ID: 1006250416

View in Genome Browser
Species Human (GRCh38)
Location 6:32778665-32778687
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1082
Summary {0: 6, 1: 529, 2: 187, 3: 149, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006250409_1006250416 -7 Left 1006250409 6:32778649-32778671 CCCTTCCCACGAGGCCATATTTC 0: 302
1: 230
2: 198
3: 85
4: 107
Right 1006250416 6:32778665-32778687 ATATTTCAGACTATCCCATGGGG 0: 6
1: 529
2: 187
3: 149
4: 211
1006250410_1006250416 -8 Left 1006250410 6:32778650-32778672 CCTTCCCACGAGGCCATATTTCA 0: 341
1: 217
2: 177
3: 56
4: 140
Right 1006250416 6:32778665-32778687 ATATTTCAGACTATCCCATGGGG 0: 6
1: 529
2: 187
3: 149
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006250416 Original CRISPR ATATTTCAGACTATCCCATG GGG Intergenic
900201613 1:1410154-1410176 ATATTTCAGACTATCACATGGGG - Intergenic
900234425 1:1580690-1580712 ATATTTCAGACTATCACATGGGG - Intergenic
900907974 1:5574230-5574252 ATATTTCAGACTATCACATGGGG + Intergenic
901150287 1:7096793-7096815 ATATTTCAGGCAAACCAATGGGG - Intronic
901601573 1:10427010-10427032 ATATTTCAGACTATCACATGGGG - Intergenic
901955928 1:12785573-12785595 ATATTTCAGACTATCACATGAGG + Intergenic
901978354 1:13013075-13013097 ATATTTCAGACTATCACATGGGG + Intronic
901979302 1:13021626-13021648 ATATTTCAGACTATCACATGGGG + Intronic
901990989 1:13113866-13113888 ATATCTCAGGCTATCACATGGGG - Intergenic
902002780 1:13207312-13207334 ATATTTCAGACTATCACATGGGG - Intergenic
902003730 1:13215863-13215885 ATATTTCAGACTATCACATGGGG - Intergenic
902022011 1:13353076-13353098 ATATTTCAGACTATCACATGGGG - Intergenic
902022954 1:13361607-13361629 ATATTTCAGACTATCACATGGGG - Intergenic
902248225 1:15135926-15135948 ATATTTCAGACTATCACATGGGG + Intergenic
902281734 1:15379615-15379637 ATATTTCAGACTTTCACATGGGG + Intronic
903038641 1:20511818-20511840 AAATTTCAGACTGTCCCAGTAGG - Intergenic
903746161 1:25588197-25588219 ATATTTCAGACTATCACATGGGG - Intergenic
904269271 1:29338677-29338699 ATATTTCAGACTATCACATGGGG + Intergenic
904272512 1:29359673-29359695 ATATTTCAGACTATCACATGGGG - Intergenic
904796991 1:33063864-33063886 ATCTCTCAGACTATCACATGGGG - Intronic
905227622 1:36489564-36489586 ATATTTCAGACTATCACATGGGG + Intergenic
905380824 1:37560296-37560318 ATATTTCAGGCTATCACGTGGGG + Intronic
905751837 1:40472108-40472130 ATAGTTCAGACTATCACATGGGG - Intergenic
905762554 1:40572373-40572395 ATATTTCAGACTATCACATGGGG - Intergenic
906402293 1:45513857-45513879 ATATTTCAGACTATCACATGGGG - Intronic
906404166 1:45528448-45528470 ATATTTCAGACTATCACATGGGG - Intergenic
906498205 1:46320639-46320661 ATATTTCAGACTATCACATGGGG - Intergenic
906499328 1:46329891-46329913 ATATTTCAGACTATCACATGGGG - Intergenic
906564481 1:46788917-46788939 GTATCTCAGGCTATCACATGTGG - Intronic
906601513 1:47133553-47133575 ATATTTCAGACTGTCACATAGGG - Intergenic
906941125 1:50256418-50256440 ATATTTCAGACTTCCCCTTCAGG - Intergenic
907120814 1:52006591-52006613 ATATTTCAGACTATCACATGGGG - Intergenic
907254567 1:53168866-53168888 ATATTTCAGACTATCACATGGGG + Intergenic
907465918 1:54636714-54636736 ATATTTCAGACTATCACATGGGG + Exonic
908022674 1:59914717-59914739 ATATTTCAGACTATCACATGGGG - Intronic
908024748 1:59938783-59938805 ATATTTCAGACTATCACATGGGG + Intergenic
908238769 1:62171604-62171626 ATATTTCAGACTATCACATGGGG + Intergenic
908543092 1:65140143-65140165 ATATTTCAGACTATCACATGGGG - Intergenic
908660032 1:66425413-66425435 ATATTTCAGACTATCACATGGGG + Intergenic
908674875 1:66592185-66592207 ATATCTCAGACTATCACATGGGG + Intronic
908798810 1:67857886-67857908 ATATTCCAAACTATTCCCTGAGG + Intergenic
909023812 1:70461029-70461051 ATATTTCAGACTATCACATGGGG + Intergenic
909234122 1:73129895-73129917 ATATTTCAGACTATCACATGGGG + Intergenic
909345459 1:74580415-74580437 ATATTTCTGACTATTCCCTTAGG + Intronic
909413178 1:75377433-75377455 ATATTTCAGACTATCACATGGGG - Intronic
909413829 1:75382838-75382860 ATATTTCAGACTATCACATGGGG - Intronic
909651795 1:77983468-77983490 ATATTTCAGACTATCACATGGGG + Intronic
909781067 1:79548261-79548283 ATATTTCATTCTATCTTATGTGG - Intergenic
909793434 1:79702689-79702711 ATATTTCAGACTACCACATGGGG - Intergenic
910504471 1:87934167-87934189 ATATTTCAGAGTTCTCCATGTGG - Intergenic
910604389 1:89067461-89067483 ATATTTCAGACTATCACATGGGG + Intergenic
910937878 1:92501153-92501175 ATATTTTCTACTATTCCATGAGG - Intergenic
911010662 1:93277380-93277402 ATATTTCAGACTATCACATGGGG + Intronic
911667490 1:100570366-100570388 ATATTTCTGACTATTCAATGTGG - Intergenic
911947855 1:104135342-104135364 ATATTTCAGACTATCACATGGGG + Intergenic
911956969 1:104248950-104248972 ATATTTAAGACTAACACATTTGG + Intergenic
912301046 1:108517793-108517815 ATATTTCAGACTATCACATGGGG - Intergenic
912642443 1:111360319-111360341 ATATTTCAGACTATCACATGAGG + Intergenic
912814396 1:112817403-112817425 ATATTTCAGACTATCACATGGGG + Intergenic
912942593 1:114058500-114058522 ATATTTCAGACTATCACGTGGGG - Intergenic
913601428 1:120425099-120425121 GTATTTCAGACTATCACATGGGG - Intergenic
914085620 1:144451496-144451518 GTATTTCAGACTATCACATGGGG + Intronic
914097492 1:144556122-144556144 ATATTTCAGACTATCACATGGGG + Intergenic
914191512 1:145415475-145415497 GTATTTCAGACTATCACATGGGG + Intergenic
914252438 1:145932780-145932802 ATATCTCAGGCTATCACATGGGG - Intergenic
914301502 1:146381496-146381518 ATATTTCAGACTATCACATGGGG - Intergenic
914358311 1:146907843-146907865 ATATCTCAGGCTATCACATGGGG + Intergenic
914362614 1:146948659-146948681 GTATTTCAGACTATCACATGGGG - Intronic
914379942 1:147106708-147106730 ATATCTCAGGCTATCACATGGGG + Intergenic
914393181 1:147240443-147240465 ATATTTCAGGCTATCACATGGGG - Intronic
914441333 1:147710034-147710056 ATATTTCAGACTATCACATGGGG + Intergenic
914444060 1:147734439-147734461 ATATTTCAGACTATCACATGGGG + Intergenic
914489054 1:148138435-148138457 GTATTTCAGACTATGACATGGGG + Intronic
914495113 1:148189164-148189186 ATATCTCAGGCTATCACATGGGG - Intergenic
914589440 1:149093479-149093501 GTATTTCAGACTATCACATGGGG + Intronic
914765591 1:150635266-150635288 ATATTTCAGACTATCACATGGGG - Intergenic
914773118 1:150709564-150709586 ATATTTCAGACTATCACATGGGG - Intronic
915052354 1:153088876-153088898 ATATTTCAGACTATCACATGGGG + Intergenic
915158386 1:153897509-153897531 CTATCTCAGACTACCCAATGTGG + Intronic
915397946 1:155600135-155600157 ATATTTCAGACTATCACATGGGG + Intergenic
915401811 1:155627264-155627286 ATATTTCAGACTATCACATGGGG + Intergenic
915402715 1:155635476-155635498 ATATTTCAGACTATCACATGGGG + Intergenic
915480227 1:156179570-156179592 ATATTTCAGACTATCACATGGGG - Intergenic
915480558 1:156181808-156181830 ACATTTCAGACTATCACATGGGG - Intergenic
915890402 1:159768143-159768165 ATATTTCAGACTTTCACATGGGG - Intergenic
916005035 1:160652486-160652508 ATATTTCAGACTGTCACATGGGG - Intergenic
916009380 1:160691133-160691155 ATATTTCAGACTATCACATGGGG - Intronic
916010273 1:160699396-160699418 ATATTTCAGACTATCACATGGGG - Intronic
916034943 1:160913503-160913525 ATATTTCAGACTATCACATGGGG - Intergenic
916039404 1:160949421-160949443 ATATCTCAGGCTATCACATGGGG + Intronic
916048280 1:161017183-161017205 ATATTTCAGACTATCACATGGGG - Intronic
916092220 1:161316278-161316300 ATATTTCAGACTATCACATGGGG + Intronic
916103511 1:161413003-161413025 ATATCTCAGGCTATCAGATGGGG - Intergenic
916106189 1:161434278-161434300 ATATTTTAGACTATCACATGGGG - Intergenic
916468138 1:165092931-165092953 ATATCTCTGGCTATCACATGGGG - Intergenic
918784877 1:188751840-188751862 ATATTTCAGACTATCACATGGGG + Intergenic
919326124 1:196109334-196109356 ATATTTCAGACTATCACATGGGG + Intergenic
919484529 1:198130311-198130333 ATATTTCAGACTATCACATGGGG + Intergenic
919579975 1:199359232-199359254 ATATTGCTGCCTATTCCATGTGG + Intergenic
919673173 1:200356425-200356447 AAATTTCAGACTAGCCGATGTGG - Intergenic
920629283 1:207635709-207635731 ATATCTCAGGCTATCACATGGGG + Intronic
920796373 1:209141530-209141552 ATATTTCAGACTATCACATGGGG - Intergenic
920873543 1:209814003-209814025 AGTTTCCTGACTATCCCATGAGG - Intergenic
921019429 1:211222730-211222752 ATATCTCAGGCTATCACATGGGG + Intergenic
921086610 1:211799795-211799817 ATATTTAAGACAATCCCATCTGG - Intronic
921821201 1:219619203-219619225 ATATCTCAGGCTATCACATGGGG + Intergenic
922305404 1:224340178-224340200 ATATTTCAGACTATCACATGGGG - Intergenic
922484888 1:225966207-225966229 ATATTTCAGACTATCACATGGGG - Intergenic
922715531 1:227868938-227868960 ATAATTCAGACTATCACATGGGG + Intergenic
923440333 1:234012439-234012461 ATATTTCAAACTATCACATGGGG + Intronic
923725854 1:236504876-236504898 ATATTTCAGACTACCACATGGGG - Intergenic
924666955 1:246083032-246083054 ATATTTCAGACTGTCACATGGGG - Intronic
924764184 1:247016381-247016403 ATATTTCAGACTGTCACATGGGG + Intergenic
924953662 1:248907526-248907548 GTATTTCAGACTATCACATGGGG + Intronic
1063114124 10:3061835-3061857 ATATTTCAGACTATAACATGGGG - Intergenic
1063530340 10:6824778-6824800 ATATTTCAGACTATCACATGGGG + Intergenic
1063531260 10:6833272-6833294 ATATTTCAGACTATCACATGGGG + Intergenic
1064395670 10:14980184-14980206 ATAATTCGGAGTATCCCAGGGGG + Intronic
1064834479 10:19510394-19510416 ATATTTCAGACTATCACATGGGG + Intronic
1065453407 10:25881729-25881751 GTATTTCAGACTATCACATGGGG + Intergenic
1065500560 10:26377483-26377505 ATATCTCAGGCTATCACATGGGG + Intergenic
1065553734 10:26893817-26893839 ATATTTCAGACTATCACATGGGG - Intergenic
1065809333 10:29427089-29427111 ATATTTCAGGCTATGACATGGGG - Intergenic
1066175056 10:32894834-32894856 ATATTTCAGACTATCACATGGGG - Intergenic
1066635274 10:37493672-37493694 ATATCTCAGGCTATCACATGGGG - Intergenic
1066927254 10:41713533-41713555 ATATTTCAGACTATCACATGGGG - Intergenic
