAAAAACTGAAGG - Intronic
1168041291 19:53761094-53761116 ATTCCAAAAAAAAAAACCCACGG + Intergenic
1168380653 19:55919615-55919637 AGCTTAAAAAAAAACACCTAAGG + Intronic
1168458234 19:56532168-56532190 AGCCAAAAAAAAAAAAACCAAGG - Intergenic
925752235 2:7099115-7099137 AGACCCAGAAGCAAAACCTAAGG - Intergenic
925909039 2:8560011-8560033 AACCACAAGAAAAAAACCTGTGG + Intergenic
926121709 2:10244841-10244863 AGCTTTAAAAAAAAATCCTATGG + Intergenic
926419556 2:12682991-12683013 AGCACAAAAAAAAAAAAATAGGG - Intergenic
927248853 2:20980562-20980584 AGCCCCAAAAAGTAAAACCAGGG + Intergenic
927836523 2:26403302-26403324 AACACCAAAAAGAAACCCTAAGG - Intronic
929217285 2:39428677-39428699 TGCCTCAAAAAAAAAATCTTTGG + Intronic
932191315 2:69743218-69743240 ATCTCAAAAAAAAAAATCTAGGG - Intronic
932481861 2:72045924-72045946 AGCCCAGAAAAAAAAACCCTTGG - Intergenic
932484797 2:72077690-72077712 ATCCCCAGAGAAAAGACCTATGG + Intergenic
933237071 2:79875725-79875747 ATCCTCACAAAAAAAACCTTAGG - Intronic
933387188 2:81625725-81625747 AACAACAAAAAAAAAACCTGAGG + Intergenic
933756429 2:85642514-85642536 AGGCCCATAAAAGAAACCAATGG - Intronic
935310294 2:101776582-101776604 CCCCCCAAAAAAAAACACTATGG + Intronic
936618213 2:114070149-114070171 AGCCAAAAAAAAAAAAAATAGGG - Intergenic
936977674 2:118235680-118235702 AGCCCCCAATAAAAAAGCTTGGG - Intergenic
937733737 2:125264353-125264375 AGCAACAAAAATAAATCCTATGG - Intergenic
938301805 2:130219999-130220021 AGCCCCCAAAGAAAAACCTGTGG - Intergenic
941356625 2:164501155-164501177 AGCCCTAAAATAAGAAACTAAGG - Intronic
941610760 2:167659231-167659253 ACCACCAAAAAAAAAACACATGG - Intergenic
941707647 2:168676978-168677000 AGCCCCAAAAAACAAAGCAATGG - Intronic
942639338 2:178044844-178044866 ATCCCCCAAAAAAACATCTAGGG - Intronic
943694452 2:190909553-190909575 AGCACCAAAAATAAAATCTTGGG - Intronic
944378605 2:199078666-199078688 TGCTCCAAAATAAAAACCTTAGG + Intergenic
944826275 2:203486054-203486076 AGCCTAGGAAAAAAAACCTAAGG + Intronic
945452191 2:210006397-210006419 AGTCTCAAAAAAAAACCCAAAGG - Intronic
945893463 2:215455915-215455937 AGCCCCAGAAAACTAACCCAAGG - Intergenic
946860532 2:223996728-223996750 AAGCCCAAAGACAAAACCTAGGG - Intronic
947172682 2:227326380-227326402 AGCCCAAAAGAAAAACCCTTAGG + Intronic
947381237 2:229547305-229547327 AGCCTCATAAGAAACACCTAAGG + Intronic
1170564474 20:17589214-17589236 TGCCTCAAAAAAAAAAAGTAGGG - Intronic
1172269928 20:33649157-33649179 AGCTTAAAAAAAAAAATCTAAGG - Exonic
1172407787 20:34702435-34702457 AGCCAGAAAAAAATAACCCAAGG - Intronic
1173086826 20:39928225-39928247 ACCCTCATAAAAAAAACCAATGG + Intergenic
