ID: 1006223793

View in Genome Browser
Species Human (GRCh38)
Location 6:32519116-32519138
Sequence CCCTGACCTGTGACATCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006223788_1006223793 -5 Left 1006223788 6:32519098-32519120 CCCTGGGAGAGGGGGTGACCCTG 0: 1
1: 0
2: 3
3: 42
4: 306
Right 1006223793 6:32519116-32519138 CCCTGACCTGTGACATCATGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1006223780_1006223793 15 Left 1006223780 6:32519078-32519100 CCCAGAGGCAGGGTCTGGAGCCC 0: 1
1: 0
2: 1
3: 109
4: 422
Right 1006223793 6:32519116-32519138 CCCTGACCTGTGACATCATGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1006223781_1006223793 14 Left 1006223781 6:32519079-32519101 CCAGAGGCAGGGTCTGGAGCCCT 0: 1
1: 0
2: 1
3: 136
4: 433
Right 1006223793 6:32519116-32519138 CCCTGACCTGTGACATCATGGGG 0: 1
1: 0
2: 3
3: 13
4: 145
1006223789_1006223793 -6 Left 1006223789 6:32519099-32519121 CCTGGGAGAGGGGGTGACCCTGA 0: 1
1: 1
2: 3
3: 40
4: 307
Right 1006223793 6:32519116-32519138 CCCTGACCTGTGACATCATGGGG 0: 1
1: 0
2: 3
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006223793 Original CRISPR CCCTGACCTGTGACATCATG GGG Intronic
900622049 1:3592019-3592041 GCCTGACCTGAGCCAGCATGTGG - Intronic
900656864 1:3762872-3762894 ACCTGACCTGTGCCTTCAAGGGG - Intronic
900682156 1:3923011-3923033 CCCTGACCTCTGCCTTCACGTGG - Intergenic
902766453 1:18619301-18619323 CTATGACCTGTGACCTTATGAGG - Intergenic
903538158 1:24081110-24081132 CCCTGACCTGGGCCATCAACTGG - Intronic
904974044 1:34442414-34442436 CCCTCACCTAGGAGATCATGGGG - Intergenic
905174497 1:36127247-36127269 CCCTGACCCGAGACAGCCTGGGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906501388 1:46343581-46343603 CTCTGACTTCTGCCATCATGGGG - Intronic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
907480614 1:54743378-54743400 CCCTGCCCTGAGCCATCATGTGG + Intergenic
915278919 1:154809045-154809067 CACTGACCTGTGACTACATCAGG - Intronic
915891146 1:159774962-159774984 CCCCGACCTGTGAGATCCTCAGG - Intergenic
917639801 1:176972307-176972329 CCCTGACCGCTAACCTCATGTGG - Intronic
918521805 1:185423239-185423261 CCCACACCTGTGGCTTCATGGGG + Intergenic
921900393 1:220444088-220444110 CCCTGACTTCTGGCAACATGAGG - Intergenic
922895233 1:229094798-229094820 CCCTGCCCTGTGACACTACGTGG - Intergenic
1062799999 10:371781-371803 CCCAGCCCTGTGACACCTTGGGG + Intronic
1062906993 10:1186041-1186063 CCCTGCCCTGTGACGGCCTGAGG + Intronic
1063837011 10:10026890-10026912 CCCATAGCTTTGACATCATGTGG + Intergenic
1066447877 10:35500156-35500178 CCCTGTCCTGTGACAGCAGGGGG + Intronic
1067546590 10:47196533-47196555 CTCTGGACTGTGACATCCTGTGG - Intergenic
1067655674 10:48189579-48189601 CGCTGGCCTGTGAGCTCATGAGG + Intronic
1069947944 10:72000442-72000464 CCCTGACCCCTGACCTAATGTGG - Intronic
1071144571 10:82552957-82552979 ACTGGGCCTGTGACATCATGTGG - Intronic
1071423745 10:85527900-85527922 CCCTGACCTGTGGCAGAATGTGG - Intergenic
1072296349 10:94012587-94012609 CCCTGCCCTGTGAGGTGATGAGG - Intronic
1076809960 10:132881341-132881363 CCCTGTCCTGTGTCCTCTTGCGG - Intronic
1077303430 11:1857332-1857354 CCCTGGCCGGTGACACCCTGGGG + Intronic