1067012808 10:42730354-42730376 ATAGTTCGGACTATCCAAAGTGG + Intergenic
1067101430 10:43337550-43337572 ATATTTCAGACTATCACATGGGG - Intergenic
1068482817 10:57615745-57615767 ATATTTCAAACCATCCTGTGAGG - Intergenic
1069184842 10:65409828-65409850 ACATTTCAGACTATCACATGGGG + Intergenic
1069452077 10:68526016-68526038 GTATTTCAGACTATCACATGGGG - Intronic
1069677297 10:70257569-70257591 ATATTTCAGACTATCATATGGGG - Intronic
1070998305 10:80806259-80806281 ATATTTCAGACTATCACATGGGG - Intergenic
1071725291 10:88192489-88192511 ATATTTAATGCCATCCCATGCGG + Intergenic
1071916844 10:90302237-90302259 ATATCTCAGGCTATCACATGGGG + Intergenic
1072410517 10:95197822-95197844 ATATTTCAGACTATCACATGGGG + Intronic
1072541760 10:96403617-96403639 ATATTTCAGACTATCACATGGGG - Intronic
1072669288 10:97417429-97417451 ATATTTCAGACTATCACATGGGG + Intronic
1072708564 10:97700195-97700217 ATATTTCAGACTATTGCATGGGG - Intergenic
1072947307 10:99821435-99821457 ATATTTCAGACTATCACATGGGG + Intronic
1073286350 10:102391793-102391815 ATATTTCAGACTATCACATGGGG - Intergenic
1075370477 10:121930536-121930558 ATATCTCAGGCTATCACATGGGG + Intergenic
1076459229 10:130628300-130628322 ATATTTCAGACTATCACATGGGG - Intergenic
1076932459 10:133541654-133541676 ATATTTCAGACTATCACATGGGG + Intronic
1077577441 11:3395181-3395203 ACTTTTCAGACTATCACATGGGG + Intergenic
1077585439 11:3448052-3448074 ATATTTCAGACTATCACATAGGG + Intergenic
1077586351 11:3456579-3456601 ATATTTCAGACTATCACATGGGG + Intergenic
1077597373 11:3545729-3545751 ATATTTCAGACAATCACATGGGG - Intergenic
1077603939 11:3594287-3594309 ACTTTTCAGACTATCACATGGGG + Intergenic
1077703278 11:4461095-4461117 ATATTTCAGACTATCACATGGGG + Intergenic
1077889442 11:6408221-6408243 ATTTTTCAGACTCTCTCCTGTGG - Intronic
1078216927 11:9319359-9319381 GTATTTCAGACTATCACATGGGG + Intergenic
1078327418 11:10391907-10391929 ATATTTCAGACTATCACATGGGG + Intronic
1078394931 11:10972684-10972706 ATATCTCAGACCATCCTATGTGG - Intergenic
1079262861 11:18900461-18900483 ATATCTCAGGCTATCACTTGGGG - Intergenic
1079664930 11:23093132-23093154 ATATTTCAGACTATCACATGCGG + Intergenic
1079769968 11:24446433-24446455 ATATTTCAGACTATCACATGGGG - Intergenic
1079780474 11:24596083-24596105 ATATTTCCCAGTATCCCATAAGG - Intronic
1079851444 11:25541079-25541101 ATATTTCAGACTATCACATGGGG - Intergenic
1080518971 11:33049911-33049933 ATATCTCAGGCTATTGCATGGGG + Intronic
1081014506 11:37859281-37859303 GTATGTCAGACTATCACCTGGGG - Intergenic
1081019756 11:37930944-37930966 ATATTTCAGACTATCACATGGGG - Intergenic
1082267195 11:50131765-50131787 ATATTTCAGACTATCACATGGGG + Intergenic
1082288893 11:50346803-50346825 ATATTTCAGACTATCACATGGGG - Intergenic
1082621701 11:55431342-55431364 ATATTTCAGGCTATCACATGGGG - Intergenic
1082672951 11:56058001-56058023 ATATTTCAGACTATCACATGGGG - Intergenic
1082706891 11:56503200-56503222 ATATTTCAGACTATCACATGGGG + Intergenic
1082706911 11:56503305-56503327 ATATTTCAGACTATCACATGGGG + Intergenic
1082716387 11:56618948-56618970 ATATTTCAGACTATCACATGGGG + Intergenic
1082724493 11:56719032-56719054 ATATTTCAGACTATCACGTGGGG - Intergenic
1082890308 11:58132053-58132075 AACTTTCTGACTATCCCAGGAGG + Intronic
1082969536 11:59005075-59005097 ATATCTCAGGCTATCACGTGGGG - Intronic
1082982515 11:59136629-59136651 ATATTTCAGACTATCACATGGGG - Intergenic
1083040563 11:59681506-59681528 ATATCTCAGGCTATCACATGGGG - Intergenic
1083139972 11:60713766-60713788 ATATTTCAGACTATCACATGGGG + Intronic
1083285413 11:61655607-61655629 ATATTTCAGACTATCACATGGGG + Intergenic
1083372785 11:62195008-62195030 GTATTTCAGACTATCACATGGGG - Intergenic
1083375409 11:62216290-62216312 ATATTTCAGACTATCACATGGGG - Intergenic
1083393054 11:62369084-62369106 ATATCTCAGGCTATCACATGGGG + Intronic
1083394785 11:62382727-62382749 ATATCTCAGGCTATCACATGGGG + Intronic
1083467610 11:62859114-62859136 ATATTTCAGACTATCACATGGGG + Intronic
1083543130 11:63528569-63528591 ATATTTCAGACTATCACATGGGG + Intergenic
1083543427 11:63530912-63530934 ATATTTCAGACTATCACATGGGG + Intergenic
1083797186 11:65023825-65023847 ATATTTCAGACTCTCACATGGGG + Intronic
1084207418 11:67603952-67603974 ATATTTCAGACTATCACATGGGG + Exonic
1084229393 11:67739966-67739988 ACTTTTCAGACTATCACATGGGG + Intergenic
1084231695 11:67758231-67758253 ATATCTCAGGCTATCACATGGGG - Intergenic
1084242345 11:67830611-67830633 ATATCTCAGACTATCACATGGGG + Intergenic
1084247408 11:67868562-67868584 ATATTTCAGACTATCACATGGGG + Intergenic
1084253475 11:67921637-67921659 ACTTTTCAGACTATCACATGGGG - Intergenic
1084259839 11:67968877-67968899 ACTTTTCAGACTATCACATGGGG + Intergenic
1084799701 11:71535049-71535071 ATATCTCAGGCTATCACCTGGGG - Intronic
1084808801 11:71599739-71599761 ACTTTTCAGACTATCACATGGGG - Intronic
1084812934 11:71626375-71626397 ACTTATCAGACTATCACATGGGG - Intergenic
1084819405 11:71674289-71674311 ACTTTTCAGACTATCACATGGGG + Intergenic
1084830788 11:71767543-71767565 ATATTTCAGACTATCACATGGGG + Intergenic
1084845907 11:71899731-71899753 ACTTTTCAGACTATCACATGGGG - Intronic
1084880082 11:72164721-72164743 ATATTTCAGACTATCACATGGGG - Intergenic
1085305406 11:75482863-75482885 TTAATGCAGACCATCCCATGGGG - Intronic
1085463897 11:76711464-76711486 ATATTTCAGACTATCACATGGGG - Intergenic
1087314122 11:96586477-96586499 ATATTTCAGACTATCACATGGGG - Intergenic
1087654688 11:100907990-100908012 AAATTTCACAATATCCTATGTGG + Intronic
1087723716 11:101695410-101695432 ATATTTCAGACTATCACATGGGG - Intronic
1087724647 11:101703908-101703930 ATATTTCAGACTATCACATGGGG - Intronic
1088032211 11:105265199-105265221 ATATTTCAGACTATCACATCGGG - Intergenic
1088858378 11:113777415-113777437 ATATTTCAGACTATCACATGGGG - Intergenic
1089471228 11:118721611-118721633 ATATTTCAGACTATCACATGGGG + Intergenic
1089472123 11:118729804-118729826 ATATTTCAGACTATCACATGGGG + Intergenic
1089487153 11:118855353-118855375 ATATTTCAGAATATCACAGGAGG - Intergenic
1089517068 11:119039867-119039889 ATATCTCAGGCTATCACATGGGG + Intergenic
1090039721 11:123280059-123280081 ATATTTCAGGCTATCATATGGGG - Intergenic
1091719903 12:2805217-2805239 CTAATCCAGACTCTCCCATGAGG + Exonic
1091963882 12:4721830-4721852 ATATTTCAGATGGTCACATGGGG + Intronic
1092059555 12:5537365-5537387 ATATTTCAGACTGTCACATGGGG - Intronic
1092142265 12:6191899-6191921 ATATTTCAGACTGTCACATGGGG + Intergenic
1092249699 12:6886452-6886474 ATATTTCAGACTATCATATGGGG + Intronic
1092405668 12:8220555-8220577 ATATTTCAGACTATCACATGGGG - Intergenic
1092412587 12:8265313-8265335 ATATCTCAGACTATCACATGGGG + Intergenic
1092431133 12:8409847-8409869 ACTTTTCAGACTATCACATGGGG + Intergenic
1092434038 12:8432036-8432058 ACTTTTCAGACTATCACATGGGG + Intergenic
1092437519 12:8462279-8462301 ATATTTCAGACTATCACATGGGG - Intronic
1092455086 12:8636004-8636026 ATATTTCAGACTATCACATGGGG - Intergenic
1092559819 12:9600813-9600835 ATATTTCAGACTATCACATGGGG - Intronic
1092645926 12:10571866-10571888 ATATTTCAGACTATCACATGGGG + Intergenic
1092873215 12:12825428-12825450 ATATTTCTGATTATCACAGGTGG - Intronic
1093559146 12:20517108-20517130 CTATTTCATACTTTCCAATGCGG + Intronic
1093650936 12:21645290-21645312 ATATTTCAGACTATCACGTGGGG - Intronic
1094389371 12:29932652-29932674 ATATTTCAGACTATCACATGGGG + Intergenic
1094623202 12:32099858-32099880 ATATTTCAGACTATCACATGGGG - Intergenic
1094815651 12:34180902-34180924 ATATTTCAGACTATCATATGGGG + Intergenic
1094874853 12:34628917-34628939 ATACCTCAGGCTATCACATGGGG + Intergenic
1095063764 12:37738686-37738708 ATATTTCAGACTGTCACATGGGG + Intergenic
1095080667 12:37995904-37995926 ATATTTAAGACTATCACATGGGG - Intergenic
1095456125 12:42388065-42388087 ATATTTCAGACTGTCACATGGGG - Intronic
1096125432 12:49116022-49116044 ATATTTCAGACTATCACATGGGG - Intergenic
1096420702 12:51454885-51454907 ATATTTCAGACTATCACATGGGG + Intronic
1096599176 12:52717405-52717427 ATATTTCCAAATGTCCCATGGGG + Intergenic
1096940038 12:55333778-55333800 ATATTTTAGACTATCACATGGGG - Intergenic
1097076811 12:56400959-56400981 ATATTTCAGACTATCACATGGGG + Intergenic
1097132435 12:56822486-56822508 ATATTTCAGACTATCACATGGGG - Intergenic
1097277206 12:57821687-57821709 ATATTTCTGGCTAGCACATGGGG + Exonic
1097330532 12:58328057-58328079 ATATTTCAGACTATCACATGGGG + Intergenic
1097331467 12:58336546-58336568 ATATTTCAGACTATCACATGGGG + Intergenic
1097350536 12:58543759-58543781 ATATTTCAGACTATCACATGGGG + Intergenic
1097399142 12:59108562-59108584 ATATTTCAGACTATCACATGGGG - Intergenic
1098838047 12:75445173-75445195 ATATCTCAGGCTATCACATAGGG - Intergenic
1098850707 12:75592950-75592972 ATATTTCAGACTATTTCAGACGG - Intergenic
1099105771 12:78494521-78494543 ATAAATCAAACTATCACATGAGG + Intergenic
1100276287 12:93074750-93074772 ATATTTCAGACTATCACATGGGG - Intergenic
1100948968 12:99823994-99824016 AGATTTCAAACTATTCCATAAGG - Intronic
1101520665 12:105479158-105479180 ATATTTCAGACTATCACATGGGG + Intergenic
1101798255 12:107997665-107997687 ATATTTCAGACTATCACATGGGG + Intergenic
1102135440 12:110570385-110570407 ATATTTCAGACTATCACATGGGG - Intronic
1103092353 12:118106324-118106346 ATATTTCAGACTATCACATGGGG - Intronic
1103688442 12:122751465-122751487 ATATTTCAGACTATCACATGAGG + Intergenic
1103794310 12:123492953-123492975 ATATTTCAGACTATCACATGGGG - Intronic
1104238102 12:126959301-126959323 ATATTTCAGACTATCACATGGGG + Intergenic
1104689570 12:130815225-130815247 AAATTTCAGAATACCCCTTGGGG - Intronic
1105055089 12:133091161-133091183 ATATTTCAGACTCTCACATTGGG + Intronic
1105055626 12:133096096-133096118 ATATTTCAGACTATCACATGGGG + Intronic
1105209859 13:18251303-18251325 ATATTTCAGACTGTCACTTGGGG - Intergenic
1105349120 13:19600565-19600587 ATATTTCAGACTATCACATGGGG - Intergenic
