ID: 1006250700

View in Genome Browser
Species Human (GRCh38)
Location 6:32781238-32781260
Sequence ACAAATATCCAAACTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006250700_1006250706 25 Left 1006250700 6:32781238-32781260 CCATCCACAGTTTGGATATTTGT No data
Right 1006250706 6:32781286-32781308 TGATCCCCAATGTTGGAGGCAGG 0: 20
1: 246
2: 1447
3: 3661
4: 4706
1006250700_1006250705 21 Left 1006250700 6:32781238-32781260 CCATCCACAGTTTGGATATTTGT No data
Right 1006250705 6:32781282-32781304 AATTTGATCCCCAATGTTGGAGG 0: 82
1: 454
2: 1191
3: 2564
4: 4065
1006250700_1006250704 18 Left 1006250700 6:32781238-32781260 CCATCCACAGTTTGGATATTTGT No data
Right 1006250704 6:32781279-32781301 TGAAATTTGATCCCCAATGTTGG 0: 92
1: 488
2: 1295
3: 2467
4: 3571
1006250700_1006250707 26 Left 1006250700 6:32781238-32781260 CCATCCACAGTTTGGATATTTGT No data
Right 1006250707 6:32781287-32781309 GATCCCCAATGTTGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006250700 Original CRISPR ACAAATATCCAAACTGTGGA TGG (reversed) Intergenic
No off target data available for this crispr