ID: 1006248258

View in Genome Browser
Species Human (GRCh38)
Location 6:32758874-32758896
Sequence GGAGGCTGGGGTGCTCCACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 5, 3: 25, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006248253_1006248258 -5 Left 1006248253 6:32758856-32758878 CCACGGTGATGGGGCTCTGGAGG 0: 2
1: 0
2: 2
3: 15
4: 195
Right 1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG 0: 1
1: 1
2: 5
3: 25
4: 250
1006248243_1006248258 16 Left 1006248243 6:32758835-32758857 CCAGTTTCCCCTTACGCCACTCC 0: 1
1: 0
2: 3
3: 9
4: 253
Right 1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG 0: 1
1: 1
2: 5
3: 25
4: 250
1006248245_1006248258 9 Left 1006248245 6:32758842-32758864 CCCCTTACGCCACTCCACGGTGA 0: 2
1: 0
2: 0
3: 6
4: 44
Right 1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG 0: 1
1: 1
2: 5
3: 25
4: 250
1006248246_1006248258 8 Left 1006248246 6:32758843-32758865 CCCTTACGCCACTCCACGGTGAT 0: 2
1: 0
2: 0
3: 2
4: 36
Right 1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG 0: 1
1: 1
2: 5
3: 25
4: 250
1006248247_1006248258 7 Left 1006248247 6:32758844-32758866 CCTTACGCCACTCCACGGTGATG 0: 2
1: 0
2: 0
3: 5
4: 31
Right 1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG 0: 1
1: 1
2: 5
3: 25
4: 250
1006248251_1006248258 0 Left 1006248251 6:32758851-32758873 CCACTCCACGGTGATGGGGCTCT 0: 2
1: 1
2: 0
3: 5
4: 104
Right 1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG 0: 1
1: 1
2: 5
3: 25
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006248258 Original CRISPR GGAGGCTGGGGTGCTCCACT TGG Exonic
900486292 1:2924319-2924341 GGAGGCTCAGGTTCTCCCCTGGG + Intergenic
900787984 1:4661128-4661150 GGGGGCTGGGGTGCTCTATGAGG + Intronic
900918089 1:5652352-5652374 GGAGGCTTGGGCGCTCCAGGAGG - Intergenic
901034732 1:6329606-6329628 GGAGGCTGGGCTTCTCCTCATGG - Intronic
902375705 1:16029063-16029085 GGAGGCTGGGGTCTGCCGCTGGG + Intronic
902380659 1:16050815-16050837 GGAGGCTGGGGTCTGCCGCTGGG + Intronic
902573350 1:17361029-17361051 GGTGGCTGGGGTTCCCCAGTAGG - Intronic
902824004 1:18960132-18960154 GGAGGCTGGCGTCCCCCACAGGG - Intergenic
902832404 1:19025323-19025345 GGAGTCTGCTGAGCTCCACTTGG - Intergenic
903176447 1:21584315-21584337 GGAGACTGGGATGGTCAACTTGG + Intergenic
903334200 1:22614063-22614085 GGAGTGCGGGGTGCTCCCCTGGG - Intergenic
904919058 1:33992452-33992474 GGAGGCTGAGGTGCTGAAGTGGG - Intronic
906662337 1:47592234-47592256 GGAAGCAGGTGTGCTCCACCAGG - Intergenic
908737069 1:67288085-67288107 GGTGGCTGAGGAGCTCCACGAGG - Intergenic
909375703 1:74939395-74939417 GGAGGCTGAGGTGGATCACTTGG + Intergenic
