ID: 1006256405

View in Genome Browser
Species Human (GRCh38)
Location 6:32835874-32835896
Sequence AGGGGAAAGCATGCCAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006256398_1006256405 3 Left 1006256398 6:32835848-32835870 CCAGGAGTGCAGAGAAGCGCAAA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1006256405 6:32835874-32835896 AGGGGAAAGCATGCCAGGAGGGG 0: 1
1: 0
2: 4
3: 63
4: 491
1006256396_1006256405 28 Left 1006256396 6:32835823-32835845 CCAGCGGGTGAAACAGAGGAGCA 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1006256405 6:32835874-32835896 AGGGGAAAGCATGCCAGGAGGGG 0: 1
1: 0
2: 4
3: 63
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006256405 Original CRISPR AGGGGAAAGCATGCCAGGAG GGG Intronic
900095747 1:939468-939490 AGGGGAGATCATGCCAGGGTGGG - Intronic
900184874 1:1328332-1328354 AGGGGCAAACAAGGCAGGAGAGG - Exonic
902037229 1:13466778-13466800 AGGGGAAAGCATCCCAGGCAAGG + Intergenic
902393402 1:16119144-16119166 TGGGGAGAGGGTGCCAGGAGTGG + Intergenic
902420497 1:16275716-16275738 AGGACAAAGGAGGCCAGGAGTGG + Intronic
902686213 1:18079315-18079337 AGGGGAGGGCAGGGCAGGAGGGG + Intergenic
902943551 1:19817242-19817264 AGGGGAAAGAATGCTAGGCATGG - Intergenic
904288906 1:29471229-29471251 AGGGGAAGACAGGCAAGGAGGGG + Intergenic
904319224 1:29685689-29685711 AGGGGAAAGGAAGGAAGGAGGGG - Intergenic
905375309 1:37516207-37516229 AGGGGAATGCAGGCCGGGCGCGG + Intergenic
906509175 1:46401105-46401127 AGGGGGAAGCAGGCCAGGGGAGG + Intronic
906636049 1:47411481-47411503 TGGGGAATGCATCCCAGAAGGGG - Intergenic
906711488 1:47933410-47933432 AAGGTAAAGAATGACAGGAGAGG - Intronic
907785653 1:57610022-57610044 AGGGAGCAGCATGCCAGCAGAGG - Intronic
907834232 1:58093865-58093887 AGGGGCAAGCAGGCCAGGAGAGG - Intronic
907889791 1:58625827-58625849 AAGGGAAAGAATCCCAGGAGAGG - Intergenic
907940694 1:59084365-59084387 AGGGGAGAGCCTGCCAGGAGGGG - Intergenic
908195395 1:61742436-61742458 AGGGGAGGGCCTGCCAGGTGAGG + Intergenic
908451569 1:64261197-64261219 AGGGGAAAGCATGACATTTGGGG + Intronic
908657698 1:66405386-66405408 AGGGGAAGCAATGACAGGAGGGG - Intergenic
908778796 1:67669025-67669047 AGGGGACAGCATGGCAGCAGTGG + Intergenic
908994028 1:70129956-70129978 AGAGGAAGGCATTCCAGTAGAGG - Intronic
909213187 1:72850461-72850483 TGGGAAAACCATTCCAGGAGTGG - Intergenic
910989126 1:93036843-93036865 AGGAGACAGCAGCCCAGGAGAGG + Intergenic
911089905 1:94010126-94010148 TGGGGAAAGCTTGCTAGGAAGGG + Intronic
912467683 1:109885291-109885313 AAGGGAGAGCATTCCAGGCGGGG + Intergenic
912698833 1:111861232-111861254 AAGGGAAAGTTTCCCAGGAGAGG + Intronic
913157660 1:116115831-116115853 AGGGGAAAGCAGCCCAAGATGGG + Intronic
913411513 1:118557362-118557384 AGGAGAAAGTATGCCAGGCAAGG - Intergenic
914703874 1:150155943-150155965 AGAGGGAGGCACGCCAGGAGAGG - Intronic
914760245 1:150592852-150592874 AGGGTAAACCAGGCCAGGTGCGG - Intergenic
915000966 1:152590582-152590604 AGAGGAAAGGATGCAAGGAGTGG + Intronic
915307243 1:154987644-154987666 AGAAGAAAGCAGGCCAGGCGTGG + Intronic
916171003 1:162001682-162001704 TGTGGAAAGCAGGCTAGGAGAGG - Intronic