1081155263 11:39682072-39682094 CCCTGACCTGTGGAATCTTTTGG + Intergenic
1082838110 11:57666721-57666743 CCCTCACCTGTAAAATCCTGAGG - Intergenic
1082989077 11:59192016-59192038 ATCTGACCTCTGAGATCATGTGG + Intronic
1083269163 11:61562609-61562631 CTCTGACCTCTGCCATCCTGTGG - Intronic
1084483534 11:69435264-69435286 CCCTCACCTGGGACCTCAAGGGG + Intergenic
1085511311 11:77089521-77089543 CCCTCACCTCTGCCACCATGGGG - Intronic
1090875977 11:130789422-130789444 CAGTGACCAGGGACATCATGAGG + Intergenic
1092208830 12:6633237-6633259 CCCTGACCTGTGTCCTGAGGTGG + Intronic
1099040588 12:77648800-77648822 CCCTGACCAGTGAAATCTTCTGG - Intergenic
1102023784 12:109701557-109701579 CCCTGTCCTTTGGCACCATGAGG - Intergenic
1103944677 12:124519419-124519441 CCCAGACCCTTGTCATCATGTGG - Intronic
1111498257 13:89082913-89082935 CCCTCTCCTGTGAAATAATGAGG - Intergenic
1114134721 14:19834617-19834639 CCCTGCCCCCTGACATCATTTGG + Intergenic
1114522399 14:23347608-23347630 CCCTGGCCTGTGTCTTCCTGGGG - Exonic
1115315404 14:32019960-32019982 TCCTTACATGCGACATCATGTGG + Intergenic
1117788653 14:59314681-59314703 TCCTGAGCTGTCACAGCATGAGG + Intronic
1120909181 14:89650261-89650283 GCCTGACCTTTGGCCTCATGGGG + Intergenic
1122029087 14:98899593-98899615 CTCTGCCCTGTGACAGCCTGAGG + Intergenic
1123577776 15:21690191-21690213 CCCTGCCCCCTGACATCATTTGG + Intergenic
1123614400 15:22132672-22132694 CCCTGCCCCCTGACATCATTTGG + Intergenic
1127585453 15:60373663-60373685 CTCAGACCTGTGAGATCCTGGGG + Intronic
1128252138 15:66171057-66171079 CCAGGACCTGTGACTTCCTGGGG - Intronic
1129888756 15:79057187-79057209 CCTTGCCCTGCGACACCATGGGG - Intronic
1202986645 15_KI270727v1_random:424436-424458 CCCTGCCCCCTGACATCATTTGG + Intergenic
1133034996 16:3029500-3029522 CCCTTACCTGTGCCATCGAGAGG - Intronic
1137494214 16:48957130-48957152 CCCTGACCTTTCACATCCTCTGG - Intergenic
1137550556 16:49434634-49434656 CCATGGCCTCTGACCTCATGAGG + Intergenic
1138652383 16:58468086-58468108 CCCACAGCTCTGACATCATGGGG + Intronic
1139471341 16:67179621-67179643 CGCTGCCCTGTGGCATCATTGGG - Intronic
1141871548 16:86789824-86789846 CTCTGACCTCTGACATGGTGAGG - Intergenic
1142177993 16:88653742-88653764 CCCTGAGCTGTTACCCCATGGGG - Intronic
1144361598 17:14500085-14500107 CCAAGACCTGTGAGGTCATGTGG + Intergenic
1146751795 17:35388823-35388845 CCTTGACCTGTGAAAACATCCGG - Intergenic
1146952854 17:36918816-36918838 CCCTGACCTGCCACTCCATGAGG + Intergenic
1148237069 17:45976121-45976143 CTCTGACCTGTGCCCACATGGGG + Intronic
1150587160 17:66529447-66529469 CCCTTACCAGTGGCTTCATGAGG - Intronic
1151564281 17:74888925-74888947 CCCTGTCCTGGGTCACCATGGGG - Intronic
1152097152 17:78278875-78278897 TGCTGACCTGTGGCACCATGTGG + Intergenic
1152525201 17:80884516-80884538 CCCTTGCCTCTGACACCATGTGG - Intronic
1153822325 18:8842863-8842885 CCCAGACCAGTTACATCAGGAGG - Intergenic
1154091416 18:11367352-11367374 CCATCACCTGTGACATGAAGAGG - Intergenic
1155464874 18:26122798-26122820 CACAGACCAGTGACACCATGAGG + Intergenic
1160007025 18:75075342-75075364 CCCAGGACTGTGACATCAGGTGG - Intergenic
1162108952 19:8389964-8389986 CGCTGACCTATGACGTCATCGGG + Intronic