913983258 1:143542717-143542739 GGAGGCTGGAGTGTCCCACAGGG + Intergenic
915913568 1:159928695-159928717 AGGGGCTGGGGTGCCCCACTGGG + Exonic
916475303 1:165163087-165163109 GCAGGCTGGCCTGCTCCACACGG + Intergenic
919857092 1:201713403-201713425 GGAGGCTTGAGTGCTCAACAGGG + Intronic
921889471 1:220339396-220339418 GGTTGCTAGGGTGCTTCACTGGG + Intergenic
922740280 1:228010548-228010570 GGAGCTTGCTGTGCTCCACTAGG - Intronic
1062925127 10:1310634-1310656 GGAGGCTGCTGCGCTCCAGTCGG + Intronic
1063950985 10:11223327-11223349 GTATGCTGGGGTGCTCCACAAGG - Intronic
1064240595 10:13624519-13624541 GGAGGGCGGGGAGCCCCACTTGG - Intronic
1066502066 10:36003919-36003941 CGAGGCTGGGGTGCAGCGCTGGG - Intergenic
1066698043 10:38095485-38095507 GGAGGGTGCTGTCCTCCACTTGG - Intronic
1066994471 10:42551699-42551721 GGAGGGTGCTGTCCTCCACTTGG + Intergenic
1067239109 10:44475285-44475307 GGAGACAGTGGTGCTCCACCTGG + Intergenic
1069546465 10:69332850-69332872 GGAAGCTGCCGTCCTCCACTTGG - Intronic
1071542383 10:86498413-86498435 GGAGGCAGGGGTGAGCCCCTAGG + Intronic
1074711881 10:116184466-116184488 GGAAGATGTGTTGCTCCACTGGG - Intronic
1075485782 10:122820975-122820997 GGAGGCTGGGCTACTCCTCCTGG + Intergenic
1075709945 10:124525604-124525626 GGAGGCTGGTGGGGTCCACATGG + Intronic
1075879910 10:125842188-125842210 GGAGGCTGGCAGGCTCCACCTGG - Intronic
1077222013 11:1422019-1422041 TGAGGTTGGGGTGCCCCACGGGG + Intronic
1082983412 11:59144912-59144934 GGGCGCTGGGGTGCTCCGCGGGG + Exonic
1084274658 11:68045135-68045157 GGAGGCTCAGCTGCCCCACTGGG + Intronic
1084496097 11:69504561-69504583 GGAGGCTGGGGTCCCCAAGTGGG - Intergenic
1084769653 11:71334423-71334445 GGAGGCTGGGGGGCTGCAGCTGG - Intergenic
1084891288 11:72238287-72238309 GGAGGCTGGGGTGCAGGACCCGG + Exonic
1085297204 11:75437924-75437946 GGAGGAGGGGGTGATCAACTTGG + Intronic
1085509473 11:77080926-77080948 GGGGGCTGGGGTGCTCACCAGGG - Intronic
1087015958 11:93554916-93554938 GGAGGCTGGCGAGCTCTAATGGG - Intergenic
1089895508 11:121926765-121926787 GGCGGCTGGCCTTCTCCACTCGG - Intergenic
1090794842 11:130125941-130125963 GCAGTCGGGGGTGCTCCAATGGG + Intronic
1092535323 12:9381257-9381279 TGAGGCTGGAATGATCCACTAGG - Intergenic
1093047163 12:14460638-14460660 GTAGGCTGGGGATTTCCACTAGG - Exonic
1096120817 12:49088566-49088588 GGAAGCTGGGCTGCTCCAGAAGG - Intergenic
1096806273 12:54143055-54143077 GGAGGATGGGGAGCTCCCCGTGG + Intergenic
1097191402 12:57221239-57221261 AGAGGCAGGGGTGCTGCAATAGG - Intronic
1100240557 12:92706845-92706867 GGAAGCTGGGGAGCTCCTGTGGG + Exonic
1102238307 12:111308492-111308514 GGAGGCTGGGCTTCTCCAGAAGG - Exonic
1102871643 12:116418683-116418705 AGAGGGTGGCGTGCTCCTCTAGG + Intergenic