1173796358 20:45863351-45863373 AGCTCCAAAGGAAAAACCCAGGG + Intronic
1174149741 20:48477730-48477752 AGTCCCAGAAAAAAAACCGGTGG - Intergenic
1174292091 20:49516591-49516613 AACCACAGAAGAAAAACCTATGG + Intronic
1176095890 20:63344489-63344511 AGCCTCAAAAAAAAAAAGAAAGG + Exonic
1176636749 21:9252176-9252198 ACCACCAAGAAAAAAACCCAGGG - Intergenic
1176648023 21:9367967-9367989 CGTCCCAAAAAAAAACCCCAGGG - Intergenic
1177075000 21:16560639-16560661 ATTCCTAAAAAAAAAACCTAAGG + Intergenic
1177690748 21:24504227-24504249 TGCTCCAAAAAAAAATTCTATGG - Intergenic
1177863446 21:26483513-26483535 AGCCCCAAGGAAAAGATCTATGG - Intronic
1177920735 21:27149133-27149155 AGCCTCAAAATGAAAACATATGG - Intergenic
1178072085 21:28979658-28979680 AACCCCAAAAACAAAACTTGCGG + Intronic
1180791968 22:18579857-18579879 AACCCCAAAAAAACAACTTTTGG - Intergenic
1180889748 22:19278303-19278325 AGCCCCAAAATAAGAACATGGGG + Intronic
1181103243 22:20555407-20555429 AGCCACAAAACACAAACCTTTGG - Intronic
1181229766 22:21415452-21415474 AACCCCAAAAAAACAACTTTTGG + Intergenic
1181248883 22:21519414-21519436 AACCCCAAAAAAACAACTTTTGG - Intergenic
1181744485 22:24946332-24946354 AACCCCAGAAAACAAAACTATGG + Intronic
949759461 3:7453390-7453412 AGCCCAGACAAAACAACCTAGGG - Intronic
951164022 3:19462740-19462762 AACCCCTAGAAGAAAACCTAGGG - Intronic
951192805 3:19789422-19789444 AGAAGAAAAAAAAAAACCTAAGG - Intergenic
951335688 3:21418908-21418930 AGCCCCAAACAACAGACTTATGG + Exonic
951720489 3:25692584-25692606 AGCCTCATAAAAAACTCCTATGG - Intergenic
952276069 3:31878156-31878178 TGCCCTCTAAAAAAAACCTAGGG + Intronic
952374956 3:32759208-32759230 ATCCCCAACAAAATAACCAATGG - Intronic
952457650 3:33488776-33488798 AGACCTTAAAAAAAATCCTATGG - Intergenic
952563246 3:34620984-34621006 AGCCCTTAAAAGAAAACATAGGG - Intergenic
953220542 3:40967540-40967562 AGCCCCAAAAGAAATGCTTAAGG - Intergenic
957981446 3:87516420-87516442 TACCCCAAAAAAAAAAAGTAAGG + Intergenic
958009004 3:87850812-87850834 ACAACAAAAAAAAAAACCTAGGG + Intergenic
959122656 3:102251515-102251537 AACACCAAAAAAATAACCCAGGG - Intronic
960150980 3:114248534-114248556 AGAGGCAAAAAGAAAACCTAGGG - Intergenic
960709219 3:120510910-120510932 AGCCCCAAAAAAGAACCCTGAGG - Intergenic
962157487 3:132963559-132963581 AGACCCAAAAATAAAACTAAAGG + Intergenic
963683104 3:148406199-148406221 AGCCAAAAAAAAAAAGTCTATGG + Intergenic
964500879 3:157347195-157347217 ACCAACAAAAAAAAAACCCATGG + Intronic
964594645 3:158410722-158410744 AGCATCAGAAAAAAATCCTAAGG - Intronic
966029735 3:175331164-175331186 AACAACAACAAAAAAACCTAGGG + Intronic