1105574313 13:21636164-21636186 AGAGTTGAGACTTTCCCATGGGG - Intergenic
1105688736 13:22814251-22814273 ATATTTCAGACTATCACATGGGG + Intergenic
1105779282 13:23692479-23692501 ATATTTGAGCCTATACCATCAGG - Intergenic
1105879514 13:24591911-24591933 ATATTTCAGACTATCACCTGGGG - Intergenic
1105920320 13:24957144-24957166 ATATTTCAGACTATCACCTGGGG + Intergenic
1107667833 13:42711152-42711174 ATATTTCAGACTATCACATGGGG - Intergenic
1107700368 13:43041137-43041159 ATATTTCAGACTATCACATGGGG + Intronic
1108352415 13:49599370-49599392 ATATTTCAGACTATCACATGGGG - Intergenic
1108813910 13:54267396-54267418 ATATCTCAGGCTATCACGTGGGG + Intergenic
1109043147 13:57369051-57369073 ATATTTCAAACTATCTGATGAGG - Intergenic
1109959815 13:69615474-69615496 ATATTTCAGACTATCACATGGGG + Intergenic
1110710627 13:78647145-78647167 ATATCTCAGGCTATCACATAGGG - Intronic
1111552217 13:89828372-89828394 AAATTTCAGAATTTCCAATGAGG + Intergenic
1112367112 13:98764700-98764722 ATATTTCAGACTATCACATGGGG - Intergenic
1113970177 13:114182538-114182560 GTATTTCAGACTATCACATGGGG + Intergenic
1113991702 14:16032880-16032902 ATATTTCAGACTATCACATGGGG - Intergenic
1114006543 14:18319826-18319848 ATATTTCAGACTATCACATGGGG - Intergenic
1114072943 14:19129791-19129813 ATATTTCAGACTATCACATGGGG - Intergenic
1114089322 14:19270202-19270224 ATATTTCAGACTATCACATGGGG + Intergenic
1114168055 14:20242185-20242207 ATATTTCAGACTATCACATGGGG + Intergenic
1114170587 14:20269270-20269292 ATATTTCAGACTGTCACATGGGG - Intronic
1114431333 14:22664230-22664252 ATATTACTGACTATTTCATGAGG - Intergenic
1114438155 14:22725283-22725305 ATATTTCAGACTATCACATGGGG + Intergenic
1114603249 14:23973199-23973221 ATATTTCAGACTATCACATGGGG + Intronic
1114604100 14:23982120-23982142 ATATTTCAGACTATCACATGGGG + Intronic
1114607619 14:24010320-24010342 ATATTTCAGACTATCACATGGGG + Intergenic
1114608228 14:24015682-24015704 ATATTTCAGACTATCACATGGGG + Intergenic
1114609122 14:24024917-24024939 ATATTTCAGACTATCACATGGGG + Intergenic
1115898515 14:38118447-38118469 ATATTTCAAACTATCATATGGGG - Intergenic
1116464310 14:45214068-45214090 ATATCTCAGGCTATCACATGGGG - Intronic
1117034252 14:51711002-51711024 ATATTTAAGGCTCTCTCATGAGG - Intronic
1117365623 14:55024897-55024919 ATATTTCAGACTATCACATGGGG - Intronic
1118054213 14:62062525-62062547 TTTTTTCAGACTATTCCCTGAGG - Intronic
1118352050 14:64979186-64979208 ATATTTCAGACTATCACATGGGG + Intronic
1119823145 14:77635875-77635897 ATATTTCAGACTATCACATGGGG + Intergenic
1119826629 14:77661996-77662018 ATATTTCAGACTATCACATGGGG + Intergenic
1119841331 14:77795272-77795294 ATATTTCAGACTATCACATGGGG + Intergenic
1120264930 14:82236723-82236745 ATATTACAGGCTACCACATGTGG - Intergenic
1120641618 14:87020486-87020508 ATATTTCAGACTATCACATGGGG - Intergenic
1120733106 14:88024688-88024710 ATATCTCAGGCTATCACATGGGG - Intergenic
1121295758 14:92820610-92820632 ATATCTCAGGCTATCACATGGGG + Intronic
1121506608 14:94482552-94482574 ATATCTCAGGCTATCACATGGGG - Intergenic
1121527057 14:94626498-94626520 ATATTTCAGACTATCACATGGGG - Intergenic
1122232251 14:100312388-100312410 ATATCTCAGGCTATCACATGGGG + Intergenic
1122500275 14:102193454-102193476 ATCCTCCAGACAATCCCATGAGG + Intronic
1122997596 14:105273825-105273847 ATATTTCAGACTATCACATGGGG - Intronic
1123052845 14:105555169-105555191 ATATTTCAGACTATCACATGGGG - Intergenic
1123077426 14:105675557-105675579 ATATTTCAGACTGTCACATGGGG - Intergenic
1202858722 14_GL000225v1_random:67220-67242 ATATTTCACAATATCCCCTGTGG - Intergenic
1202919353 14_KI270723v1_random:16596-16618 ATATTTCAGACTATCACATGGGG + Intergenic
1202925279 14_KI270724v1_random:18398-18420 ATATTTCAGACTATCACATGGGG - Intergenic
1123390473 15:19866465-19866487 ATATTTCAGACTATCACATGGGG - Intergenic
1125562319 15:40644571-40644593 ATATTTCAGACTATCACATGGGG + Intronic
1126002925 15:44228959-44228981 ATATTTCAGACTATCACATGGGG - Intergenic
1127266704 15:57368049-57368071 AAATTTCAGAACAACCCATGAGG - Intergenic
1127423640 15:58833928-58833950 ATATTTCAGACTATCACATGGGG + Intronic
1128131022 15:65227140-65227162 ATATTTCAGACTATCACATGGGG + Intergenic
1128193949 15:65734001-65734023 ATATTTCAGACTATCACATGGGG - Intronic
1129406677 15:75323896-75323918 ATATTTCAGGCTATCACATGGGG + Intergenic
1129485876 15:75871452-75871474 ATATTTCAGACTATCACATGGGG + Intronic
1130944499 15:88540899-88540921 ATATTTCAGACTATCACATGGGG - Intronic
1131194825 15:90347190-90347212 ATATTTCAGACTATCACACGGGG + Intergenic
1131775010 15:95785313-95785335 ATATCTCAGGCTATCACATGGGG + Intergenic
1131895782 15:97027839-97027861 ATTTTTAAGCCTATCCCAGGAGG - Intergenic
1131946688 15:97629731-97629753 ATATTTCAGACTATCGCATGGGG + Intergenic
1132440603 15:101860575-101860597 ATATTTCAGACTATCACATGGGG + Intergenic
1132831644 16:1931206-1931228 ATATTTCAGACTATCACATGGGG - Intergenic
1133433014 16:5754986-5755008 ATATTTCAGACTATCACATGGGG + Intergenic
1133602403 16:7352213-7352235 ATTTTTCAGCCTTTCCCAAGAGG + Intronic
1133687436 16:8179359-8179381 ATATTTCAGACTATCACATGGGG + Intergenic
1133991344 16:10709922-10709944 ATTTTTCAAAATATCGCATGGGG - Intergenic
1134007858 16:10830085-10830107 GTATTTCAGACTATCACATGGGG + Intergenic
1134322073 16:13173332-13173354 ATATTTCAGACACTACAATGTGG + Intronic
1134483311 16:14636737-14636759 ATATTTCAGACTATCACATGGGG + Intronic
1135289408 16:21222384-21222406 ATATTTCAGACTATCACATGGGG + Intergenic
1135577847 16:23599823-23599845 ATATTTCAGACTATCACATGGGG - Intergenic
1136911019 16:34144448-34144470 ATATTTCAGACTCTCCTATGGGG - Intergenic
1136930379 16:34412655-34412677 ATATTTCAGACTATCACATGGGG + Intergenic
1136974195 16:34999153-34999175 ATATTTCAGACTATCACATGGGG - Intergenic
1136991466 16:35153805-35153827 ATATTTCAGACTATCACATGGGG - Intergenic
1137075493 16:35956153-35956175 ATATTTCAGACTATCACATCGGG + Intergenic
1137366580 16:47864806-47864828 ATATTTCAGACTATCACATGGGG - Intergenic
1137763110 16:50956569-50956591 ATATTTCCAAATATCCCTTGGGG + Intergenic
1137911688 16:52384267-52384289 ATATTACCAAATATCCCATGGGG + Intergenic
1139029710 16:62864117-62864139 ATATTTGACATTATCACATGTGG + Intergenic
1139394354 16:66628356-66628378 GTATTTCAGACTATCTCACGGGG + Intronic
1139439153 16:66956005-66956027 ATATTTCAGACTATCACAGGCGG + Intergenic
1140418899 16:74799991-74800013 ATATTTCAGACTATCACATGGGG + Intergenic
1140546626 16:75815893-75815915 ATATTTCAGACTATCACATGGGG + Intergenic
1141416543 16:83879814-83879836 ATATCTCAGGCTATCACGTGGGG + Intergenic
1143195779 17:5075277-5075299 ATATTTCAGACTACCACATGGGG + Intergenic
1143459041 17:7088681-7088703 GTATCTCAGGCTATCACATGGGG - Intergenic
1144571213 17:16400480-16400502 ATATTTCAGACTATCACATGGGG - Intergenic
1144624038 17:16835485-16835507 ATATTTCAGACTATCACATGGGG + Intergenic
1144745512 17:17611522-17611544 ATATTTCAGACTGTCACATGGGG + Intergenic
1144882388 17:18437230-18437252 ATATTTCAGACTATCACATGGGG - Intergenic
1144930275 17:18853496-18853518 ATATTTGCCATTATCCCATGTGG - Intronic
1145031053 17:19505552-19505574 ATATTTCAGACTATCACATGGGG + Intronic
1145149846 17:20507156-20507178 ATATTTCAGACTATCACATGGGG + Intergenic
1145363309 17:22230015-22230037 ATATTTCAGACTATCACATGGGG - Intergenic
1146161784 17:30563792-30563814 ATATTTCAGACTATCACTTGGGG + Intergenic
1146181437 17:30700639-30700661 ATATTTCAGACTATCACATGGGG + Intergenic
1146760908 17:35477225-35477247 CTATTTCATTTTATCCCATGTGG - Intronic
1146839465 17:36140400-36140422 ATATTTCAGACTATCACATGGGG - Intergenic
1147838753 17:43355293-43355315 ATATTTCAGACTATCGCATGGGG - Intergenic
1148162151 17:45456501-45456523 AGATTTCACACTATTCTATGGGG + Intronic
1148273725 17:46284212-46284234 ATATTTCAGACTATCACATGGGG + Intronic
1149124113 17:53207355-53207377 TGATTTCAGACTATACTATGAGG + Intergenic
1149202345 17:54201921-54201943 ATATTTCAGACTATCACATGGGG - Intergenic
1149295852 17:55262256-55262278 ATACTTCTGACAATTCCATGAGG - Intergenic
1149913266 17:60585495-60585517 ATATTACAGAATGTCCCATCAGG + Intronic
1150393385 17:64803149-64803171 AGATTTCACACTATTCTATGGGG + Intergenic
1150409334 17:64930369-64930391 ATATTTCAGACTATCACATGGGG - Intergenic
1150686800 17:67327445-67327467 ATATTTCGGACTATCACATGGGG + Intergenic
1150840929 17:68604590-68604612 ATATTTCAGACTCTCACATGGGG + Intergenic
1152429721 17:80241951-80241973 ATATTCCAGAAGATCCCATCTGG - Intronic
1152480917 17:80551806-80551828 ATATTTCAGACTATCACATGGGG + Intronic
1152869594 17:82745127-82745149 ATATTTCAGACTGTCACATGGGG + Intronic
1153143473 18:2001412-2001434 ATATTTCAGACTATCACATGGGG + Intergenic
1153422098 18:4917878-4917900 ATATTTCAGACTATCACATGGGG + Intergenic
1154530925 18:15344372-15344394 ATATTTCAGACTATCACATGGGG + Intergenic
1155472131 18:26202432-26202454 ATATTTCAGACTATCACATGGGG + Intergenic
1155547184 18:26927870-26927892 ACATTTCAGACTATCACATGGGG + Intronic
1156086199 18:33406745-33406767 ATAATCCATACTTTCCCATGGGG + Intronic
1156563106 18:38151845-38151867 ATTTTACAGACTATGCCATGTGG - Intergenic
1156806096 18:41184216-41184238 ATATCTCAGGCTATCACATGGGG - Intergenic
1157777188 18:50404807-50404829 ATATCTCAGGCTGTCACATGGGG + Intergenic
1158214016 18:55080326-55080348 AGATGTAAGAATATCCCATGTGG - Intergenic
1158659051 18:59369103-59369125 ATATTTCCCACTTTCCGATGTGG + Intergenic
1159336737 18:67077382-67077404 ATATTTCAGACTATCACATGGGG + Intergenic
1159397747 18:67885988-67886010 AGATTTCAAACTATACCATAAGG + Intergenic
1159413027 18:68105841-68105863 ATGTTTCAGACTATCACATGGGG + Intergenic
1159477566 18:68942867-68942889 ATGTTTCAGACTATCACATGGGG + Intronic
1159484938 18:69043450-69043472 ATATTTCAGACTATCACATGGGG + Intronic
1159606448 18:70479499-70479521 ATATTTCAGACTATCACATGGGG - Intergenic