1103728888 12:123013053-123013075 GGAAGCTGGGGTGCTCCATGGGG + Intronic
1107130922 13:36894763-36894785 GGGAGGTGGGGTTCTCCACTGGG - Intronic
1110390917 13:74972951-74972973 GGAGGCTGGGGTGGGCCAGAGGG - Intergenic
1110536299 13:76654459-76654481 GGAAGCTGGAGTCATCCACTTGG + Intergenic
1112020686 13:95368593-95368615 GGAGGCTAAGGTGCTCAAGTGGG - Intergenic
1114377540 14:22164464-22164486 GGAGGCTAGTGTGATCCACGTGG - Intergenic
1118182920 14:63511271-63511293 AAAGCCTGGGGTTCTCCACTTGG - Intronic
1118442855 14:65827766-65827788 AGAGGTGTGGGTGCTCCACTTGG + Intergenic
1119891340 14:78184791-78184813 GGAGCCTGGGGAGCTGAACTAGG + Intergenic
1119932800 14:78564545-78564567 GGAGGCCGGGGTGTTCCATCAGG - Intronic
1121563071 14:94888393-94888415 GGAGCCTGTGGTGCTGCGCTAGG - Intergenic
1121685028 14:95829490-95829512 GGAGGCTGGGGGGCTGCAAAGGG - Intergenic
1124369303 15:29094382-29094404 GGGGGCTGGGGGGTTCCCCTGGG + Intronic
1126407018 15:48331902-48331924 GGGGGGTGGGGTGGTCCATTAGG + Intronic
1128156420 15:65394524-65394546 GAGAGCTGGGGTGCTGCACTGGG + Exonic
1128683273 15:69666508-69666530 GGAGGCTGGGGCTCTTCCCTAGG + Intergenic
1129562459 15:76586181-76586203 GGGTGGTGGGGTGGTCCACTAGG + Intronic
1130142451 15:81239689-81239711 AGAGGCTGGGATTCCCCACTAGG + Intronic
1132801884 16:1758622-1758644 GGAGGCTGGGGGGCTGCATCTGG - Intronic
1133408613 16:5549079-5549101 GGAAGCTGGGGTCCTCCACGAGG - Intergenic
1133859770 16:9583578-9583600 GGACACTGCTGTGCTCCACTGGG - Intergenic
1134057294 16:11178561-11178583 GGAGGCTGTGGGGGTCAACTGGG - Exonic
1134633771 16:15776902-15776924 GGAGGCTGGGCTACTGTACTGGG + Intronic
1138130266 16:54473316-54473338 TGAGGGTGGGGCTCTCCACTGGG + Intergenic
1139506444 16:67400298-67400320 GGAGACTGGGGGGCTCCAGAAGG + Intronic
1139847694 16:69932397-69932419 GGGGCCTGGGGTGCCCCACTGGG + Intronic
1142597276 17:1035752-1035774 GGAGGATGGGATGGTCCACTAGG - Intronic
1143781371 17:9231293-9231315 GGAGGCTGGGGTCCCCCCCCGGG - Intronic
1144924034 17:18787949-18787971 GGAGGCTGGTGAGTGCCACTAGG + Intronic
1145275089 17:21424373-21424395 GGAGGATGGGGTGCTCCCTACGG + Intergenic
1145312943 17:21710273-21710295 GGAGGATGGGGTGCTCCCTACGG + Intergenic
1146055601 17:29579246-29579268 GGAACCTGGGGAGCTTCACTAGG - Intronic
1146633055 17:34484420-34484442 GGAGGCTGGGAGGCTGCACAGGG + Intergenic
1146945243 17:36869172-36869194 GGAGGAGGGTGGGCTCCACTGGG + Intergenic
1147317366 17:39627352-39627374 TGGGGCTGGGGTGCGCGACTCGG - Exonic
1147670842 17:42176000-42176022 GTCGGCTGGGGGGATCCACTTGG - Intronic
1147871282 17:43589282-43589304 GGGGGCGGGGCTGCTACACTGGG - Intergenic
1148492591 17:48032908-48032930 GGAAACTGGAGTTCTCCACTGGG + Intronic
