ID: 1006244098

View in Genome Browser
Species Human (GRCh38)
Location 6:32715100-32715122
Sequence CACTGTGTATTGAGTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006244094_1006244098 26 Left 1006244094 6:32715051-32715073 CCGTTTTTGAATGGGCATGTTTA No data
Right 1006244098 6:32715100-32715122 CACTGTGTATTGAGTGCTGATGG No data
1006244095_1006244098 -7 Left 1006244095 6:32715084-32715106 CCTGACCCAGTTTCAGCACTGTG No data
Right 1006244098 6:32715100-32715122 CACTGTGTATTGAGTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006244098 Original CRISPR CACTGTGTATTGAGTGCTGA TGG Intergenic
No off target data available for this crispr