ID: 1006217374

View in Genome Browser
Species Human (GRCh38)
Location 6:32455965-32455987
Sequence TTGAATAAGAATGGTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006217374_1006217383 30 Left 1006217374 6:32455965-32455987 CCTCCCTCACCATTCTTATTCAA No data
Right 1006217383 6:32456018-32456040 AGGCCAGAGAAAGAAATAAAGGG 0: 18
1: 2868
2: 5957
3: 10854
4: 5509
1006217374_1006217379 10 Left 1006217374 6:32455965-32455987 CCTCCCTCACCATTCTTATTCAA No data
Right 1006217379 6:32455998-32456020 GAAGTCCTGACCAGAACATCAGG No data
1006217374_1006217382 29 Left 1006217374 6:32455965-32455987 CCTCCCTCACCATTCTTATTCAA No data
Right 1006217382 6:32456017-32456039 CAGGCCAGAGAAAGAAATAAAGG 0: 13
1: 2373
2: 4570
3: 6170
4: 6902

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006217374 Original CRISPR TTGAATAAGAATGGTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr