ID: 1006217733

View in Genome Browser
Species Human (GRCh38)
Location 6:32459763-32459785
Sequence CACACACACTCCCTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006217728_1006217733 12 Left 1006217728 6:32459728-32459750 CCTACACCCTCCCACAGGGTGCT No data
Right 1006217733 6:32459763-32459785 CACACACACTCCCTGTTCTCAGG No data
1006217725_1006217733 28 Left 1006217725 6:32459712-32459734 CCTTCTGGCTCACAATCCTACAC No data
Right 1006217733 6:32459763-32459785 CACACACACTCCCTGTTCTCAGG No data
1006217732_1006217733 1 Left 1006217732 6:32459739-32459761 CCACAGGGTGCTTACGTGTGCAT No data
Right 1006217733 6:32459763-32459785 CACACACACTCCCTGTTCTCAGG No data
1006217730_1006217733 5 Left 1006217730 6:32459735-32459757 CCTCCCACAGGGTGCTTACGTGT No data
Right 1006217733 6:32459763-32459785 CACACACACTCCCTGTTCTCAGG No data
1006217729_1006217733 6 Left 1006217729 6:32459734-32459756 CCCTCCCACAGGGTGCTTACGTG No data
Right 1006217733 6:32459763-32459785 CACACACACTCCCTGTTCTCAGG No data
1006217731_1006217733 2 Left 1006217731 6:32459738-32459760 CCCACAGGGTGCTTACGTGTGCA No data
Right 1006217733 6:32459763-32459785 CACACACACTCCCTGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006217733 Original CRISPR CACACACACTCCCTGTTCTC AGG Intergenic
No off target data available for this crispr