966501286 3:180643352-180643374 AGCTCCAAAGAAAAAAAATATGG + Intronic
966599948 3:181764993-181765015 AGTACCAAAACAAAAGCCTATGG + Intergenic
966659163 3:182395040-182395062 AGTCCCAAAAAAAAATCTGATGG + Intergenic
967137353 3:186523660-186523682 GACCCCAAAAAAAAAACCTCCGG + Intergenic
967534573 3:190587749-190587771 ATCTCCAAAATAAAAACCAAGGG + Intronic
967900305 3:194443247-194443269 TGCCCCCCAAAACAAACCTATGG - Intronic
968320622 3:197764844-197764866 CCCCCCAAAAAAAAAAAGTATGG - Intronic
1202738861 3_GL000221v1_random:37020-37042 CGTCCCAAAAAAAAACCCCAGGG + Intergenic
1202750146 3_GL000221v1_random:152843-152865 ACCACCAAGAAAAAAACCCAGGG + Intergenic
969252759 4:5980426-5980448 AACAACAAAAAAAAAAACTACGG - Intronic
969848671 4:9939589-9939611 AGACCTAAAAAAAAAAACCAAGG - Intronic
969935551 4:10676976-10676998 AGCCAAAAAAAAAAAAAATAGGG - Intronic
971306212 4:25483906-25483928 AGTCTCAAAAAAAAAACCATTGG - Intergenic
971380442 4:26092361-26092383 AGCTCCAAAAAAAAAAAAAAAGG - Intergenic
971765751 4:30828827-30828849 AACAACAAAAAAAAAACCTCAGG - Intronic
972108898 4:35530124-35530146 AACCACAAAAGAAAAATCTATGG - Intergenic
972881404 4:43427672-43427694 AACCCCTAGAAGAAAACCTAGGG - Intergenic
973929338 4:55774155-55774177 AACCACAAAACAAAAATCTACGG + Intergenic
973997774 4:56477122-56477144 AACAACAAAAAAAAAACATAAGG - Intronic
974905739 4:68054306-68054328 AACTAGAAAAAAAAAACCTAAGG - Intronic
974949014 4:68565006-68565028 AGACCCAAAAAGAAAACCAGAGG - Intronic
975032381 4:69637153-69637175 AGCCAGAAAAAAAGAAACTACGG + Intronic
975193174 4:71490484-71490506 ATCCCCCAAAAAGAAAGCTAGGG - Intronic
975912368 4:79282129-79282151 AGCCCCAAGAAAAGAACGAATGG + Intronic
976343466 4:83971946-83971968 AGCACCAAACCAAAAAGCTAGGG + Intergenic
977713206 4:100150654-100150676 AGCTCCAAGAAAACAACCTCAGG - Intergenic
978553027 4:109948479-109948501 CCCCCCAAAAAAAAATCCGAAGG - Intronic
979582952 4:122381050-122381072 TCCTCCAAAAAAAATACCTAAGG + Exonic
980122742 4:128744568-128744590 AGGGGGAAAAAAAAAACCTATGG - Intergenic
980136389 4:128862547-128862569 AGCCCCAAGAAAATGACCCAAGG + Intronic
981266747 4:142793131-142793153 ATCCCCAAGATAAAAACATATGG + Intronic
981285123 4:143007956-143007978 AGCCGTAACAAGAAAACCTACGG + Intergenic
981416654 4:144501201-144501223 ACAAACAAAAAAAAAACCTAGGG + Intergenic
981923536 4:150113370-150113392 AACAACAACAAAAAAACCTAGGG - Intronic
983152197 4:164298371-164298393 TACAACAAAAAAAAAACCTATGG + Intronic
983495448 4:168437852-168437874 AAACCCAAAAAAAAACCCCATGG - Intronic
984674403 4:182530534-182530556 AGCCCCACAATAAATACCTGTGG - Intronic