1167078469 19:47263452-47263474 CACTGAATTGTGACAACATGTGG + Intronic
1167410625 19:49341715-49341737 CCTTTACTTGTGACATGATGGGG - Intronic
925147152 2:1588886-1588908 CCCTCCCCTGTGTCCTCATGTGG - Intergenic
928435303 2:31251063-31251085 CACTGGCCTGTCACACCATGAGG - Intronic
929040965 2:37743976-37743998 CACTGAGCTGTGACATCATGGGG - Intergenic
935145708 2:100393818-100393840 CCCTCAGCTGTGACCTCCTGTGG - Intronic
936679282 2:114752107-114752129 CCCTGACCATTGGCATCATTTGG - Intronic
939873917 2:147554944-147554966 CCCTCTCCTGGGACATCCTGAGG - Intergenic
944886407 2:204066808-204066830 CCCAGCCCTGTGATATCTTGAGG + Intergenic
944887047 2:204073626-204073648 CCCTGGCATGTGGCAGCATGCGG - Intergenic
948366000 2:237455177-237455199 CCCTGCCCTGTTACCTCAAGGGG - Intergenic
948919545 2:241055922-241055944 AGCTGACCTGTGATATCATTAGG - Intronic
1169979987 20:11373650-11373672 CCCTGAGCTGAGACTTCAAGAGG + Intergenic
1170591416 20:17774722-17774744 TTCTGACCTTTGTCATCATGGGG - Intergenic
1171392183 20:24808831-24808853 CCGTGGGCTGTGAGATCATGTGG + Intergenic
1172070396 20:32252430-32252452 CCCAGACCTGAGACAGGATGTGG + Intergenic
1174340264 20:49890991-49891013 CACGGACCTGAGACTTCATGAGG - Exonic
1176194508 20:63831090-63831112 CGCTTACCTGTGACCCCATGGGG + Intronic
1179267674 21:39819106-39819128 CCCTGACTTGTGCCCTCAGGAGG + Intergenic
1180216995 21:46330805-46330827 CCCTGGCCTGGGACATTATTCGG - Intronic
1183808969 22:40237955-40237977 CACTGACCTGTGACACAATCAGG - Intronic
1185077248 22:48690076-48690098 CCCTGCCCTGTGGCATCAGCTGG + Intronic
1203293233 22_KI270736v1_random:15555-15577 CACTGAGGTGTGACATCATGGGG - Intergenic
950026875 3:9826128-9826150 CCCTCATCTGTGACATGAGGAGG + Intronic
951922852 3:27875090-27875112 CCTTGAACTGTGACATACTGGGG - Intergenic
954554094 3:51504766-51504788 TTCTGACCTGAGTCATCATGAGG - Intergenic
961264816 3:125633344-125633366 CCCTGACCTCTGAGTTCCTGGGG + Intergenic
965149441 3:164951282-164951304 CCCTGTCCTGTAACAAAATGAGG - Intergenic
967938425 3:194747703-194747725 CCCACACCTGTGACATCACGTGG - Intergenic
972336276 4:38109580-38109602 CCATGACCAGTGACATCAAGTGG - Intronic
972634916 4:40875107-40875129 ACCTGACATGTCACATCGTGGGG + Intronic
973259917 4:48152592-48152614 TCCTTACCTGTGAAATAATGTGG - Intronic
973848796 4:54940369-54940391 CACTGACCTGAAAGATCATGTGG + Intergenic
981110925 4:140932543-140932565 CCCTTACCTGTGACAGCTTGAGG - Intronic
981696025 4:147559553-147559575 TCCTGATCTGTAAAATCATGAGG + Intergenic
984183486 4:176513484-176513506 CGATGACTTGTGACATCAAGTGG + Intergenic
984566796 4:181340701-181340723 ACCTGACCTGGCACTTCATGGGG - Intergenic
984837956 4:184039962-184039984 CCCTCATCTGTGAAATCACGCGG - Intergenic
986173073 5:5329245-5329267 CCCTGAGCTATGAAATCCTGGGG - Intergenic
997475263 5:134138993-134139015 CCCTGACCTCAGGCAGCATGGGG + Exonic
999135736 5:149317675-149317697 GCCTGCCCTGGGACAGCATGGGG - Intronic
1000290683 5:159867748-159867770 CTCTGACATCTGTCATCATGTGG - Intergenic
1000747437 5:165052075-165052097 CACTGACATGTGAAAACATGGGG - Intergenic
1003967132 6:11263634-11263656 TCCTGGCCTTTGACATCATGAGG + Intronic