1159887903 18:73927033-73927055 ATATCACAGACTATCCCCTGTGG - Intergenic
1160164929 18:76502392-76502414 ATATATCACAATAACCCATGAGG + Intergenic
1160593740 18:79960464-79960486 ATATTTCAGACTATCACATGGGG - Intergenic
1160675168 19:387019-387041 ATATTTCAGACTGTCACATGGGG - Intergenic
1161479869 19:4505117-4505139 ATAGTTCAAACTTCCCCATGAGG + Intronic
1162096834 19:8315196-8315218 ACATCTCAGGCTATCACATGGGG - Intronic
1162668144 19:12232421-12232443 ATATTTCAGACTATCACATGGGG + Intronic
1163628178 19:18402815-18402837 ATGTTTCAGACTATCCCATGGGG - Intergenic
1163898810 19:20082686-20082708 ATATTTCAGACTATCACATGGGG - Intronic
1163907072 19:20156938-20156960 ATATTTCAGACTATCACATGGGG + Intergenic
1163920706 19:20286099-20286121 ATATTTCAGACTATCACATGGGG - Intergenic
1163937884 19:20466674-20466696 ATATCTCAGGTTATCACATGGGG - Intergenic
1164041479 19:21496539-21496561 ATATGTCACAATGTCCCATGTGG - Intergenic
1164049018 19:21568291-21568313 ATATTTCAGACTATCACATGGGG - Intergenic
1164055755 19:21620840-21620862 ATATTTCAGACTATCACATAGGG + Intergenic
1164108826 19:22135601-22135623 ATATTTCATAATATCCCTTGAGG - Intergenic
1164122834 19:22283883-22283905 ATATTTCAGACTATCACATGGGG - Intergenic
1164128962 19:22344589-22344611 ATATGTCATAATGTCCCATGTGG - Intergenic
1164129142 19:22346198-22346220 ATATTTCAAAATCTCCCTTGAGG - Intergenic
1164153673 19:22575285-22575307 ATATTTCAGACTATCACATGGGG - Intergenic
1164154347 19:22581139-22581161 ATATTTCAGACTATCACATGGGG - Intergenic
1164170457 19:22720436-22720458 ATATGTCATAATGTCCCATGTGG + Intergenic
1164205684 19:23056745-23056767 ATATTTCACAATACCCCCTGAGG + Intergenic
1164208606 19:23078087-23078109 ATATCTCAGACTATCACATGGGG - Intronic
1164273282 19:23693036-23693058 AAATTTCAGACTGTCACATGGGG - Intergenic
1164276620 19:23724239-23724261 ATATTTCAGACTGTCACATGGGG + Intergenic
1164370365 19:27638188-27638210 ATATTTCAGACTATCACATGGGG + Intergenic
1164390415 19:27814942-27814964 ATATCTCATGCTATCACATGGGG - Intergenic
1164424701 19:28130977-28130999 ATATTTCAGGCTATCACATGGGG - Intergenic
1164489031 19:28689910-28689932 ATATTTCAGACTATCACATGGGG + Intergenic
1165206593 19:34193642-34193664 GTATTTCAAGCTGTCCCATGGGG + Intronic
1165295111 19:34920526-34920548 ATATCTCAGACTATCACATGGGG - Intergenic
1165506459 19:36233962-36233984 ATATTTCAGACTATCACATGGGG + Intronic
1165508095 19:36247563-36247585 ATATTTCAGACTATCACATGGGG + Intergenic
1165523548 19:36332779-36332801 ATATCTCAGGCTATCACATGGGG + Intergenic
1165574147 19:36799902-36799924 ATATCTCAGGCTATCGCATGAGG - Intergenic
1165595088 19:37006506-37006528 ATATTTCAGACTATCACATGGGG - Intergenic
1165606263 19:37107233-37107255 ATATCTCAGGCTATCACATGGGG + Intronic
1165633463 19:37321134-37321156 ATATTCCAGACCATCACAAGGGG - Intronic
1165634794 19:37331738-37331760 ATCTTTCAGACTATCACATGGGG - Intronic
1165655718 19:37530401-37530423 GTATTTCAGACTATCACATGGGG + Intronic
1165666219 19:37630543-37630565 ATATTTCAGACTATCACATGGGG + Intronic
1165691397 19:37866524-37866546 ATATTTCAGACTATCACATGGGG - Intergenic
1165814252 19:38631731-38631753 ATATTTCAGACTATCACATGGGG + Intronic
1165837584 19:38769006-38769028 ATCTTTCAGAAAATCCCCTGTGG - Intronic
1165936082 19:39389869-39389891 AGCTTTCAGACTCTGCCATGGGG - Intronic
1165952036 19:39479832-39479854 ATATTTCAGACTATCACATGGGG - Intergenic
1166013282 19:39959827-39959849 GTATTTCAGACTATCACATGGGG + Intergenic
1166248027 19:41544956-41544978 ATATTTCAGACTATCACATGGGG - Intergenic
1166619293 19:44281201-44281223 GTATCTCAGGCTATCACATGGGG + Intronic
1166653635 19:44594443-44594465 ATATTTCAGACTATCACATGGGG - Intergenic
1167238632 19:48330232-48330254 ACATTTCCCAATATCCCATGGGG - Intronic
1167336568 19:48889983-48890005 ATATTTCAGACTATCACATGGGG - Intronic
1167818596 19:51906040-51906062 ATATTTCAGACTATCACATGGGG - Intronic
1167818972 19:51908788-51908810 ATATTTCAGACTATCACATGGGG + Intronic
1167819035 19:51909342-51909364 ATATCTCAGGCTATCACATGGGG - Intronic
1167831479 19:52026557-52026579 ATATCTCAGGCTATCATATGGGG - Intronic
1167833112 19:52043480-52043502 ATATTTCAGACTATCACATGGGG - Intronic
1167834049 19:52052070-52052092 ATATCTCAGGCTATCACATGGGG - Intronic
1167867400 19:52339363-52339385 ATATCTCAGGCTATCACATGGGG + Intronic
1167876930 19:52421555-52421577 ATATTTCAGACTATCACATGGGG + Intergenic
1167883840 19:52484448-52484470 ATATTTCAGAATATCACATGGGG + Intronic
1167884041 19:52485884-52485906 ATATTTCAGACTGTCACATGGGG - Intronic
1167910528 19:52698337-52698359 ATATTTCAGACTATCACATGGGG + Intergenic
1167917100 19:52750088-52750110 ATATCTCAGGCTATCACATGGGG + Intergenic
1167997826 19:53420879-53420901 ATATCTCAGGCTATCACATGGGG - Intronic
1168006955 19:53497987-53498009 ATATCTCAGGCTATCACATGGGG - Intergenic
1168052353 19:53838973-53838995 ATATTTCAGACTATCACATGGGG - Intergenic
1168218540 19:54944075-54944097 TTATCTCAGGCTATCACATGGGG - Intronic
1168219587 19:54950880-54950902 ATATTTCAGGCTATCACATGGGG + Intronic
1168235422 19:55060050-55060072 ATATTTCAGACTATCCCACGGGG - Intronic
1168461187 19:56559922-56559944 ATATTTCAGACTATCACATGGGG + Intergenic
1168612233 19:57810653-57810675 ATATCTCAGGCTATCACATGGGG - Intronic
924967842 2:94410-94432 ATATTTCAGACTATCACATGGGG - Intergenic
925037662 2:703178-703200 ATATTTCAGACTATCACATGGGG + Intergenic
925336857 2:3105054-3105076 ATATCTCAGGCTATCACATGGGG + Intergenic
927188827 2:20501798-20501820 ATATTTCAGACTATCACATGGGG + Intergenic
927992828 2:27460326-27460348 ATATTTCAGACTATCACATGGGG - Intronic
928243235 2:29604931-29604953 ATATGTCAGAATATCCCAACAGG - Intronic
928355877 2:30614070-30614092 ATATTTCAGACTATCACATGGGG + Intronic
928540028 2:32276180-32276202 ATATTTCAGACTATCACATGGGG + Intergenic
928715803 2:34058825-34058847 AGATTTCAGTTTCTCCCATGTGG - Intergenic
928990228 2:37225665-37225687 ATATTTCAGACTATCACATGGGG - Intronic
929041716 2:37750939-37750961 ATATTTCAGACCATCACATGGGG - Intergenic
929097511 2:38278132-38278154 ATATTTCAGACTATCGCACGGGG - Intergenic
929208093 2:39321508-39321530 ATATTTCAGACTATCACATGGGG - Intronic
930017947 2:46983758-46983780 ATTTTACAGACTTTCCCATAAGG - Intronic
930786827 2:55279620-55279642 ATATTTCAGACTATCACATGGGG - Intergenic
931770943 2:65497386-65497408 ATCTTTGAAACTATCCTATGAGG + Intergenic
932798677 2:74720327-74720349 ATACTTCAGACTATCACATGGGG - Intergenic
933838042 2:86261647-86261669 ATATTTCAGACTATCACATGGGG - Intronic
934489028 2:94745260-94745282 ATATCTCAGACTATCACTTGGGG + Intergenic
934542969 2:95191718-95191740 ATATTTCAGACTATCACATGGGG - Intergenic
934592384 2:95567543-95567565 ATATTTCAGACTATCACATAGGG - Intergenic
934897371 2:98130466-98130488 ATATTTCAGACTGTCACATGGGG + Intronic
935132357 2:100270165-100270187 GTATATCAGGCTATCACATGGGG - Intergenic
935180438 2:100685214-100685236 ATATTTCAGACTGTCACATGGGG - Intergenic
935656152 2:105425405-105425427 ATATTTCAGACTATCACATGGGG - Intronic
936107497 2:109637465-109637487 ATATTTCAGACTATCACATGGGG + Intergenic
936157257 2:110056419-110056441 ATATCTCAGGCTATCACATGGGG - Intergenic
936187437 2:110315025-110315047 ATATCTCAGGCTATCACATGGGG + Intergenic
936378526 2:111963440-111963462 ATATTTCAGACTATCACATGGGG + Intronic
936486995 2:112934602-112934624 ATATTTCAGACTATCACATGGGG - Intergenic
937873061 2:126799659-126799681 ATATTTCAAACTATCACAGTTGG + Intergenic
937970176 2:127543174-127543196 ATATCTCAGGCTATCACATGGGG + Intronic
938235363 2:129701728-129701750 ATATTTCAGACTATCACATGGGG - Intergenic
938270118 2:129962563-129962585 ATATTTCAGACTATCACATGGGG + Intergenic
938486995 2:131721572-131721594 ATATTTCAGACTATCACATGGGG - Intergenic
938530015 2:132175646-132175668 ATATTTCAGACTATCACATGTGG + Intronic
938821729 2:134967271-134967293 ACTTTTCAGACTATCACATGGGG - Intronic
940358343 2:152769706-152769728 ATATTTCAGACTATCACATGGGG + Intergenic
941262040 2:163309482-163309504 ACATTTCAGACTGTTTCATGTGG + Intergenic
941859479 2:170263909-170263931 ATATCTCAGGCTATCACATGTGG + Intronic
942650582 2:178163152-178163174 ATATTTCAGACATTTCCATCAGG - Intergenic
942951442 2:181726940-181726962 ATATTTTACATTCTCCCATGGGG - Intergenic
942951965 2:181731595-181731617 ATATTTTACATTCTCCCATGGGG - Intergenic
943159034 2:184222541-184222563 ATATTACAAACAATCACATGGGG + Intergenic
943838232 2:192542539-192542561 ATATTTCAGACTATCACATGGGG + Intergenic
943880917 2:193142769-193142791 ATATTTCAGACTATCACATGGGG - Intergenic
943977695 2:194504910-194504932 ATATTTCAGACTATCACATGGGG + Intergenic
944581977 2:201139349-201139371 ATATTTCAGACTATCACATGGGG - Intronic
945175202 2:207037172-207037194 ATATTTCAGACTATCACATGGGG - Intergenic
945232025 2:207601679-207601701 ATATTTCAGTATATTACATGTGG - Exonic
945299157 2:208199902-208199924 ATATTTCAGACTATCACATGGGG - Intergenic
945832380 2:214803232-214803254 ATATTTCAGACTATCACATGGGG - Intronic
946204723 2:218095886-218095908 ATATTTCAGACTATCACATGGGG - Intergenic
946780666 2:223190825-223190847 ATATCTCAGGCTGTCACATGGGG - Intronic
947273423 2:228364240-228364262 ATATTTCAGACTATCACATGGGG + Intergenic
947520755 2:230844235-230844257 ATATTTCAGACTATCACATGGGG + Intergenic
947619074 2:231577123-231577145 ATATTTCAGACTATCACATGGGG - Intergenic
947730090 2:232423353-232423375 ATATTTCAGACTATCACATGGGG - Intergenic
947953563 2:234168663-234168685 ATATTTCAGACTATCACATGGGG + Intergenic
948843452 2:240671723-240671745 ATATTTCAGACTATCACACGGGG - Intergenic
1169247438 20:4034594-4034616 ATATTTCAGACTCTCACATGGGG + Intergenic
1169470968 20:5885352-5885374 ATATTTCAGACCATCATATGGGG - Intergenic
1170397867 20:15947293-15947315 ATACTTCAGACTATCACATGGGG + Intronic
1171264178 20:23756877-23756899 ATATTTCAGACTTTCATATGGGG + Intergenic
