ID: 1006249224

View in Genome Browser
Species Human (GRCh38)
Location 6:32766364-32766386
Sequence GATTCTAAGAGATGCTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006249224_1006249227 12 Left 1006249224 6:32766364-32766386 CCTGGTCAGCATCTCTTAGAATC No data
Right 1006249227 6:32766399-32766421 GTGCAGTTGAATGTAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006249224 Original CRISPR GATTCTAAGAGATGCTGACC AGG (reversed) Intergenic
No off target data available for this crispr