916572185 1:166037660-166037682 AGGGGAAAGGATGAGAGAAGAGG - Intergenic
917109288 1:171528654-171528676 AAAAGAAAGCATGCCTGGAGAGG - Intronic
918212784 1:182366461-182366483 GGGAGAAAGCATGCCATAAGTGG + Intergenic
919734778 1:200939899-200939921 ACGGAAAAGCAGGCCAGGCGTGG - Intergenic
919958307 1:202439870-202439892 TGGGGCAAGCAGGGCAGGAGGGG - Intronic
920192856 1:204205240-204205262 AGGGGAAAGCATTACAGCACTGG - Intronic
920284282 1:204868551-204868573 AGGGAACAGGAAGCCAGGAGGGG - Intronic
920456298 1:206104172-206104194 GGGGGAAAAAATGCCAGGCGCGG + Intergenic
921586268 1:216949428-216949450 AGTGGATAGTGTGCCAGGAGAGG - Intronic
921786976 1:219243021-219243043 AGGGGAAAGAATGGCTGGAAGGG + Intergenic
922228831 1:223668166-223668188 AATGGAAAGAAAGCCAGGAGGGG - Intergenic
922591798 1:226783018-226783040 AGAGGAAAGAATGCCGGGTGGGG + Intergenic
923688724 1:236172980-236173002 AGGGAAAAGCATGCCAGGCATGG - Intronic
1062823427 10:551330-551352 AGGGGCAGGCATGCCAGGGTAGG + Intronic
1064466191 10:15584644-15584666 AGGGGGAAGAATGTCAGCAGAGG - Intronic
1065171584 10:23035671-23035693 AGGGGGAAGGATGGGAGGAGAGG - Intronic
1065683761 10:28263673-28263695 AGAGGAAAGGATGGCAGGGGAGG + Intronic
1065812070 10:29451445-29451467 AGGGGCCTGCATTCCAGGAGAGG - Intergenic
1065875654 10:29995265-29995287 AGGGGAAAACAGGCCAGAGGAGG + Intergenic
1066220845 10:33335445-33335467 AGGGGAAAGCCGGGCTGGAGTGG + Intronic
1066577178 10:36838976-36838998 AGTGGAAAGGATGACAGAAGAGG + Intergenic
1066746942 10:38610354-38610376 AGGGGGAAGGATGCCGGGTGTGG + Intergenic
1067216876 10:44310832-44310854 AGAGGCAGGCAGGCCAGGAGCGG + Intergenic
1067357732 10:45546489-45546511 AGAATAAAGCAGGCCAGGAGTGG + Intronic
1067432424 10:46252999-46253021 AGGGGAAGGGAAGGCAGGAGAGG + Intergenic
1068583654 10:58771977-58771999 AGAAGAAAGCATGCCAGGAGTGG + Intronic
1068998923 10:63241933-63241955 AGAGGAAAGCAGGTAAGGAGAGG + Intronic
1069135154 10:64754626-64754648 AGGTGAAAGCTTGGGAGGAGAGG + Intergenic
1069615616 10:69804286-69804308 AGGGGAAAGCATGGAGAGAGGGG - Intronic
1069677447 10:70258755-70258777 AGGGGAAAGCTTGCCCAGTGGGG + Intronic
1069956661 10:72056166-72056188 TGCGGGAGGCATGCCAGGAGTGG + Intergenic
1070541265 10:77417076-77417098 TGGGGAGAGCATCCCAGGAGTGG - Intronic
1070794931 10:79210920-79210942 AGAGGAATCCATGGCAGGAGAGG + Intronic
1071329341 10:84544506-84544528 CGGGGAAAGCATCACAGAAGGGG - Intergenic
1071480159 10:86059063-86059085 GGGGAAAAGCATTCCAGCAGAGG + Intronic
1071530690 10:86388690-86388712 AGGGGAAAACATAGCAGGAAAGG - Intergenic
1071826174 10:89328373-89328395 AGAGGAAGGCTTGGCAGGAGCGG + Intronic
1072549927 10:96469588-96469610 TGGGGGAAGCCTGCCATGAGAGG + Intronic
1072622812 10:97091248-97091270 AGGGGAGAAGATGGCAGGAGTGG - Intronic
1072747135 10:97948641-97948663 AGAGGAAAGGAAGCCAGGATGGG + Intronic
1072835939 10:98712021-98712043 AGGGGAGAGCATTCTTGGAGGGG + Intronic
1073053407 10:100683970-100683992 AGGGGGGAGGATCCCAGGAGAGG + Intergenic
1073062279 10:100739904-100739926 AGGGGACAGCTGGCCAGGTGGGG + Intronic