1171272875 20:23829949-23829971 ATATTTCAGACTATCACATGGGG + Intergenic
1171276592 20:23861196-23861218 ATATTTCAGACTATCATATGGGG + Intergenic
1171291015 20:23982990-23983012 ATATTTCAGACTGTCACATGGGG - Intergenic
1171450766 20:25234436-25234458 ATATCTCAGGCTATCACATGGGG + Intergenic
1171451880 20:25241596-25241618 ATATTTCAGACTATCACATGGGG - Intergenic
1171770162 20:29316782-29316804 ATATTTCAGACTATCACATGGGG + Intergenic
1171783318 20:29440886-29440908 ATATTTCAGACTATCACATGGGG + Intergenic
1171812871 20:29759577-29759599 ATATTTCAGACTATCACATGGGG + Intergenic
1171817893 20:29804770-29804792 ATATTTCAGAATATCACATGCGG - Intergenic
1171824738 20:29884613-29884635 ATATTTCAGACTATTGCATGGGG + Intergenic
1171900341 20:30850510-30850532 ATATTTCAGACTATCACATGGGG + Intergenic
1171906360 20:30902729-30902751 ATATTTCAGACTATCATATGGGG - Intergenic
1172479513 20:35262722-35262744 ATATTTCAGACTATCACATGGGG + Intronic
1173319056 20:41971243-41971265 ATATTTCAGACTATCACATGGGG - Intergenic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1175573490 20:60041779-60041801 ATATTTCAGACTATCACATGGGG + Intergenic
1176424446 21:6539413-6539435 ATATCTCAGACTATCACATGGGG + Intergenic
1176766486 21:13024090-13024112 ATATTTCAGACTATTACATGGGG - Intergenic
1176838750 21:13820227-13820249 ATATTTCAGACTATCACACGGGG - Intergenic
1176888168 21:14281542-14281564 ATATTTCAGACTATCACATGGGG + Intergenic
1177175164 21:17694814-17694836 ATATTTCAGACTATCACATGGGG + Intergenic
1177199088 21:17933318-17933340 ATATTTCAGACTATCATATGGGG + Intronic
1177249123 21:18569275-18569297 ATATTTCAGACTATCACATGGGG + Intergenic
1177290376 21:19103687-19103709 ATATCGCAGGCTATCACATGGGG - Intergenic
1177301777 21:19255864-19255886 AAATACCAGCCTATCCCATGTGG - Intergenic
1177876004 21:26632900-26632922 AAAGTCCAGACCATCCCATGTGG - Intergenic
1178154522 21:29835748-29835770 ATATTTCAGAATAACCCAATGGG + Intronic
1178741220 21:35203579-35203601 ATTTCTCAGAGTTTCCCATGAGG + Intronic
1178912911 21:36690581-36690603 ATCTTTCAGACTATATCACGTGG + Intergenic
1178975624 21:37218849-37218871 ATATTTGAGACTATCTTAAGTGG - Intergenic
1179444462 21:41421467-41421489 GTATTTCAGACTATCACATGGGG + Intronic
1179699939 21:43147728-43147750 ATATCTCAGACTATCACATGGGG + Intergenic
1179878478 21:44283451-44283473 ATATCTCAGGCTATCACATGGGG + Intergenic
1180315568 22:11274647-11274669 ATATTTCAGACTATCACATGGGG + Intergenic
1180321339 22:11324252-11324274 GTATTTCAGAATATCACATGGGG - Intergenic
1180333009 22:11550010-11550032 ATATTTCAGACTATCACATGGGG - Intergenic
1180333706 22:11556501-11556523 ATATTTCAGACTATCACATGGGG + Intergenic
1180339779 22:11608844-11608866 ATATTTCAGACTATCATATGGGG - Intergenic
1180431052 22:15250637-15250659 ATATTTCAGACTATCACATGGGG - Intergenic
1180491385 22:15852145-15852167 ATATTTCAGACTATCACATGGGG - Intergenic
1180513613 22:16118538-16118560 ATATTTCAGACTATCACATGGGG - Intergenic
1180606017 22:17059511-17059533 ATATTTCAGACTATCACATGGGG - Intergenic
1180766400 22:18348097-18348119 ATATTTCAGACTGTCACCTGGGG + Intergenic
1180779915 22:18514281-18514303 ATATTTCAGACTGTCACCTGGGG - Intergenic
1180812629 22:18771602-18771624 ATATTTCAGACTGTCACCTGGGG - Intergenic
1180837723 22:18939021-18939043 ATATTTCAGACTATCACATGGGG - Intergenic
1180838632 22:18947232-18947254 ATATTTCAGACTATCACATGGGG - Intergenic
1181198788 22:21205850-21205872 ATATTTCAGACTGTCACCTGGGG - Intergenic
1181534873 22:23536409-23536431 ATATTTCAGACTGTCACATGGGG - Intergenic
1181594827 22:23907431-23907453 ATATTTCAGACTATCACATGGGG - Intergenic
1181642621 22:24211487-24211509 ATATTTCAGACTGTCACATGGGG + Intergenic
1181702928 22:24631041-24631063 ATATTTCAGACTGTCACATGGGG + Intergenic
1183864564 22:40693957-40693979 AGATTCCAGAGCATCCCATGGGG - Intergenic
1203228017 22_KI270731v1_random:88987-89009 ATATTTCAGACTGTCACCTGGGG + Intergenic
1203287814 22_KI270734v1_random:164320-164342 ATATTTCAGACTATCACATGGGG - Intergenic
1203293939 22_KI270736v1_random:22459-22481 ATATTTCAGACCATCACATGGGG - Intergenic
949451619 3:4191534-4191556 ATAATTCAGGCTATGGCATGGGG + Intronic
949547178 3:5082194-5082216 ATATTTCAGACTATCACATGGGG + Intergenic
950030400 3:9848280-9848302 ATATTTCAGACTATCACATGGGG + Intronic
950387909 3:12674463-12674485 ATATCTCAGGCTATCACATGGGG - Intergenic
950607124 3:14091783-14091805 ATATTTCAGACTATCACATGGGG + Intergenic
950629535 3:14273191-14273213 ATATTTCAGACTATCACATGGGG - Intergenic
950753063 3:15146150-15146172 ACTTTTCAGACTATCACATGGGG + Intergenic
950823434 3:15788680-15788702 ATATTTCAGATTAACCTATTTGG + Intronic
951886683 3:27531619-27531641 ATATTTCAGACTATCACATGGGG - Intergenic
952685375 3:36141700-36141722 ATATTTCAGACTATCACATGGGG + Intergenic
953059949 3:39418897-39418919 ATATTTCAGACTATCACATGGGG + Intergenic
953481886 3:43258896-43258918 ATATCTCAGGCTATCATATGGGG + Intergenic
953500536 3:43428835-43428857 AGATTTCAGATTTTCCCATTAGG + Intronic
953960076 3:47259881-47259903 ATATTTCAGACTATCACATGGGG - Intronic
954267621 3:49482254-49482276 ATATTTCAGACTATCACATGGGG - Intronic
954400625 3:50317746-50317768 AGATTCCAGAATTTCCCATGGGG - Intergenic
954440660 3:50520229-50520251 ATATTTCAGACTATCACATGGGG - Intergenic
954896306 3:53978112-53978134 ATATTTCAGACTATCACATGGGG + Intergenic
955257103 3:57343562-57343584 ATATTTCAGACTATCACATGGGG - Intronic
956990581 3:74758631-74758653 TGATTTCAAACTATACCATGAGG + Intergenic
957045968 3:75374793-75374815 ACATTTCAGACTATCACATGGGG + Intergenic
957067542 3:75538098-75538120 ATATTTCAGACTATCACATGGGG - Intergenic
957069880 3:75559347-75559369 ATATTTCAGACTATCACATGGGG - Intergenic
957074789 3:75593300-75593322 ACATTTCAGACTATCACATGGGG + Intergenic
957082159 3:75645676-75645698 GTATTTCAGACTATCACATGGGG - Intergenic
958765585 3:98363185-98363207 ATATTTCAGACTATCACATGGGG + Intergenic
958937557 3:100273091-100273113 ATATTTCAGACTATCACATGGGG + Intronic
958943266 3:100336924-100336946 ATATTTCAGACTATCACATGGGG + Intronic
958975782 3:100666738-100666760 ATATTTCAGACTATCACATGGGG + Intronic
959069864 3:101692241-101692263 ATATTTCAGACTATCACATGGGG - Intergenic
959070769 3:101700395-101700417 ATATTTCAGACTATCACATGGGG - Intergenic
959071311 3:101704431-101704453 ATATTTCAGACTATCACATGGGG + Intergenic
959369588 3:105506398-105506420 GTATTTCAGTCTTTTCCATGTGG + Intronic
959985289 3:112564677-112564699 ATATTTCAGACTATCACATGGGG + Intronic
960027443 3:113024875-113024897 ATATTTCAGACTATCACATGGGG + Intergenic
960028356 3:113033074-113033096 ATATTTCAGACTATCACATGGGG + Intergenic
960510201 3:118540468-118540490 ATATCTCAGGCTATCACATGGGG + Intergenic
960809135 3:121611716-121611738 ATATTTCAGACTATCACATGGGG + Intronic
961276416 3:125730817-125730839 ACTTTTCAGGCTATCACATGGGG - Intergenic
961279314 3:125753410-125753432 ACTTTTCAGACTATCACATGGGG - Intergenic
961285610 3:125799875-125799897 ATATTTCAGACTATCACATGGGG + Intergenic
961296737 3:125890798-125890820 ATATTTCAGACTATCACATGGGG - Intergenic
961297557 3:125899132-125899154 ATATTTCAGACTATCACATGGGG - Intergenic
961430959 3:126882776-126882798 ATATTTCACAGTATCACATGTGG - Intronic
961512604 3:127412260-127412282 ATATTTCAGACTATCACATGGGG + Intergenic
961834039 3:129641693-129641715 ATATTTCAGACTATCACATGGGG + Intergenic
961875084 3:130016201-130016223 ACTTTTCAGACTATCACATGGGG + Intergenic
961878021 3:130038916-130038938 ACTTTTCAGACTATCAAATGGGG + Intergenic
961880397 3:130057634-130057656 ATATATCAGGCTATCACATGGGG - Intergenic
961890149 3:130123965-130123987 ATATTTCAGACTATCACATGGGG + Intergenic
962056872 3:131881437-131881459 ATATTTCACAGTTCCCCATGAGG + Intronic
962128616 3:132649143-132649165 ATATTTCAGACTATCACATGGGG - Intronic
962334682 3:134516531-134516553 GAATTTCAGACTATCACATGGGG + Intronic
963068672 3:141284162-141284184 ACATTTCAGACCTTCACATGAGG - Intronic
963216328 3:142752674-142752696 ATATTTCAGACTATCACATGGGG + Intronic
963535438 3:146522608-146522630 ATATTTCAGACTATCACATGGGG - Intronic
965115792 3:164486215-164486237 AAATTTCAGACTTTCCCTCGAGG + Intergenic
965480066 3:169207314-169207336 CTATCTCAGAATATCCCATCTGG + Intronic
966073367 3:175906148-175906170 ATATTTCAGACTATCACATGGGG + Intergenic
966530862 3:180978213-180978235 ATATATCTGACTATTCTATGTGG - Exonic
966733562 3:183170356-183170378 ATATTTCAGACTGTCACATGGGG - Intergenic
966771916 3:183511551-183511573 ATATTTCAGACTATCACATGGGG + Intronic
967025875 3:185563146-185563168 ATATTTCAGACTATCACATGGGG + Intergenic
967026784 3:185571358-185571380 ATATTTCAGACTATCACATGGGG + Intergenic
967176559 3:186866098-186866120 ATATTTCAGACTCTCACATGGGG + Intergenic
967179113 3:186887472-186887494 ATATTTCAGACTATCACACGGGG + Intergenic
967179725 3:186893567-186893589 ATATTTCAGACTATCACATGGGG - Intergenic
967418915 3:189251969-189251991 ATATTTCAGACTATCACATGGGG + Intronic
968095622 3:195928123-195928145 ATATTTCAGACTATCACATGGGG + Intergenic
968221666 3:196944423-196944445 ATATTTCAGACTATCACATGGGG - Intergenic
968373711 4:19380-19402 ACATTTCAGACTATCACATGGGG - Intergenic
968387252 4:152340-152362 ATATTTCAGACTATCACATGGGG + Intronic
968393040 4:208396-208418 ATATCTCAGGCTATCACATGGGG + Intergenic
968987434 4:3883978-3884000 ATATTTCAGACTATCACATGGGG + Intergenic
968990235 4:3905949-3905971 ACATTTCAGACTATCACATGGGG + Intergenic
968992787 4:3925988-3926010 ATATATCAGGCTATCACATGGGG - Intergenic
969000622 4:3977953-3977975 ATATTTCAGACTATCACATGGGG + Intergenic
969001547 4:3986530-3986552 ATATTTCAGACTATCACATGGGG + Intergenic
969012118 4:4074668-4074690 ATATTTCAGACTCTCACATGGGG - Intergenic
969018391 4:4120938-4120960 ACTTTTCAGACTATCACATGGGG + Intergenic