1151197223 17:72440228-72440250 GGAGCCTGGAGTGCTCCATGTGG - Intergenic
1151748375 17:76023567-76023589 GGAGGCTGAGGTGCTGCTCAAGG - Exonic
1152272880 17:79335479-79335501 GGAGGCTGAGGTCCGACACTTGG + Intronic
1152550391 17:81026917-81026939 TGACACTGGGCTGCTCCACTGGG + Intergenic
1152565005 17:81096453-81096475 GGATGCTGGGGTGCGCCTCCAGG - Intronic
1152888962 17:82869100-82869122 GGAGGCTTGGGTGCTCCCCCTGG + Intronic
1153734212 18:8047666-8047688 GGAGGCTGGGGAGCACTATTGGG - Intronic
1154109456 18:11553318-11553340 GGAGGCTGGAAAGATCCACTTGG - Intergenic
1157141469 18:45111551-45111573 GGAGGTTGTTTTGCTCCACTTGG + Intergenic
1159040203 18:63318068-63318090 GGAGGCTGGGTAGGTGCACTTGG - Exonic
1159996240 18:74968126-74968148 AAAGGCTGGGGTGCTCCTTTTGG + Intronic
1160011523 18:75110075-75110097 GGAGGCTGGGGAGCGCCCCTGGG + Intergenic
1160811508 19:1014888-1014910 GGGCCCTGGTGTGCTCCACTTGG - Intronic
1161850274 19:6734332-6734354 TGAGGCTGGGGGGCTGAACTTGG + Intronic
1162758305 19:12873618-12873640 CGAGGCTGGGGAGCTGCTCTGGG - Exonic
1163284495 19:16338044-16338066 GCAGGCTGGGGTGCTTCTATGGG - Intergenic
1163640090 19:18457227-18457249 GAAGGCTGGGCTGCACCTCTGGG - Intronic
1165443134 19:35842251-35842273 GGGGAGTGGGGTGCTCCACCTGG + Exonic
1165867224 19:38946232-38946254 GCAGGCTGGGGTGGTCCACAGGG - Intronic
1166118671 19:40671651-40671673 GGAGGCTGGGCTGCTCCAAAAGG - Intronic
1167286503 19:48601398-48601420 GGAGGCTGGGGTGGGGCCCTGGG + Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168489028 19:56792287-56792309 GGAGGCTGAGGTGATCCACCCGG + Intronic
1168691835 19:58382027-58382049 GGAGGCTGTGGTTCCCCAATGGG - Intergenic
925905951 2:8539773-8539795 GGAGGCTGGGGTGTCCCACTGGG - Intergenic
925905981 2:8539849-8539871 GGAGGCTGGGGTCCCCCAGTGGG - Intergenic
926118706 2:10229319-10229341 GGAGGGTGGGGGGCTCCACAGGG + Intergenic
926323034 2:11762259-11762281 GGAGGCTGGGGTGCTAGAGAGGG - Intronic
927562603 2:24084431-24084453 TGAGGCTGGGCTGCTCCGCGAGG - Exonic
927710483 2:25322694-25322716 GGAGGCTTGGGTGGTCATCTCGG - Intronic
927985698 2:27409217-27409239 GGGGGATGGGGTCCTCCCCTGGG - Intronic
929386262 2:41411005-41411027 GGAAGATGGGGTGCTCCAGAAGG + Intergenic
930277657 2:49332200-49332222 TGAGGCTGTGGTTCTCAACTGGG + Intergenic
933703977 2:85276303-85276325 GGAGGCTGGGATGCCCAACTTGG - Intronic
933840712 2:86283909-86283931 GGAGGGTGGGCTGCTCCCCAAGG - Intronic
934555025 2:95282530-95282552 ATTGGCTGGGATGCTCCACTTGG + Intronic
934623933 2:95833070-95833092 GGAGGCCGAGGTCCTTCACTGGG + Intergenic
936397869 2:112142641-112142663 GGAGACTGCGGTGCTCCTCATGG + Intronic
937389373 2:121470083-121470105 GGAATCTGAGGTGCTCCTCTAGG + Intronic
937485249 2:122308777-122308799 GGAGCATGGGGTTCTCCCCTTGG - Intergenic
937952699 2:127400979-127401001 GGAGGCAGGGGCGCTCCGCCGGG - Intergenic
937976366 2:127584389-127584411 GGAGGCTGGGAAACTCCATTTGG + Intronic
938333232 2:130463631-130463653 GCAGGATGGGGTGCTCCTCAGGG + Exonic
938356579 2:130657040-130657062 GCAGGATGGGGTGCTCCTCGGGG - Exonic
938644700 2:133318794-133318816 GGTGGCTGGTATGCTCCCCTGGG + Intronic
941809645 2:169742770-169742792 GGAGTCTGGGATGGTCCATTTGG - Intronic
941979024 2:171434520-171434542 GGAGTGTGGGGCGCGCCACTCGG + Exonic
946045331 2:216816238-216816260 AGAGGCTTGGAAGCTCCACTGGG + Intergenic
1169224244 20:3846527-3846549 GGAGGAGGGGCTGCTTCACTTGG + Intergenic
1169334349 20:4743105-4743127 GGAGGCTAGAATGATCCACTTGG + Intergenic
1172847394 20:37938102-37938124 GGAGGCTGGGGTGATGGCCTGGG + Intronic
1173611440 20:44371077-44371099 GGAGGCCTGGGTGCTCCCCTGGG + Intronic
1174428610 20:50451227-50451249 GGTGGCTGGGGTGCTGGCCTCGG - Intergenic
1174500644 20:50981509-50981531 GGAAGATGGGATGCTCCACATGG - Intergenic
1175487617 20:59356655-59356677 GGTTGCTGGGGTGCCCCACAGGG + Intergenic
1179134141 21:38664713-38664735 GGACCCAGGGATGCTCCACTTGG - Intergenic
1179543393 21:42099098-42099120 GGAGGCTGGAGTGCTGTACAGGG + Exonic
1179624171 21:42638873-42638895 GGAGGCTGGGGTGGTCCATGTGG + Intergenic
1180001150 21:44996083-44996105 GGAGGCTGGGGAGGACCTCTGGG + Intergenic
1180848151 22:18995533-18995555 GGAGACTGGGGTGCTGCTCCTGG + Intergenic
1180868827 22:19134699-19134721 GGGGGCTGGGGTGCACCCCCAGG + Intronic
1181360107 22:22327717-22327739 GGAGGCTGAGGTGCCAGACTTGG - Intergenic
1181363771 22:22358163-22358185 GGAGGCTGAGGTGCCAGACTTGG - Intergenic
1181366585 22:22381248-22381270 GGAGGCTGAGGTGCCAGACTTGG - Intergenic
1181370329 22:22410183-22410205 GGAGGCTGAGGTGCCAGACTTGG - Intergenic
1181372946 22:22432366-22432388 GGAGGCTGAGGTGCCAGACTTGG - Intergenic
1181516110 22:23414759-23414781 GGAGGCCGGGGTGCCCCTCCAGG - Intergenic
1181587931 22:23864105-23864127 GGAGGCTGGGATGCTCAGATTGG + Intronic
1181770346 22:25120511-25120533 GAGGGCTTGGGTGCTCCACAGGG + Intronic
1182073700 22:27480523-27480545 GGAGGCTGGGATGAACCACTGGG + Intergenic
1184307932 22:43620207-43620229 GGAGGCTGAGGTGGATCACTTGG + Intronic
1185221006 22:49629291-49629313 GGAGGCTGGGGTGCACGGCGGGG + Intronic
1185221083 22:49629594-49629616 GGAGGCTGGGGTGCAGGGCTGGG + Intronic
1185221104 22:49629658-49629680 GGAGGCTGGGGTGCAGGGCTGGG + Intronic
1185221125 22:49629722-49629744 GGAGGCTGGGGTGCAGGGCTGGG + Intronic
1185221146 22:49629786-49629808 GGAGGCTGGGGTGCAGGGCTGGG + Intronic
1185284762 22:49995284-49995306 GGAGGCTGGGGTCCAGCACCTGG + Exonic
950140331 3:10610902-10610924 AGAGGCTGGAGAGCTTCACTTGG + Intronic
950203403 3:11060648-11060670 GGAGGCTCGAGTGCTCCCCAAGG + Intergenic
950565504 3:13767427-13767449 GGGGGCTGGGGTGGGACACTGGG + Intergenic
950682476 3:14594566-14594588 GGAGGGAGAGGAGCTCCACTTGG + Intergenic
952300509 3:32100668-32100690 GGAGGCTGGAGTCCTCTACGTGG - Intergenic
953339763 3:42123484-42123506 AGATCCTGGGGTGCTCCACACGG - Intronic
953389565 3:42526503-42526525 GGAGGCTGGAGTCCTCAGCTAGG + Intronic
953809076 3:46096510-46096532 TGAGGCAGGGATGCTCCAATGGG - Intergenic
955112327 3:55961028-55961050 GGAGGCTGAGCTACTCCGCTGGG + Intronic
961442332 3:126960479-126960501 GGAAGATGGGCTGCTCCCCTCGG + Intergenic
962200864 3:133400187-133400209 GGAGGCTGGGGGGCTCTCCAGGG - Exonic
966195744 3:177312283-177312305 GGAGACTGTCGGGCTCCACTTGG + Intergenic
966983356 3:185157710-185157732 GGAGAATGAGGTGCTCCAGTTGG + Intergenic
967265848 3:187691576-187691598 GGAGGCTGAGGTGGACCACGAGG - Intergenic
967995765 3:195165227-195165249 GGAGGCTGGAGAGCACCACCTGG - Intronic
968479334 4:826512-826534 GGAGGCGGGGGCGCGTCACTCGG - Intergenic
968592545 4:1466184-1466206 GGAGGCCGGCCTGCTGCACTTGG - Intergenic
969492793 4:7509609-7509631 GGGGGCTGGGGTGAACCACCAGG + Intronic
969658361 4:8510748-8510770 GGAAGCTGGGGGGCTGCCCTGGG + Intergenic
971424627 4:26503523-26503545 GGAGGCTGCTGGGCACCACTGGG + Intergenic
972877949 4:43388392-43388414 CCAGGCTAGGGTGCTTCACTTGG - Intergenic
975738148 4:77401659-77401681 TGAGGCTAGGGCTCTCCACTGGG + Intronic
979672192 4:123371677-123371699 GGGGCCTGGTGTGCTCAACTGGG - Intergenic
983229138 4:165112502-165112524 GGAGGCTGGGGTGGGCTCCTGGG - Intronic
984140794 4:176002043-176002065 GGAGGGTGGGGGGCTGCGCTTGG - Intronic
985365856 4:189231964-189231986 TGAGGCTGGGGTGTTCCAGGTGG + Intergenic
985681229 5:1256948-1256970 CGAGGCTGTGGTGGTCCACGTGG - Intronic
986179682 5:5382196-5382218 GGAGGCCCTGGTGCTCGACTGGG - Intergenic
986630116 5:9763724-9763746 GGATGCTGGGTTGCGGCACTTGG - Intergenic
986947170 5:13036785-13036807 GGAGGCTAGAGTGATCCACATGG + Intergenic
987572807 5:19687224-19687246 GGAGGGAGTGATGCTCCACTTGG + Intronic
988815487 5:34830309-34830331 GGATGATGTGGTCCTCCACTGGG + Intronic
991371467 5:65925148-65925170 GGAGGCTGAGCTGCGCCGCTGGG + Intergenic
992081040 5:73234349-73234371 GGAGGCTGGGCCGCTCGCCTTGG - Intergenic
995276803 5:110286504-110286526 GGACGCTGGGGTGCTCCATTTGG + Intergenic
999872408 5:155766057-155766079 AGAGGCTGGGTTGTTCCTCTAGG + Intergenic
1001400777 5:171445223-171445245 GGAGGCAGGGCTGGTCCACAGGG + Intronic
1001569058 5:172718323-172718345 GGAGGCTGGGGAGACCCACTGGG - Intergenic
