ID: 1006250609

View in Genome Browser
Species Human (GRCh38)
Location 6:32780292-32780314
Sequence TCATGTGACAAGAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006250603_1006250609 9 Left 1006250603 6:32780260-32780282 CCCTCTGCTGAGTTCTGATGAGG No data
Right 1006250609 6:32780292-32780314 TCATGTGACAAGAGGGCAAAGGG No data
1006250605_1006250609 8 Left 1006250605 6:32780261-32780283 CCTCTGCTGAGTTCTGATGAGGT No data
Right 1006250609 6:32780292-32780314 TCATGTGACAAGAGGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006250609 Original CRISPR TCATGTGACAAGAGGGCAAA GGG Intergenic
No off target data available for this crispr