969023077 4:4151139-4151161 ACTTTTCAGACTATCACATGGGG + Intergenic
969730729 4:8955944-8955966 ACTTCTCAGACTATCACATGGGG - Intergenic
969735593 4:8987780-8987802 ACTTTTCAGACTATCACATGGGG - Intergenic
969741966 4:9035041-9035063 ATATTTCAGACTATCACATGGGG + Intergenic
969752474 4:9122161-9122183 ATATTTCAGATTATCACATGGGG - Intergenic
969753395 4:9130720-9130742 ATATTTCAGACTATCACATGGGG - Intergenic
969760449 4:9177428-9177450 ATATTTCAGACTATCGCATGGGG + Intergenic
969786900 4:9465573-9465595 ACTTTTCAGACTATCACATGGGG - Intergenic
969790328 4:9490052-9490074 ACTGTTCAGACTATCACATGGGG - Intergenic
969794811 4:9519235-9519257 ACTTTTCAGACTATCACATGGGG - Intergenic
969812370 4:9658330-9658352 ATATTTCAGACTATCACATGGGG - Intergenic
969813296 4:9666903-9666925 ATATTTCAGACTATCACATGGGG - Intergenic
969822688 4:9732373-9732395 ATATATCAGGCTATCACATGGGG + Intergenic
969825085 4:9751416-9751438 ACTTTTCAGACTATCACATGGGG - Intergenic
969874775 4:10127953-10127975 ATATTTCAGACTCTCACAGGGGG + Intergenic
970418076 4:15878905-15878927 ATATTTCAGACTATCACATGGGG - Intergenic
970440430 4:16077012-16077034 ATATTTCAGACTATCACATGGGG - Intronic
971026956 4:22598388-22598410 ATATTTCAGACTATCACATGGGG + Intergenic
971720073 4:30233513-30233535 ATATTTCAGACTATCACATGGGG + Intergenic
971730725 4:30376132-30376154 ATAGTTCAGGTCATCCCATGCGG + Intergenic
972846941 4:43002261-43002283 ATATTTCAGACTATCACATGGGG + Intronic
972887120 4:43506147-43506169 ATATTTCAGCCTATGCTATTGGG + Intergenic
973273593 4:48285961-48285983 ATATTTCAGACTATCACATGGGG + Intergenic
973711148 4:53631545-53631567 ATTTTTTAAACTATGCCATGGGG - Intronic
974517949 4:62941225-62941247 ATATTTCAGACTGTCACATGGGG - Intergenic
974621127 4:64356224-64356246 ATATTTCAGACTATCACATGGGG - Intronic
974766951 4:66359356-66359378 ATATTTCAGACTATCACATGGGG + Intergenic
974952354 4:68598377-68598399 ATATTTCAGACTATCACATGGGG - Intronic
974952798 4:68602856-68602878 ATATTTCAGACTATCACATGGGG - Intronic
974960501 4:68693815-68693837 ATATCTCAGGCTATCGCATGGGG - Intergenic
975246846 4:72129822-72129844 ATATTTCAGACTATCACATGGGG + Intronic
975519707 4:75287225-75287247 ATATTTCAGACTATCACATGGGG + Intergenic
975851860 4:78580760-78580782 ATATTTCTGTTTTTCCCATGAGG + Intronic
976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG + Intronic
978048914 4:104171345-104171367 ATATTTCAGACTATCACATGGGG - Intergenic
979141644 4:117183460-117183482 ATATTTCAGACTATCACATGGGG - Intergenic
979322742 4:119343130-119343152 ATATTTCAGACTATCACATGGGG + Intergenic
979327464 4:119396712-119396734 ATATTTCAGACTATCACATGGGG - Intergenic
979497196 4:121396903-121396925 ATATTTCAGACTATCACATGGGG - Intergenic
979501612 4:121446647-121446669 ATATTTCAGACTATCACATGGGG + Intergenic
980380582 4:132010202-132010224 ATCTTTCAGACTATGATATGTGG - Intergenic
980512906 4:133816961-133816983 AGATTTCAAACTATCCTATAAGG + Intergenic
980580429 4:134743451-134743473 TGATTTCAAACTATCCCATAGGG + Intergenic
982512860 4:156305360-156305382 ATATTTCAGACTATCACATGGGG + Intergenic
982518801 4:156386982-156387004 ATACTTCAGACTATCACATGGGG + Intergenic
982823795 4:159977085-159977107 ATATCTCAGACTATCACAGGGGG + Intergenic
982876584 4:160659133-160659155 ATATTTCAGACTATCACATGGGG - Intergenic
983001362 4:162418820-162418842 ATATCTCAGGCTATCACATGGGG - Intergenic
983205467 4:164906112-164906134 ATATTTCAGACTATCACATGGGG + Intergenic
983212749 4:164975734-164975756 ATATTTCAGACTATCACATGGGG - Intronic
983214491 4:164990730-164990752 ATATCTCAGACTATCACATGGGG - Intergenic
983215168 4:164996034-164996056 ATATTTCAGACTATCTCATGGGG - Intergenic
983215886 4:165002297-165002319 ATATTTCAGACTATCACATGGGG - Intergenic
983290320 4:165795043-165795065 ATATATAGGACTATCACATGTGG - Intergenic
983313277 4:166093692-166093714 ATATTTCAGACTATCACATGGGG + Intronic
984011750 4:174380377-174380399 ATATTTCAGATTATCACATGGGG - Intergenic
984012114 4:174383377-174383399 ATATTTCAGACTATCACATGGGG - Intergenic
984013603 4:174401108-174401130 ATATTTCAGACTATCACATGGGG - Intergenic
984423440 4:179553774-179553796 ATATTTCAGACTATCACATGGGG + Intergenic
984802377 4:183726888-183726910 ATATTTCAGACTATCACAAGGGG + Intergenic
985057793 4:186050397-186050419 ATATTTCAGACTGCCACACGGGG - Intergenic
985279923 4:188275961-188275983 TTATTTCAGCTTTTCCCATGTGG - Intergenic
985461026 4:190106887-190106909 ACATTTCAGACTATCACATGGGG + Intergenic
985461676 4:190113171-190113193 ACATTTCAGACTATCACATGGGG + Intergenic
985494582 5:197401-197423 ATATTTCAGACTATCACATGGGG + Exonic
985738092 5:1596575-1596597 ATATTTCAGACTATCACATGGGG + Intergenic
985771188 5:1812488-1812510 GTATCCCAGATTATCCCATGTGG + Intronic
986130477 5:4925276-4925298 ATATTTCAGACTATCACATGGGG - Intergenic
986542566 5:8862221-8862243 AAATTTTAGACTATCTCATCAGG + Intergenic
986549613 5:8938088-8938110 ATATTTCAGACTATCACATGGGG - Intergenic
987490845 5:18578802-18578824 ATATTTCAGACTATCACATGGGG - Intergenic
987936038 5:24466116-24466138 ATATTTCAGACTATTACATGGGG - Intergenic
988062988 5:26197782-26197804 ATATTTCAGACTATCACATGGGG - Intergenic
988379998 5:30487251-30487273 ATATTTCAGACTATCACATGGGG + Intergenic
988850592 5:35176733-35176755 GTATTTCAGACTATCACATGGGG - Intronic
989296133 5:39828670-39828692 ATGTATCAGACTATCACATGGGG + Intergenic
989640743 5:43580768-43580790 ATATTTCAGACTATCACATGGGG - Intergenic
989737929 5:44731085-44731107 ATATTTCAGACTATCACATGGGG + Intergenic
989836536 5:46000637-46000659 ATATCTCAGGCTATCACATGGGG + Intergenic
989837418 5:46009535-46009557 ATATCTCAGGCTATCACATGGGG + Intergenic
990171742 5:53058890-53058912 ATTTTGCACACAATCCCATGAGG + Intronic
990414279 5:55571419-55571441 ATATTTCAGACTATCACATGGGG - Intergenic
990475378 5:56157345-56157367 ATATTTCAGACTATCACATGGGG - Intronic
990619739 5:57547016-57547038 CAATTTCAGACTATCACATGGGG - Intergenic
990789737 5:59464134-59464156 ATATTTCAGACTATCACATGGGG - Intronic
992320218 5:75606431-75606453 ATATTTCAGACTATCACATGGGG + Intergenic
992359645 5:76023981-76024003 ATATTTCCAAATATCCCCTGGGG + Intergenic
992655938 5:78909713-78909735 ATATTTCAGACTATCACATGGGG - Intronic
993613943 5:90086679-90086701 ATTTTTCAGACAATCAAATGTGG + Intergenic
993708720 5:91200770-91200792 ATATTTCAGAATTTGCCATTAGG - Intergenic
993781583 5:92072806-92072828 ATATTCCAGACTTTCACAAGTGG - Intergenic
993889574 5:93457208-93457230 ATATTTCAGATTACCACATGGGG + Intergenic
994404584 5:99328771-99328793 ATATTTCAGACTATCACATGGGG - Intergenic
994503198 5:100606401-100606423 ACATTTCAGACTATCACATGGGG - Intergenic
994532006 5:100983632-100983654 ATATTTCAGACTATCACATGGGG + Intergenic
994534340 5:101008459-101008481 ATATTTCAGACTACCACGTGGGG + Intergenic
994936525 5:106259767-106259789 ATATTTCAGACTATCACATGGGG + Intergenic
995750460 5:115448732-115448754 ATATTTCAGACTATCACATGGGG - Intergenic
995878843 5:116821478-116821500 ATATTTCAGACTATCACATGGGG - Intergenic
996163425 5:120195282-120195304 ATATTTCAGACTATCACATGGGG + Intergenic
999295089 5:150454353-150454375 ATATTTCAGACTATCACATGGGG + Intergenic
999560669 5:152797915-152797937 ATATTTCATACTATCACATGGGG + Intergenic
999752196 5:154636583-154636605 ATATTTCAGACTATCACATGGGG + Intergenic
999753046 5:154644277-154644299 ATATTTCAGACTATCACATGGGG + Intergenic
999951718 5:156658304-156658326 ATATTTCAGACTATCACATGGGG + Intronic
999952621 5:156666516-156666538 ATATTTCAGACTATCACATGGGG + Intronic
1000527007 5:162370480-162370502 ATATTTCAGACTATCACATGGGG - Intergenic
1000528658 5:162390461-162390483 ATATTTTTAACAATCCCATGAGG - Intergenic
1001013834 5:168122797-168122819 ATATTTCTCACGATCCCATTTGG - Intronic
1001232118 5:169997473-169997495 ATATTTCAGACTATCACATGGGG + Intronic
1001383604 5:171319725-171319747 ATCTTTCAAACCACCCCATGAGG - Intergenic
1002268916 5:178056647-178056669 ATATTTCAGATTTTCACATAGGG + Intergenic
1002377452 5:178798424-178798446 GTATTTCAGACTGTCACATGGGG - Intergenic
1002482812 5:179514561-179514583 ATATTTCAGACTATCACATGGGG + Intergenic
1002650598 5:180690173-180690195 ATATTTCAGACTATCACATGGGG + Intergenic
1002666232 5:180827613-180827635 ATATTGCAGACTATCACATGGGG - Intergenic
1002722037 5:181267458-181267480 ATATTGCAGACTATCACATGGGG + Intergenic
1002984038 6:2170658-2170680 ACATTACAGACTAACCCATTTGG + Intronic
1003066582 6:2909011-2909033 ATATTTCAGACTATCCCATGGGG - Intergenic
1003492555 6:6636328-6636350 ATCCTTATGACTATCCCATGAGG - Intronic
1004716948 6:18227087-18227109 ATATTTCAGACTATGACATGGGG - Intronic
1005293412 6:24400650-24400672 ATATTTCAGACTATCACATGGGG + Intergenic
1005430265 6:25749113-25749135 ATATTTCAGACTATCACATGGGG + Intergenic
1005453784 6:25999577-25999599 ACATTTCAGACTATCACATGGGG - Intergenic
1005534844 6:26745021-26745043 ATATTTCAGAATAGTACATGGGG - Intergenic
1005618412 6:27597351-27597373 ATATTTCAAACTATCACATGGGG + Intergenic
1005638758 6:27775058-27775080 ATATTTCAGACTATCACATGGGG + Intergenic
1005644224 6:27826254-27826276 ATATTTCAGACTATCACATGGGG + Intergenic
1005729992 6:28687716-28687738 ATATCTCAGGCTATCACATGGGG - Intergenic
1005730458 6:28692346-28692368 CTATCTCAGGCTATCACATGGGG - Intergenic
1006238569 6:32657724-32657746 ATATTTCAGACTATCACATGGGG + Intergenic
1006250416 6:32778665-32778687 ATATTTCAGACTATCCCATGGGG + Intergenic
1006399791 6:33810558-33810580 ATATTTCAGACTATCACAAGGGG + Intergenic
1006538470 6:34720058-34720080 ATATTTCAGACTATCACACGGGG + Intergenic
1007624915 6:43240124-43240146 ATATTTCAGACTATCACATGGGG + Intergenic
1007793541 6:44328640-44328662 ATATTTCAGACTATCACATGGGG + Intronic
1008563911 6:52748905-52748927 ATATTTCAGACTATCACATGGGG + Intergenic
1008565290 6:52762177-52762199 ATATTTCAGACTATCACATGGGG - Intronic