1073461091 10:103666324-103666346 AAGGGAAAGCATTCCAGCAGGGG - Intronic
1073590879 10:104756613-104756635 TGGAGAAAGCATCCCAAGAGTGG + Intronic
1074055470 10:109919741-109919763 AAGGGAAATCACGCCAGGCGCGG + Intronic
1074180821 10:111061338-111061360 TGGGGCATGCCTGCCAGGAGTGG + Intergenic
1074287384 10:112110827-112110849 AGGTGAGAGCAGGGCAGGAGAGG - Intergenic
1074407231 10:113189978-113190000 TGGGAAGAGCATGCCAGGAGAGG - Intergenic
1074862126 10:117518412-117518434 CTGGGAAAGCATGCAAGGAGTGG - Intergenic
1075286592 10:121192409-121192431 AGGGGAAAACATGCCTGTAAGGG + Intergenic
1075571750 10:123551424-123551446 AGGGGAGAGCATGCCAGGCAGGG + Intergenic
1076495210 10:130892714-130892736 AGGGGTGAGCAGCCCAGGAGAGG + Intergenic
1076939470 10:133591896-133591918 AAGGGAAACCATCCCTGGAGTGG + Intergenic
1077020117 11:413659-413681 AGGGGAGAGGGTGCAAGGAGAGG - Intronic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077229349 11:1451595-1451617 AGGGGAAGGCCAGCCAGGGGAGG + Intronic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077535999 11:3124522-3124544 AGGGAAAAGCATTCCAGGCTGGG - Intronic
1077964157 11:7109623-7109645 AGTGGAAAGTAGGCCAGGTGTGG - Intergenic
1078189717 11:9083169-9083191 AGGGAAATGCATGGAAGGAGGGG + Intronic
1078920494 11:15826162-15826184 AGGAGAGAGCAGGCCTGGAGAGG - Intergenic
1079363776 11:19791730-19791752 AGAAGAAAGCCTGGCAGGAGAGG + Intronic
1079936532 11:26623526-26623548 AGGGGAAAAGATGGCAGAAGAGG + Intronic
1080723541 11:34872469-34872491 AGAGGATGGCATGCCTGGAGAGG + Intronic
1081517088 11:43843611-43843633 TGGGGAAAGGATGCCAACAGAGG - Intronic
1081779686 11:45701490-45701512 GGGGGAAAGCATTCCATGGGGGG + Intergenic
1081824393 11:46034223-46034245 AGGGAAAAGTATGCAAGGGGGGG - Intronic
1082192713 11:49266798-49266820 AGGCAAGAGCATGGCAGGAGAGG + Intergenic
1082881207 11:58040177-58040199 AAGGGAACTGATGCCAGGAGAGG - Intronic
1083254530 11:61487938-61487960 TGGGGAAAGCATTATAGGAGTGG + Intronic
1083674697 11:64318897-64318919 AGGGGAAATCAGGCCGGGAGTGG - Intronic
1083771671 11:64871070-64871092 AGGGGAAAAAAAGTCAGGAGGGG + Intronic
1083774988 11:64890233-64890255 AGCTGAGATCATGCCAGGAGGGG + Intergenic
1084083893 11:66845952-66845974 AGGGCATAGCCTGCCAGCAGGGG - Exonic
1084374054 11:68764038-68764060 AGAGGACAGCACGGCAGGAGGGG + Intronic
1084580901 11:70022658-70022680 GGGGGAAAGCAAGCTAGGTGAGG - Intergenic
1084724819 11:70934578-70934600 ATTGCAAAGAATGCCAGGAGAGG - Intronic
1085498831 11:76998304-76998326 ATGAGAAAGAATGCCAGGGGAGG + Intronic
1086248082 11:84779079-84779101 AGGGGCAAGGAAGCCAGTAGTGG - Intronic
1087194515 11:95292263-95292285 AAGGGAAAACATGCCAGGACAGG - Intergenic
1087212061 11:95454626-95454648 AGGGGAAAGCAAGCCTAGAGCGG - Intergenic
1088719400 11:112578620-112578642 AGAGGAAAGCATTACAGGTGAGG - Intergenic
1089270657 11:117299600-117299622 AATGGAAACCAGGCCAGGAGTGG - Intronic
1089690497 11:120184052-120184074 AGTGGAAAACAGGCCGGGAGAGG + Intronic
1090398545 11:126434467-126434489 AGGGGCATGTCTGCCAGGAGGGG + Intronic
1090803416 11:130188437-130188459 TGGGGAATGAATGCCAGGAGGGG - Intronic