984913521 4:184698948-184698970 AGGCATAATAAAAAAACCTATGG - Intronic
986142709 5:5046767-5046789 AGCCCCAAGAAAAAAAACAAGGG - Intergenic
987024186 5:13907436-13907458 CCCCCCAAAAAAAGAACCTGGGG + Intronic
988770247 5:34426111-34426133 TGTCCCAAAAAAAAAAAATAGGG + Intergenic
990565487 5:57023254-57023276 ATCTAAAAAAAAAAAACCTATGG + Intergenic
990991794 5:61691944-61691966 ATAACAAAAAAAAAAACCTACGG + Intronic
991769327 5:70025798-70025820 AGCGCCAAACAAAAGAACTAGGG - Intronic
991848622 5:70901216-70901238 AGCGCCAAACAAAAGAACTAGGG - Intronic
993477761 5:88386192-88386214 TGCCCCTAAAAAAACACCTTTGG + Intergenic
993478834 5:88397565-88397587 ACCGCCAAAACAAAAACCCAAGG + Intergenic
993667145 5:90713339-90713361 AGCCTCAAAAAAAAAAAAAAAGG - Intronic
993846565 5:92951824-92951846 AGCCCTATAAAAAATACTTAAGG - Intergenic
994935707 5:106250785-106250807 ACACCCTAAAAACAAACCTAAGG + Intergenic
994999210 5:107105980-107106002 TGCCCTAAAAAACAAACCCAAGG + Intergenic
995642196 5:114269493-114269515 AGCACCAAAAAAAAAAAAAAAGG - Intergenic
996163912 5:120201073-120201095 AGGAAAAAAAAAAAAACCTAGGG + Intergenic
996519075 5:124406317-124406339 AACCCCAAACAAGCAACCTAGGG - Intergenic
996655135 5:125926236-125926258 AGCCCCAAGAAAAAAACTTGAGG + Intergenic
997965890 5:138355778-138355800 AGACCAAAAAAAGAAACCCATGG + Intronic
998281691 5:140815355-140815377 AACCACAAAGAAAATACCTATGG - Intronic
998562998 5:143188925-143188947 AGCCCCAAACAAACAGCCCAGGG - Intronic
998685449 5:144518832-144518854 AATTCCAAAAAAAAAACTTAGGG - Intergenic
1000175905 5:158753940-158753962 AGCCAGAAAAAAAAAATCTAGGG - Intronic
1002389351 5:178897010-178897032 AACCCTAACACAAAAACCTAAGG - Intronic
1002990245 6:2231559-2231581 GTCTCCAAAAAAAAAGCCTAAGG + Intronic
1003451280 6:6235151-6235173 AGACCTAAATATAAAACCTAGGG + Intronic
1003674635 6:8192005-8192027 ATCCCCAAAAAGAAACCCAAAGG - Intergenic
1006206139 6:32344845-32344867 AGCCCCAAAAAAAAAACCTAAGG - Intronic
1006734177 6:36260813-36260835 TGCCCCAGAAAAAAATCATATGG - Intronic
1008402095 6:51075664-51075686 AGCACAAATAAAAAAATCTAAGG - Intergenic
1008601686 6:53102186-53102208 TCCCACAAAAAAAAGACCTACGG + Intergenic
1008796121 6:55305131-55305153 AACTCCAAGAAAAAAACATAAGG - Intergenic
1008862934 6:56172882-56172904 AACCTCAAAGAAAATACCTACGG + Intronic
1009713556 6:67356780-67356802 AGCCACAAAATAAAAACTCAAGG + Intergenic
1011426594 6:87238595-87238617 AACCAAAAAAATAAAACCTAAGG - Intronic
1011554201 6:88557577-88557599 TGTCCCATAAAAAAAATCTAGGG + Intergenic
1012279343 6:97310408-97310430 AGCCCCAGAATTAAAATCTATGG - Intergenic