1008578444 6:52883612-52883634 ATATTTCAGACTATCACGTGGGG - Intronic
1008582974 6:52923019-52923041 ATATTTCAGACTATCACATGGGG - Intergenic
1008585874 6:52948327-52948349 ACATTTCAGACTATCACATGGGG + Intergenic
1008619465 6:53257856-53257878 ATATTTGAGACTCTCCTATGTGG + Intergenic
1009193301 6:60655361-60655383 ATATTTCAGACTATTACATGGGG - Intergenic
1009540141 6:64944464-64944486 ATATTTCAGACTATCACATTGGG - Intronic
1009540159 6:64944569-64944591 ATATTTCAGACTATCATATGGGG - Intronic
1010260110 6:73805622-73805644 ACATTTCAGACTATCACATGGGG + Intronic
1010423868 6:75704707-75704729 ATATTTCAGACTATCACATGGGG + Intronic
1010591471 6:77717543-77717565 ATATTTCAGACTATCACATGGGG + Intronic
1010592408 6:77726005-77726027 ATATTTCAGACTATCACATGGGG + Intronic
1010686403 6:78859135-78859157 ATATTTCAGACTATCACATGGGG - Intergenic
1010839725 6:80635030-80635052 ATATTTCAGACTATCACATGGGG - Intergenic
1011536542 6:88381935-88381957 ATATTTCAGACTATCACATGGGG - Intergenic
1011693473 6:89891167-89891189 ATATTTCAGACTATCACATGGGG - Intergenic
1011967160 6:93173712-93173734 ATATTTCAGACTATCACATGGGG - Intergenic
1012120606 6:95361829-95361851 ATATTTCAGACTATCACATGGGG + Intergenic
1012136301 6:95561219-95561241 ATATCTCAGGCTACCACATGCGG + Intergenic
1012458129 6:99429718-99429740 ATATTTCAGACTATCACATGGGG - Intergenic
1012697241 6:102402195-102402217 AGATTTGAGATTATTCCATGTGG - Intergenic
1012956949 6:105581520-105581542 AAATTTAAGACAATGCCATGAGG + Intergenic
1013512975 6:110860256-110860278 GTATTTCACATTATCTCATGGGG - Intronic
1013555796 6:111255686-111255708 ATATTTCAGACTATCACATGGGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014396632 6:120931801-120931823 ATATTTCATACTATCACATGGGG - Intergenic
1014525479 6:122496197-122496219 AGATTTTATACTATGCCATGTGG - Intronic
1014800843 6:125776447-125776469 ATATTTCAGACTATCACATGGGG + Intergenic
1015346481 6:132165243-132165265 ATATATCAGCCTATGCCAGGGGG + Intergenic
1015574794 6:134659708-134659730 ATATTTCAGACTATCACATGGGG + Intergenic
1015878122 6:137844817-137844839 ATATTTCAGACTATCACATGGGG - Intergenic
1016177338 6:141096838-141096860 ATATTTCAGACTATCACATGGGG + Intergenic
1017171125 6:151455808-151455830 ATATTTCAGACTATCACATGGGG + Intronic
1017785409 6:157752811-157752833 ATATTTCAGACTATCACATGGGG + Intronic
1018024686 6:159795329-159795351 ATATTTCAGTCTATCACATGGGG + Intronic
1018060116 6:160083541-160083563 ATATTTCAGACTATCACATGGGG + Intronic
1019071254 6:169346883-169346905 ATATTTCAGACTATCACATGGGG + Intergenic
1019687548 7:2390003-2390025 ATATCTCAGACTATCACATGGGG + Intergenic
1019976145 7:4583024-4583046 ATATTTCAGACTTTCACATGGGG + Intergenic
1019977080 7:4591528-4591550 ATATTTCAGGCTATCACATGGGG + Intergenic
1019978016 7:4600031-4600053 ATATTTCAGGCTATCACATGGGG + Intergenic
1020310129 7:6860863-6860885 ACTTTTCAGACTATCACATGGGG + Intergenic
1020313069 7:6884003-6884025 ACTTTTCAGACTATCACATGGGG + Intergenic
1020315436 7:6902342-6902364 ATATCTCAGGCTATCACATGGGG - Intergenic
1020329388 7:7002371-7002393 ATATTTCAGACTATCACATGGGG + Intergenic
1020336500 7:7066350-7066372 ATTGTTCATAATATCCCATGTGG + Intergenic
1021067771 7:16198069-16198091 ATATTTCAGACTATCACATGGGG - Intronic
1021671579 7:23040203-23040225 ATATTTCAGACTATCACATGGGG - Intergenic
1021747562 7:23757809-23757831 GTATTTCAGACTGTCACATGGGG + Intronic
1022164318 7:27742251-27742273 ATATTTCAGACTATCACATGGGG + Intronic
1022477196 7:30719207-30719229 ATATTTCAGACTATCACATGGGG + Intronic
1023248356 7:38231471-38231493 ATATTTCAGACTATCACATGGGG + Intergenic
1024313247 7:47990020-47990042 ATATTTCAGACTATCACATGGGG - Intronic
1024932234 7:54675808-54675830 ATATTTCAGACTGTCACATGGGG + Intergenic
1025075976 7:55943505-55943527 GTATTTCAGACTATCACATGGGG + Intergenic
1025161474 7:56664927-56664949 ATATCTCACAGTATCCCCTGTGG - Intergenic
1025574532 7:62619576-62619598 ATATTTCAGACTATCACATGGGG - Intergenic
1025850986 7:65243631-65243653 ATATTTCAGACTATCACATGGGG + Intergenic
1025853662 7:65260753-65260775 ATATTTCAGACTCTCACATGGGG + Intergenic
1026008667 7:66619556-66619578 ATATTTCAGACTATCACATGGGG + Intergenic
1026188666 7:68104380-68104402 ATATTTCAGGGTATCATATGGGG + Intergenic
1026425975 7:70294023-70294045 ATATATCCTACTATGCCATGTGG - Intronic
1026736396 7:72951557-72951579 ATATTTCAGACTATCACATGGGG - Intergenic
1027107337 7:75413505-75413527 ATATTTCAGACTATCACATGGGG + Intergenic
1028298171 7:89162088-89162110 ATATTTCAGTCTGTAGCATGTGG + Intronic
1029076879 7:97941646-97941668 ACTTTTCAGACTATCACATGGGG + Intergenic
1029280438 7:99432103-99432125 ATATCTCAGGCTATCACATGGGG - Intronic
1029534775 7:101150451-101150473 ATATTTCAGACTATCCCATGGGG + Intergenic
1029790550 7:102838854-102838876 ATATTTCAGACTATCACATGGGG - Intronic
1029966708 7:104748268-104748290 ATATTTCAGACTATCACATGGGG - Intronic
1030009155 7:105149014-105149036 ATATTTCAGACTATCACATGGGG - Intronic
1030760314 7:113342115-113342137 ATATTTCAGACTATCACATGGGG + Intergenic
1031230628 7:119100840-119100862 ATATTTCAGCCTATCACATGGGG + Intergenic
1031606974 7:123780984-123781006 ATATTTCAGACTATCACATGGGG - Intergenic
1031724608 7:125221768-125221790 ATATTTCAGACTATCACATGGGG + Intergenic
1031795414 7:126168507-126168529 ATATTTCAGACTATCACATGGGG - Intergenic
1032373707 7:131387150-131387172 ATAGTTCAGAATATCACATTTGG + Exonic
1033212116 7:139467752-139467774 ATATTTCAGACTATCCCATGGGG - Intronic
1033349885 7:140553575-140553597 ATATTTCAGACTATCCCATGAGG + Intronic
1033481951 7:141751481-141751503 ATATTTCAGACTATCACATGGGG - Intronic
1034042679 7:147896189-147896211 ATATTTCAGATCATCCCCTTAGG + Intronic
1035349648 7:158237138-158237160 ATATTTCAGACTATCACATGGGG - Intronic
1035518013 8:253132-253154 ACATTTCAGACTATCACATGGGG - Intergenic
1035791472 8:2309464-2309486 AGATTTCAGATAATCCCATCAGG - Intergenic
1035801333 8:2412241-2412263 AGATTTCAGATAATCCCATCAGG + Intergenic
1036240899 8:7080308-7080330 ACATTTCAGACTATCACATGGGG - Intergenic
1036247158 8:7127608-7127630 ACTTTTCAGACTATCACATGGGG + Intergenic
1036261156 8:7241283-7241305 ATATTTCAGACTATCACATGGGG + Intergenic
1036262783 8:7253538-7253560 ATATTTCAGACTGTTACATGGGG + Intergenic
1036264086 8:7261170-7261192 ATATTTCAGACTGTCACATGGGG + Intergenic
1036265382 8:7268792-7268814 ATATTTCAGACTGTCACATGGGG + Intergenic
1036266683 8:7276414-7276436 ATATTTCAGACTGTCACATGGGG + Intergenic
1036267989 8:7284036-7284058 ATATTTCAGACTGTCACATGGGG + Intergenic
1036269293 8:7291658-7291680 ATATTTCAGACTGTCACATGGGG + Intergenic
1036270562 8:7299268-7299290 ATATTTCAGAGTATCGCATCGGG + Intergenic
1036291693 8:7498473-7498495 ATATTTCAGACTATCACATGGGG + Intronic
1036292624 8:7506976-7506998 ATATTTCAGACTATCACATGGGG + Intronic
1036297300 8:7547766-7547788 ATATTTCAGACTGACACATGGGG - Intergenic
1036298603 8:7555421-7555443 ATATTTCAGACTGTCACATGGGG - Intergenic
1036299908 8:7563071-7563093 ATATTTCAGACTGTCACATGGGG - Intergenic
1036301213 8:7570717-7570739 ATATTTCAGACTGTCACATGGGG - Intergenic
1036302513 8:7578366-7578388 ATATTTCAGACTGTCACATGGGG - Intergenic
1036303805 8:7586020-7586042 ATATTTCAGACTGTTACATGGGG - Intergenic
1036305448 8:7598264-7598286 ATATTTCAGACTATCACATGGGG - Intergenic
1036313195 8:7699827-7699849 ATATTTCAGACTATCACATGGGG + Intergenic
1036314823 8:7712077-7712099 ATATTTCAGACTGTTACATGGGG + Intergenic
1036316126 8:7719709-7719731 ATATTTCAGACTGTCACATGGGG + Intergenic
1036317435 8:7727357-7727379 ATATTTCAGACTGTCACATGGGG + Intergenic
1036318743 8:7735005-7735027 ATATTTCAGACTGTCACATGGGG + Intergenic
1036320050 8:7742652-7742674 ATATTTCAGACTGTCACATGGGG + Intergenic
1036321359 8:7750300-7750322 ATATTTCAGACTGTCACATGGGG + Intergenic
1036322668 8:7757948-7757970 ATATTTCAGACTGTCACATGGGG + Intergenic
1036323973 8:7765597-7765619 ATATTTCAGACTGTCACATGGGG + Intergenic
1036325280 8:7773253-7773275 ATATTTCAGACTGTCACATGGGG + Intergenic
1036350787 8:8011076-8011098 ATATTTCAGAGTATCGCATCGGG - Intergenic
1036352067 8:8018710-8018732 ATATTTCAGACTGTCACATGGGG - Intergenic
1036353367 8:8026356-8026378 ATATTTCAGACTGACACATGGGG - Intergenic
1036354660 8:8034012-8034034 ATATTTCAGACTGTTACATGGGG - Intergenic
1036356298 8:8046261-8046283 ATATTTCAGACTATCACATGGGG - Intergenic
1036375686 8:8197556-8197578 ATATTTCAGATTATCACATGGGG - Intergenic
1036376605 8:8206051-8206073 ATATTTCAGACTATCACATGGGG - Intergenic
1036832048 8:12028243-12028265 ACTTATCAGACTATCACATGAGG + Intergenic
1036846062 8:12171504-12171526 ATATTTCAGACTATCGCATGGGG - Intergenic
1036852932 8:12217087-12217109 ATATTTCAGACTATCACATGGGG + Intergenic
1036853844 8:12225588-12225610 ATATTTCAGATTATCACATGGGG + Intergenic
1036867427 8:12413823-12413845 ATATTTCAGACTATCGCATGGGG - Intergenic
1036874305 8:12459609-12459631 ATATTTCAGACTATCACATGGGG + Intergenic
1036875215 8:12468098-12468120 ATATTTCAGATTATCACATGGGG + Intergenic
1036887101 8:12566358-12566380 ATATTTCAGACTATCACATGGGG - Intergenic
1036894694 8:12624454-12624476 AGATTTTGGACTATCACATGGGG - Intergenic
1036902258 8:12679033-12679055 ACTTATCAGACTATCACATGGGG + Intergenic
1037307242 8:17518174-17518196 ATATTTGAGACTATCATATGGGG - Intronic
1037426745 8:18763901-18763923 ATAATACATACTTTCCCATGAGG + Intronic
1037429437 8:18794296-18794318 ATATTTCAGACTATCACATGGGG - Intronic
1037654327 8:20870164-20870186 ATATTCAAAACTATCCCATGAGG + Intergenic
1037713832 8:21379392-21379414 AGACTTCAAACTATACCATGAGG - Intergenic
1038030005 8:23629552-23629574 ATATTTCTGAAGCTCCCATGGGG - Intergenic
1038730080 8:30119019-30119041 ATATTTCAGACTATCACATGGGG + Intronic
1039392657 8:37193966-37193988 ATATTTCAGACTATCACATGGGG + Intergenic
