ID: 1006217731

View in Genome Browser
Species Human (GRCh38)
Location 6:32459738-32459760
Sequence TGCACACGTAAGCACCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006217731_1006217733 2 Left 1006217731 6:32459738-32459760 CCCACAGGGTGCTTACGTGTGCA No data
Right 1006217733 6:32459763-32459785 CACACACACTCCCTGTTCTCAGG No data
1006217731_1006217734 3 Left 1006217731 6:32459738-32459760 CCCACAGGGTGCTTACGTGTGCA No data
Right 1006217734 6:32459764-32459786 ACACACACTCCCTGTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006217731 Original CRISPR TGCACACGTAAGCACCCTGT GGG (reversed) Intergenic
No off target data available for this crispr