ID: 1006252661

View in Genome Browser
Species Human (GRCh38)
Location 6:32801980-32802002
Sequence TTGAATAAGCATGGCGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006252661_1006252666 10 Left 1006252661 6:32801980-32802002 CCACTCTCGCCATGCTTATTCAA No data
Right 1006252666 6:32802013-32802035 GAAGTTCTAGATAATGTAATGGG No data
1006252661_1006252665 9 Left 1006252661 6:32801980-32802002 CCACTCTCGCCATGCTTATTCAA No data
Right 1006252665 6:32802012-32802034 GGAAGTTCTAGATAATGTAATGG No data
1006252661_1006252667 26 Left 1006252661 6:32801980-32802002 CCACTCTCGCCATGCTTATTCAA No data
Right 1006252667 6:32802029-32802051 TAATGGGCGAGAAAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006252661 Original CRISPR TTGAATAAGCATGGCGAGAG TGG (reversed) Intergenic
No off target data available for this crispr