1039674598 8:39647613-39647635 ATATTTCAGACTATCACATGGGG + Intronic
1040027630 8:42796292-42796314 ATATTTCAGACTATCACATGGGG + Intronic
1040126170 8:43740137-43740159 ATATTTCAGACTATCACATGGGG + Intergenic
1040316660 8:46264659-46264681 ATATTTCAGACTATCACATGGGG + Intergenic
1040339181 8:46431605-46431627 ATATTTCAGACTATCACATGGGG + Intergenic
1040382224 8:46884105-46884127 ATATTTCACAATGTCCCCTGGGG + Intergenic
1040413312 8:47176631-47176653 ATATTTCAGACTGTCACATGGGG + Intergenic
1041060757 8:54032279-54032301 ATATTTCAGACTATCACATGGGG + Intergenic
1041374549 8:57200202-57200224 ATATTTCAGACTATCACATGGGG + Intergenic
1041513071 8:58672339-58672361 ATATTTCAGACTATCACATGGGG + Intergenic
1042177178 8:66048221-66048243 ATATTTCTGAGTATCCCTAGAGG + Intronic
1042204398 8:66313681-66313703 ATATTTCAAACTATCACATGGGG + Intergenic
1043135729 8:76521780-76521802 ATACTTCAAACTATACCATAGGG - Intergenic
1043264735 8:78250392-78250414 ATATTTCAAATGATGCCATGGGG + Intergenic
1043278986 8:78439121-78439143 ATATTTCAGACTATCACATGGGG - Intergenic
1044310162 8:90684379-90684401 ATATTTCAGACTATCACATGGGG - Intronic
1044310294 8:90685226-90685248 ATATTTCAGACTATCACATGGGG - Intronic
1045923950 8:107565903-107565925 ATTTTTGAGACTATCACAGGTGG - Intergenic
1046037611 8:108862864-108862886 ATATTGAAGAATATCCCATAAGG + Intergenic
1046280810 8:112028383-112028405 ATATTTCAGCCTTTCCTCTGTGG + Intergenic
1046334873 8:112772522-112772544 ATATTTCAGACTATCACATGGGG - Intronic
1046939535 8:119917642-119917664 ATATTTCAGACTATCACATGGGG - Intronic
1047302456 8:123625535-123625557 ATATTTTAGGCTATTCCAGGAGG - Intergenic
1048276840 8:133072525-133072547 ATATTTCAGACCAAACCATTTGG - Intronic
1048728878 8:137414946-137414968 ATATTTCAGGCTATCACATGTGG + Intergenic
1048947221 8:139460504-139460526 ATATTTCAGACTATCACATGGGG + Intergenic
1049481924 8:142829188-142829210 ATATCTCAGATTATCACATGGGG - Intergenic
1049506256 8:143001131-143001153 ACTTTTCAGACTATCACATGGGG - Intergenic
1049557027 8:143287882-143287904 ATATTTCAGACTGTCACATGGGG + Intergenic
1049663621 8:143832336-143832358 ATATTTCAGACTATCACATGGGG - Intergenic
1049667126 8:143850301-143850323 ATATTTCAGACTGTCACATGGGG + Intergenic
1049725890 8:144146079-144146101 ATATTTCAGACTATCACATGGGG - Intergenic
1049845010 8:144796241-144796263 ATATTTCAGACTATCACATGGGG - Intergenic
1049867715 8:144949804-144949826 ATATTTCAGACTATCACATGGGG - Intronic
1049872652 8:144993101-144993123 GTATTTCACACTATCCCACAGGG - Intergenic
1049876099 8:145021873-145021895 ATATTTCCGACTATCACATGGGG + Intergenic
1049876779 8:145028453-145028475 ATATTTCAGACTATCATATGGGG + Intergenic
1050360350 9:4824722-4824744 ATAGATCAGAATATCTCATGTGG - Intronic
1050385244 9:5082634-5082656 ATATTTCAGACTATCACATGGGG + Intronic
1050972523 9:11895120-11895142 ATATTTTAGACTTTCACATGGGG + Intergenic
1051471271 9:17445708-17445730 ATATTTCAGACTATCACATGGGG - Intronic
1052279397 9:26715809-26715831 ATATTTCAGACTATCACATGGGG + Intergenic
1052469858 9:28880569-28880591 ATATTTCAGACTATCACATGGGG - Intergenic
1052676592 9:31633477-31633499 ATATTTCAGACTATCACATGGGG + Intergenic
1053668759 9:40339089-40339111 ATATCTCAGACTATCACTTGGGG - Intergenic
1053708625 9:40782119-40782141 ATATTTCAGACTATCACATGGGG + Intergenic
1053736378 9:41105539-41105561 ATATTTCAGACTATCACATGGGG - Intergenic
1053918560 9:42965362-42965384 ATATCTCAGACTATCACTTGGGG - Intergenic
1054322250 9:63682207-63682229 ATATTTCAGACTATCACATGGGG + Intergenic
1054379895 9:64479126-64479148 ATATCTCAGACTATCACTTGGGG - Intergenic
1054418536 9:64902914-64902936 ATATTTCAGACTATCACATGGGG + Intergenic
1054515852 9:66037205-66037227 ATATCTCAGACTATCACTTGGGG + Intergenic
1054691995 9:68325861-68325883 ATATTTCAGACTATCACATGGGG + Intergenic
1054843122 9:69763735-69763757 ATATTTCAGACTATCACATGGGG + Intergenic
1055157960 9:73087805-73087827 ATATTTCAGACTATCACATGGGG + Intergenic
1055158199 9:73091026-73091048 ATTTTTCATAGTAGCCCATGTGG + Intergenic
1055540897 9:77304052-77304074 ATATTTCAGACTATCATATGGGG + Intronic
1055801144 9:80037950-80037972 AAATCTCAGACTCCCCCATGTGG - Intergenic
1056567328 9:87785561-87785583 ATATCTCAGGCTATCACATGGGG + Intergenic
1057685693 9:97232490-97232512 ATATCTCAGGCTATCACATGGGG - Intergenic
1058806243 9:108594952-108594974 ATATTTCAGACTATCACATGGGG - Intergenic
1059042144 9:110826595-110826617 ATGTTTCACAGTATCACATGGGG - Intergenic
1059143412 9:111875647-111875669 ATATTTCAGACTATCACATGGGG - Intergenic
1059193687 9:112350751-112350773 ATATCTCAGAGTCTCTCATGAGG + Intergenic
1059309707 9:113379689-113379711 ATATCTCAGGCTGTCACATGGGG + Intergenic
1060167351 9:121429453-121429475 ATATTTCAGACTATCACATGGGG - Intergenic
1060831043 9:126716876-126716898 ATATTTCAGACTATCACATGGGG - Intergenic
1061154653 9:128850594-128850616 ATATTTCAGACTATCACATGGGG - Intronic
1061155272 9:128856810-128856832 ATATTTCAGATTATCACATGGGG - Intronic
1061554240 9:131357058-131357080 ATATTTCAGACTATCACATGGGG - Intergenic
1061955266 9:133958120-133958142 ATATTTCAGACTATCACATGGGG - Intronic
1061979521 9:134093034-134093056 ATATTTCAGACTATCACATGGGG + Intergenic
1062098531 9:134715522-134715544 ATATTTCAGACTATCACACGGGG + Intronic
1203456765 Un_GL000219v1:175558-175580 ATATTTCAGACTATCCCATGGGG - Intergenic
1203363853 Un_KI270442v1:240569-240591 ATATTTCAGACTATCACATGGGG + Intergenic
1203369557 Un_KI270442v1:290032-290054 GTATTTCAGAATATCACATGGGG - Intergenic
1203377796 Un_KI270442v1:390986-391008 ATATTTCAGACTATCACATGGGG + Intergenic
1185444749 X:251757-251779 ATATTTCAGACTATCACATGGGG + Intergenic
1185575794 X:1171288-1171310 ATATTTCAGACTATCACATGGGG - Intergenic
1186098763 X:6132286-6132308 ATATTTTGGATTATCCCATCTGG - Intronic
1187030126 X:15478339-15478361 ATTTTGCAGACAATCCCAAGAGG - Intronic
1187198873 X:17115608-17115630 ATATTTCAGACTATCACATGGGG + Intronic
1187385784 X:18847087-18847109 ATATTTCAGACTATCACATGGGG + Intergenic
1187858590 X:23660462-23660484 ACATTTCAGACTATCACATGGGG + Intergenic
1188211561 X:27431162-27431184 ATAATTCTGACTAGCCTATGAGG + Intergenic
1188281592 X:28276987-28277009 AAGTCTCAGACAATCCCATGGGG + Intergenic
1189586621 X:42468472-42468494 ATAATTCAGACTATTTCAAGAGG - Intergenic
1191033341 X:55998368-55998390 ATATTTCAGACTATTACATGGGG + Intergenic
1191161631 X:57335753-57335775 ATATTTCAGACTATCACATGGGG + Intronic
1192425961 X:71076845-71076867 ATAGTTCAGAATATGCCTTGGGG - Intergenic
1192626426 X:72733532-72733554 ATATTTCAGACTATCACATGGGG - Intergenic
1192831500 X:74755279-74755301 ATATGTTAGACTATGCCATGAGG + Intronic
1192993035 X:76482777-76482799 AGATTTCAAACTATACTATGAGG - Intergenic
1194141295 X:90213679-90213701 ATATCTCAGACTATCACATGGGG - Intergenic
1194200753 X:90950963-90950985 GTATTTCAGACTATCACATGGGG - Intergenic
1194219209 X:91170644-91170666 ATATTTCAGACTATCACATGGGG - Intergenic
1195424024 X:104707338-104707360 ATATTAAAAACTATCCCATCAGG - Intronic
1197383840 X:125779858-125779880 ATATTTCAGACTATCACATGGGG - Intergenic
1197509532 X:127354299-127354321 ATATTTCAGACTATCACATGGGG - Intergenic
1197565300 X:128076893-128076915 GTATTTCAGACTATACTATATGG + Intergenic
1198268187 X:135030693-135030715 ATATCTCAGGCTATCATATGGGG - Intergenic
1198297701 X:135303335-135303357 ATATTTCAGACTATCACATGGGG + Intronic
1198308562 X:135406446-135406468 GTATTTCAGACTATCACATGGGG - Intergenic
1198602269 X:138296380-138296402 ATATTTCAGACTATCACATGGGG + Intergenic
1198605614 X:138333834-138333856 ATATTTCAGACTATCACATGGGG - Intergenic
1198696332 X:139342518-139342540 AAATTTCAGACTATCACATGGGG + Intergenic
1199256228 X:145721439-145721461 ATATTTCAGACTATCACATGGGG + Intergenic
1199896179 X:152129966-152129988 ATATTTCAGACTATCACATGGGG - Intergenic
1199964080 X:152804434-152804456 AGACTTCATCCTATCCCATGGGG - Intergenic
1200245421 X:154521534-154521556 ATATTTCAGACTATCACATGGGG - Intergenic
1200257122 X:154589009-154589031 ATATCTCAGGCTATCACATGGGG - Intergenic
1200259957 X:154609046-154609068 ATATCTCAGGCTATCACATGGGG + Intergenic
1200260647 X:154615393-154615415 ATATCTCAGGCTATCACATGGGG + Intergenic
1200294966 X:154910681-154910703 ATATCTCAGGCTATCACATGGGG - Intronic
1200487049 Y:3782781-3782803 ATATCTCAGACTATCACATGGGG - Intergenic
1200555727 Y:4634401-4634423 ATATTTCAGACTATCACATGGGG - Intergenic
1200731636 Y:6749235-6749257 ATATTTCAGACTATCACATGGGG - Intergenic
1200752465 Y:6959027-6959049 ATATTTCAGACTATCACATGGGG + Intronic
1200777201 Y:7180223-7180245 ATATTTCAGACTATCACATGGGG - Intergenic
1200833622 Y:7711686-7711708 ATATCTCAGGCTGTCACATGGGG - Intergenic
1200869591 Y:8083105-8083127 ATATGTCAGAATGTCCCCTGTGG + Intergenic
1200894755 Y:8363312-8363334 ATATTTCAGAATATCCTCTGGGG + Intergenic
1201068735 Y:10124993-10125015 ATATTTCAGACTATCACATGGGG + Intergenic
1201074464 Y:10176268-10176290 ATATTTCAGACTATCACATGGGG - Intergenic
1201356718 Y:13104420-13104442 ATATTTCAGACTATCACATGGGG + Intergenic
1201452693 Y:14133554-14133576 ATATTTCAGACTATCACATGGGG - Intergenic
1201962755 Y:19700077-19700099 ATATTTCAGACTATCACATGGGG + Intergenic
1202069572 Y:20976672-20976694 ATATCTAAGGCTATCACATGGGG + Intergenic
1202253165 Y:22893637-22893659 ATATTTCAGACTATCACATGGGG + Intergenic
1202260145 Y:22961810-22961832 ATATTTCACAATGTCCCCTGGGG - Intergenic
1202342114 Y:23880720-23880742 ATATCTCAGGCTATCACATGGGG + Intergenic
1202406155 Y:24527386-24527408 ATATTTCAGACTATCACATGGGG + Intergenic
1202413132 Y:24595551-24595573 ATATTTCACAATGTCCCCTGGGG - Intergenic
1202457650 Y:25074517-25074539 ATATTTCACAATGTCCCCTGGGG + Intergenic
1202464627 Y:25142695-25142717 ATATTTCAGACTATCACATGGGG - Intergenic
1202528655 Y:25789365-25789387 ATATCTCAGGCTATCACATGGGG - Intergenic