1003087151 6:3068997-3069019 GAAGTCAGGGGTGCTCCGCTAGG + Intronic
1006223832 6:32519394-32519416 TCACGCTTGGGTGCTCCACTTGG + Exonic
1006230427 6:32581581-32581603 TCACGCTTGGGTGCTCCACTTGG + Exonic
1006239118 6:32661991-32662013 GGAGGCTGGGGTGCTCCACGTGG + Exonic
1006245563 6:32731444-32731466 GGAGGCTGGGGTGCTCCAGATGG + Intergenic
1006247749 6:32755041-32755063 GGAGGCTGAGGTGCTCCACATGG + Intergenic
1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG + Exonic
1006284880 6:33085185-33085207 CCAGGCTGGTGTGCTCCACTTGG - Exonic
1006290062 6:33128052-33128074 CCAGGCTGGGGTGCTCCACTTGG - Intergenic
1006429278 6:33985152-33985174 GGAGGCTGGGGAGCACCGCATGG + Intergenic
1007342823 6:41202377-41202399 AGAGGTTGAGGAGCTCCACTGGG + Intergenic
1007347407 6:41242660-41242682 AGAGGTTGAGGAGCTCCACTGGG - Intergenic
1007372072 6:41432529-41432551 GGAGGCTGGGGTGGGCCAGGGGG - Intergenic
1007383313 6:41504184-41504206 CGAGGCTGGGGGGCTCCCCCGGG + Intergenic
1012023373 6:93955679-93955701 GGAGAGAGAGGTGCTCCACTGGG - Intergenic
1018229715 6:161663872-161663894 AGAGGCTGGGATGCTGCACATGG + Intronic
1020584241 7:10046127-10046149 GGAGGCTGAGGTGTTCCATCTGG - Intergenic
1025246056 7:57318230-57318252 GGTGGCTGGGGTGCTGGCCTTGG + Intergenic
1026413595 7:70154748-70154770 GGAGGCTGGAGTGCAGCACATGG + Intronic
1026874669 7:73872279-73872301 GGGGGGTGGGGCGCTGCACTGGG + Intergenic
1028875894 7:95823157-95823179 GGTGGCTGAGGTAGTCCACTAGG - Intronic
1029000380 7:97148126-97148148 GGAGGCTGAGGTGGATCACTTGG - Intronic
1029241359 7:99165436-99165458 TGAGGGTGGGGTGCTCCTCGAGG - Intergenic
1029491920 7:100875342-100875364 GGAGCCTGGGGGGCCCCGCTGGG + Intronic
1031414824 7:121483421-121483443 GGAGGGTGGGGTGCTCCTAGGGG + Intergenic
1032483221 7:132263127-132263149 GGAGGCTGAGCTTCTCCCCTGGG + Intronic
1034203928 7:149299518-149299540 GGAGACTGTGCTTCTCCACTGGG + Intergenic
1035095599 7:156352238-156352260 GGAGGATGAAGTGCTCCTCTGGG - Intergenic
1036528296 8:9556058-9556080 AGAGGCTGGGGTGGTCCCCGGGG - Exonic
1036785492 8:11683240-11683262 CGGGGCTGGCGTGCTCCACCTGG + Intronic
1037890921 8:22623349-22623371 GGAGGCATGGGGGCGCCACTGGG - Intronic
1038193091 8:25341871-25341893 GGAGCCTGGGCTGCTACACCTGG + Intronic
1039971512 8:42324938-42324960 GGAGGCTTGGGTGCTTAACATGG + Intronic
1040107632 8:43549481-43549503 GGAGGCTGGGGTTGTCCTCCAGG - Intergenic
1040440050 8:47431575-47431597 GGAGGCGGAGGTGCTCAGCTAGG + Intronic
1044599410 8:93988734-93988756 GGAGGCTGGGGTGGTAGACAAGG + Intergenic
1048460175 8:134615061-134615083 TGAGGCTGGTGTGGTCCAGTGGG - Intronic
1049588102 8:143441157-143441179 GGAGGCTGTGGCGCTGCACGGGG + Intronic
