ID: 1006225923

View in Genome Browser
Species Human (GRCh38)
Location 6:32535869-32535891
Sequence CAGGACAATCAGCTGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006225920_1006225923 4 Left 1006225920 6:32535842-32535864 CCTCTCTGCTGAGAACTGAGGAA No data
Right 1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG No data
1006225916_1006225923 19 Left 1006225916 6:32535827-32535849 CCCTCACCAAGGTCTCCTCTCTG No data
Right 1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG No data
1006225918_1006225923 13 Left 1006225918 6:32535833-32535855 CCAAGGTCTCCTCTCTGCTGAGA No data
Right 1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG No data
1006225917_1006225923 18 Left 1006225917 6:32535828-32535850 CCTCACCAAGGTCTCCTCTCTGC No data
Right 1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006225923 Original CRISPR CAGGACAATCAGCTGCAGAG AGG Intergenic
No off target data available for this crispr