1013248643 6:108312760-108312782 ACAACCAAAAAAAAAACATAAGG - Intronic
1014093212 6:117429170-117429192 AACCCTAAAAAAAAAAACTGGGG - Intronic
1015352182 6:132233314-132233336 AGCCCCTAAAAAAAAAAAAAAGG - Intergenic
1015452635 6:133388821-133388843 AGCATCAAGAATAAAACCTAGGG - Intronic
1016289610 6:142514329-142514351 ACCCCCAAAAAACAAAACTTTGG - Intergenic
1016678388 6:146799146-146799168 AGACTCTACAAAAAAACCTATGG + Intronic
1016720898 6:147296057-147296079 ACCCCCCAAAAAAAAACAGATGG + Intronic
1017487454 6:154916352-154916374 AGCCCTAAAAAAAAAAAAAAAGG - Intronic
1019798190 7:3067592-3067614 ACCCCCCCAAAAAAAACCCATGG - Intergenic
1020769254 7:12367564-12367586 AGCCCCAAATTAAAAGCATATGG + Intronic
1022489183 7:30803679-30803701 TACCCCAAAAACAAAACCTCAGG - Intronic
1022815286 7:33907342-33907364 AGCCACAAAAAACAAACATAAGG + Intronic
1022915048 7:34940461-34940483 AGCCCCAAAATAATAATCTTTGG + Intronic
1023195311 7:37631518-37631540 AGCTTCAAATAAACAACCTAAGG - Intergenic
1023348444 7:39295204-39295226 AGTCCTAAAATGAAAACCTAGGG + Intronic
1024600330 7:50975004-50975026 GGCTCCAAGAAAAAAACTTACGG - Intergenic
1026022764 7:66722643-66722665 AGACCCAAATATAAAAGCTAAGG - Intronic
1026611860 7:71867139-71867161 TGTCTCAAAAAAAAAAACTAAGG + Intronic
1029825648 7:103190664-103190686 AGACCCATCAAAAAAAACTACGG + Intergenic
1032637049 7:133720484-133720506 ACCCCCAAAATAAGATCCTATGG - Intronic
1032711916 7:134468240-134468262 CCCCCCAAAAAAAACACCCATGG + Intergenic
1032861652 7:135885437-135885459 AGCCTCCAACAAAAAACCTCGGG - Intergenic
1035116391 7:156527926-156527948 ATCCTTAAAAGAAAAACCTAAGG - Intergenic
1035178062 7:157067560-157067582 ACCCTCAAAAAAGAAAACTATGG - Intergenic
1037972149 8:23180083-23180105 ATCTCAAAAAAAAAAAGCTATGG - Intergenic
1038712213 8:29958155-29958177 TGCCCCAAAAACAAAGCCAAGGG + Intergenic
1039405208 8:37306765-37306787 ATCCTCAAGAAAAAAACCAAAGG - Intergenic
1040030569 8:42819908-42819930 AGCCTCAAAAAGAAAAGCTGAGG - Intergenic
1040821694 8:51565934-51565956 AGATCCAAAAAAAACCCCTATGG - Intronic
1041038452 8:53820392-53820414 AGACCAAAAAAAAAAATCCAAGG + Intronic
1041119665 8:54573413-54573435 AGACCAAAAATAAAAACCTCAGG + Intergenic
1042865325 8:73351695-73351717 ATACCCAAAAAAGAAATCTAGGG + Intergenic
1044861336 8:96526655-96526677 TGTCCAAAAAAAAAAACCAAAGG - Intronic
1044918377 8:97140884-97140906 AGCCCCAAAATAAACATATAAGG + Intronic
1048300927 8:133250673-133250695 GGACCTAAAAAAAAAACCTTTGG + Intronic
1049853203 8:144845381-144845403 AGCAGCAAAAAAAAAACTGAGGG - Intronic
1050875385 9:10628300-10628322 AGCTTCAAAAAACAAACATAGGG + Intergenic