1049747078 8:144267459-144267481 GGAGGCTGGGGAGCTGGACCAGG + Intronic
1049799959 8:144513156-144513178 TGAGGGTGGGGTGGACCACTGGG + Intronic
1051598452 9:18848624-18848646 CCAGGCTGGGGTGCTCCAAGAGG - Intronic
1052569758 9:30204759-30204781 GGAGGCTGGGCAGGTTCACTTGG - Intergenic
1053368577 9:37541744-37541766 GGAGGCTGGTGGCCTCCCCTTGG - Exonic
1056632309 9:88303974-88303996 GTCAGCTGGGGTGCTCCACTTGG + Intergenic
1057580942 9:96287254-96287276 GGAGGCTGACCTGCACCACTGGG - Intronic
1058633572 9:107014698-107014720 GGAGTCTGGGTTGCTCCATCTGG + Intergenic
1060430958 9:123551291-123551313 TGAGGCAGAGGGGCTCCACTTGG - Intronic
1060497099 9:124126872-124126894 GGAGGCTGGGGAGCAGCGCTTGG - Intergenic
1060514831 9:124258858-124258880 GGAGGCTGTGGTGGGCCCCTCGG + Intronic
1061294723 9:129670935-129670957 GGGTGCTGGGATGCTCCAGTTGG + Intronic
1061478158 9:130883009-130883031 AGACGCTTGGGTGCTCCTCTGGG - Intronic
1061957565 9:133971531-133971553 GGGGCCTGAGCTGCTCCACTGGG + Intronic
1062212610 9:135372929-135372951 GGTGGCTGTGGGGCTCCACCGGG - Intergenic
1062454576 9:136629521-136629543 GGAGACTGGGGTCCTCGCCTGGG + Intergenic
1187826313 X:23335374-23335396 GGAGGCTGGGAGGCTCCAGTCGG - Intronic
1189261638 X:39683076-39683098 GAAGGCTGGGGTCTTCCACATGG - Intergenic
1189355397 X:40306595-40306617 TGAGGCTGGAGTGCTGCAGTAGG + Intergenic
1192657118 X:73003471-73003493 GGAGGCTGCGGGGCCCCCCTTGG + Intergenic
1192665002 X:73079530-73079552 GGAGGCTGCGGGGCCCCCCTTGG - Intergenic
1194445929 X:93987004-93987026 GGAGGGGGGTGTGCTTCACTGGG - Intergenic
1195942010 X:110174684-110174706 GGAGGTTCAGGTGCTCCACAAGG + Exonic
1196812390 X:119639063-119639085 GGAGCTGGGGATGCTCCACTAGG - Intronic
1196959858 X:120989836-120989858 GGAAACAGGGGTGCTCCATTGGG - Intergenic
1197147373 X:123184930-123184952 GGAGGCTGGGATGCTGCAAGGGG + Intronic
1197870452 X:131058467-131058489 GGGGGCTGGGGTGCTCGGCCGGG + Intronic
1199747373 X:150781969-150781991 GGAGGCGGGGATGCACCACACGG + Intronic
1199982939 X:152930785-152930807 GAAGGCTGGAGTGGCCCACTGGG + Intronic
1200003646 X:153074202-153074224 GGAGGCTGAGGAGCTCCTCCAGG + Exonic
1200004077 X:153075807-153075829 GGAGGCTGAGGAGCTCCTCCAGG - Intergenic
1200180027 X:154144414-154144436 GGAGGCTGGGTGGCTGCACTGGG + Intronic
1200185855 X:154182808-154182830 GGAGGCTGGGTGGCTGCACTGGG + Intergenic
1200191507 X:154219946-154219968 GGAGGCTGGGTGGCTGCACTGGG + Intronic
1200197262 X:154257750-154257772 GGAGGCTGGGTGGCTGCACTGGG + Intronic
1200236767 X:154471545-154471567 GGAGGCGGGACTGCTCCACCAGG - Exonic
1201062430 Y:10059288-10059310 GGAGGCTGGGGAGCACCCCAGGG + Intergenic
1201143159 Y:11045051-11045073 CAAGGCTGGTGTGCCCCACTGGG - Intergenic