ID: 1006241581

View in Genome Browser
Species Human (GRCh38)
Location 6:32684547-32684569
Sequence CTGTAGTCCTCCTCTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006241581_1006241583 9 Left 1006241581 6:32684547-32684569 CCTTCATTAGAGGAGGACTACAG No data
Right 1006241583 6:32684579-32684601 ATTATTACGAGAGATGCCTCAGG No data
1006241581_1006241584 22 Left 1006241581 6:32684547-32684569 CCTTCATTAGAGGAGGACTACAG No data
Right 1006241584 6:32684592-32684614 ATGCCTCAGGAACAAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006241581 Original CRISPR CTGTAGTCCTCCTCTAATGA AGG (reversed) Intergenic
No off target data available for this crispr