ID: 1006249223

View in Genome Browser
Species Human (GRCh38)
Location 6:32766363-32766385
Sequence ATTCTAAGAGATGCTGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006249223_1006249227 13 Left 1006249223 6:32766363-32766385 CCCTGGTCAGCATCTCTTAGAAT No data
Right 1006249227 6:32766399-32766421 GTGCAGTTGAATGTAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006249223 Original CRISPR ATTCTAAGAGATGCTGACCA GGG (reversed) Intergenic
No off target data available for this crispr