1051207743 9:14706615-14706637 AATCACAAAACAAAAACCTACGG + Intergenic
1051510012 9:17867439-17867461 AGCCCCAAAAGAAAAAAATCAGG - Intergenic
1051518091 9:17953028-17953050 ATTCCAAAAAAAAAAAACTATGG - Intergenic
1051649419 9:19306320-19306342 TGAACCAAAAAAATAACCTAAGG + Intronic
1052178664 9:25498193-25498215 AGCAACAAAAACAAACCCTAAGG + Intergenic
1053912404 9:42920731-42920753 TGTCCCAAAAAAAAAACCCAGGG + Intergenic
1054982915 9:71227313-71227335 AGCCACACATACAAAACCTATGG + Intronic
1055514783 9:77023515-77023537 AGCCCCCAAAACAAAACTTCTGG - Intergenic
1056483279 9:87028606-87028628 AGCACTAAAAAAAAAAGTTATGG + Intergenic
1056718219 9:89051447-89051469 AACACTGAAAAAAAAACCTAAGG + Intronic
1059394726 9:114027325-114027347 AGCCCCAGAAACAAATCCCAAGG - Intronic
1062241635 9:135543964-135543986 ATCTACGAAAAAAAAACCTATGG - Intergenic
1203707592 Un_KI270742v1:67464-67486 CGTCCCAAAAAAAAACCCCAGGG + Intergenic
1185492025 X:525096-525118 ATCTCAAAAAAAAAAACCAAAGG + Intergenic
1186005795 X:5070584-5070606 AGACGGATAAAAAAAACCTAAGG - Intergenic
1188402203 X:29759419-29759441 ATCTCCAAAAAAAAGAACTATGG - Intronic
1188737691 X:33738788-33738810 AGCACCAAAACACAAAACTAAGG + Intergenic
1188755610 X:33957877-33957899 AGACCCAGAAAAATAATCTACGG - Intergenic
1188761231 X:34032694-34032716 AGCAGCCAAAAAAAAACATATGG - Intergenic
1190295722 X:49026234-49026256 CCCCCCCAAAAAAAAACCTCTGG + Intergenic
1192046927 X:67685788-67685810 ATCCCTAAAAAAAACACCAATGG + Intronic
1193321462 X:80126981-80127003 AGCTGGAAAAATAAAACCTAAGG - Intergenic
1193731060 X:85104325-85104347 AGCCACAATAAAAAAGCCTCAGG - Intronic
1195764682 X:108283572-108283594 CCCCCCAAAAAAAAAACTTAGGG - Intronic
1195814932 X:108874477-108874499 AGATTAAAAAAAAAAACCTATGG - Intergenic
1195950230 X:110263383-110263405 AAGCCCAGAAAAAAAACCAATGG - Intronic
1196361352 X:114864302-114864324 AGCCACAAAACAAAAATCTATGG - Intronic
1197047799 X:122020775-122020797 CGCCCCCCAAAAAAAACCAAAGG - Intergenic
1197161985 X:123334098-123334120 TGTCCCAAAAGCAAAACCTATGG + Intronic
1197360031 X:125490358-125490380 ACACCCAGAAAAAAAACTTATGG - Intergenic
1199133050 X:144217229-144217251 AACAACAAAAAAAAAACCTTTGG + Intergenic
1199920552 X:152398260-152398282 AGCCCAAAAAAAAAAAAAAAAGG - Intronic
1199921343 X:152407136-152407158 AGCTACAAATAAATAACCTAAGG + Intronic
1201356306 Y:13100419-13100441 AGGAACAAAAAAAAACCCTAGGG + Intergenic
1201518400 Y:14843824-14843846 AACCTCAAAATAATAACCTAAGG - Intronic
1201653194 Y:16314385-16314407 AACCCCTAAAAAAAAACCTTTGG - Intergenic
1201704635 Y:16922682-16922704 ACCTCAGAAAAAAAAACCTAAGG + Intergenic