1005946893 6:30602046-30602068 CGGTGACCAGGGACATCATGAGG + Exonic
1006223793 6:32519116-32519138 CCCTGACCTGTGACATCATGGGG + Intronic
1006227715 6:32554436-32554458 CCCTGACCTGTGCTATCATGGGG + Intronic
1006230381 6:32581302-32581324 CCCTGACCTGCAAAATCATGGGG + Intronic
1012692931 6:102338044-102338066 CCCTGACCATTGCCATCATAGGG - Intergenic
1014894007 6:126877652-126877674 CACTGAGCTGTGACACCTTGGGG + Intergenic
1019087119 6:169489034-169489056 CCCTCATCTCTGAAATCATGTGG - Intronic
1019346267 7:532236-532258 CCCTGACCTGGGAGCTCAGGGGG + Intergenic
1020084598 7:5303615-5303637 CCCTGACCTGTGGCATCGTGTGG - Exonic
1023063588 7:36352973-36352995 GCCTGACCTGTAGCATCTTGAGG - Intronic
1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG + Intergenic
1025662249 7:63563267-63563289 CCCCGACCTGTGGCATCACGTGG - Intergenic
1029257570 7:99279825-99279847 CCCTGACCACTGACCACATGGGG + Intergenic
1031601220 7:123712901-123712923 TTCTGACCTGTTACATAATGTGG - Intronic
1032536638 7:132669883-132669905 CCCAGACCTGAGAAATCATTAGG + Intronic
1033142299 7:138838365-138838387 ACCCGACCTTTCACATCATGGGG - Intronic
1035358409 7:158294119-158294141 CACTGCACTGTGACATCATGAGG + Intronic
1035585616 8:770747-770769 CCCTGAGCTGTAAAATCCTGGGG + Intergenic
1044737544 8:95294769-95294791 CACGGACCTGAGACTTCATGGGG - Intergenic
1048875644 8:138835167-138835189 CCCTGCCCTTTGCCATCCTGAGG + Intronic
1049224096 8:141441456-141441478 CCCTGGCCTGTGACCTCCTAGGG - Intergenic
1051971239 9:22890257-22890279 CGCTCACCTATGGCATCATGAGG - Intergenic
1053303380 9:36967185-36967207 CACTGACCGGTCACATGATGTGG - Intronic
1053604574 9:39644287-39644309 CTCTGACCTGGGACATTGTGGGG + Intergenic
1053833964 9:42114115-42114137 CTCTGGCCTGTGAGGTCATGAGG - Intronic
1053862390 9:42400306-42400328 CTCTGACCTGGGACATTGTGGGG + Intergenic
1054248968 9:62698127-62698149 CTCTGACCTGGGACATTGTGGGG - Intergenic
1054563078 9:66732660-66732682 CTCTGACCTGGGACATTGTGGGG - Intergenic
1054596585 9:67073294-67073316 CTCTGGCCTGTGAGGTCATGAGG + Intergenic
1055678559 9:78691141-78691163 CACAGACCTTTGACCTCATGGGG - Intergenic
1059656986 9:116366249-116366271 CCCTGACCTCACACATCCTGAGG - Intronic
1060315266 9:122503996-122504018 CCCTTACCTATGGCCTCATGAGG - Intergenic
1061005259 9:127925324-127925346 CTCTGCCCCGTGACAGCATGTGG + Intronic
1061961337 9:133990790-133990812 ACCTGACCACTGACATCCTGCGG + Intronic
1186533899 X:10327805-10327827 GCCTGAGCTGTGACATCTTGGGG - Intergenic
1188811977 X:34661712-34661734 CCCTGTCCTGGGACCTTATGGGG + Intergenic
1188956828 X:36443341-36443363 CCCTCAGCTGTGACATAAAGTGG - Intergenic
1197263355 X:124339399-124339421 CCCTAGCCTGTGACCTTATGAGG + Intronic
1197949014 X:131874128-131874150 CCAAAACCTGTGGCATCATGAGG - Intergenic
1199265798 X:145824020-145824042 ACTGTACCTGTGACATCATGGGG + Exonic
1199765909 X:150941608-150941630 CCCTGACCTTGGCCATCCTGTGG - Intergenic
1201475145 Y:14373616-14373638 CCTTTACCAGTGAGATCATGAGG - Intergenic
1202266948 Y:23029541-23029563 CCCTGTTCTGTCCCATCATGTGG + Intergenic
1202419941 Y:24663286-24663308 CCCTGTTCTGTCCCATCATGTGG + Intergenic
1202450845 Y:25006798-25006820 CCCTGTTCTGTCCCATCATGTGG - Intergenic