1090904842 11:131066025-131066047 AGGGGAAGGCAAGCAAGCAGAGG - Intergenic
1091676490 12:2494628-2494650 AAAGGAAATCATGCCAAGAGAGG + Intronic
1091974925 12:4816861-4816883 AAGGCAAAGCAGGCCAAGAGGGG - Intronic
1093005785 12:14049312-14049334 AGGAGAGAGCATGAAAGGAGCGG - Intergenic
1095315567 12:40756642-40756664 AGGGGAAAGCATTCTAGGCTCGG - Intronic
1095352111 12:41225976-41225998 ACCGGAAAGAATGCCTGGAGAGG - Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096455332 12:51780332-51780354 AGGGGAGAGGCTGACAGGAGAGG - Intronic
1096634575 12:52950018-52950040 TAGGGAAAAAATGCCAGGAGAGG + Intronic
1097661305 12:62434656-62434678 AGGGTAAAGCATGCGTGGGGTGG - Intergenic
1097957330 12:65499518-65499540 AGGGGAAAGGATCCCAGGGAGGG + Intergenic
1099223963 12:79946545-79946567 AATGGAAAGCTGGCCAGGAGCGG - Intergenic
1099266929 12:80459394-80459416 AGTGTCAAGCATGCCAGAAGTGG + Exonic
1099631708 12:85156812-85156834 AGTGGGGAGCATGGCAGGAGGGG + Intronic
1100208799 12:92379985-92380007 AAGGAGAAGGATGCCAGGAGTGG + Intergenic
1100256269 12:92886470-92886492 AGGGGAAAGGAGGGGAGGAGAGG + Intronic
1101385051 12:104249643-104249665 AAGTGAAAGCTTGCCAGGCGCGG + Intronic
1102198789 12:111043333-111043355 AGGGAAAAGCATCTCAGAAGAGG + Intronic
1102816936 12:115873856-115873878 AGGGAAAAGCATTCCAACAGAGG + Intergenic
1103950455 12:124548216-124548238 AGGGAACAGCATTCCAGGTGGGG + Intronic
1104090517 12:125512970-125512992 AGTGGGAAGGATGTCAGGAGGGG + Intronic
1104283135 12:127396632-127396654 AGTGGGAAGGATGTCAGGAGGGG - Intergenic
1104977362 12:132558130-132558152 TGGGCAAAGCCAGCCAGGAGGGG - Intronic
1105968283 13:25404502-25404524 TGAGGAAAGCATTCAAGGAGAGG + Intronic
1106124021 13:26885420-26885442 AGAGCAAAGCATGTCAGGACAGG + Intergenic
1106144853 13:27041295-27041317 AGGGGGCAGCCTGCCTGGAGGGG - Intergenic
1106504005 13:30355684-30355706 GGGAGAAAGGAGGCCAGGAGAGG - Intergenic
1107043588 13:35973390-35973412 AGGGGAGAGCTTCCCAGAAGAGG - Intronic
1107310728 13:39074154-39074176 AGGTGAATACATGCCAGAAGAGG + Intergenic
1107418020 13:40219429-40219451 AGGGTATTGCATTCCAGGAGTGG + Intergenic
1107860333 13:44654681-44654703 AGAGGAATGCAGGCCAGGCGCGG + Intergenic
1108287437 13:48922561-48922583 AGGGGTGGGCAAGCCAGGAGGGG - Intergenic
1108304065 13:49113241-49113263 AGGGGGAAGCAAGCAAGGAGAGG - Intronic
1108461026 13:50667403-50667425 AATGGAAAGCATGCCAGAATAGG + Intronic
1111779933 13:92709586-92709608 AGAGAAAAGAATGACAGGAGGGG + Intronic
1112323443 13:98427708-98427730 AGGAGAAAGAACGCCAGGAGCGG - Intronic
1112478458 13:99752986-99753008 GGAGGACAGCATCCCAGGAGGGG + Intronic
1114266503 14:21075402-21075424 AGGGGACAACATTCCAGAAGAGG + Exonic
1114271897 14:21105396-21105418 AGGGCAATGCCTGCAAGGAGAGG + Intergenic
1115330302 14:32189666-32189688 TGGAGAAAGGAAGCCAGGAGAGG + Intergenic
1116075059 14:40100825-40100847 AGGGGAAGGGAGGGCAGGAGAGG - Intergenic
1116075067 14:40100845-40100867 AGGGGAAGGGAGGGCAGGAGAGG - Intergenic
1116574841 14:46560011-46560033 AGGTGAAAGCTTGCTAGGTGTGG + Intergenic
1118693258 14:68360276-68360298 GGGAGAAGGCATTCCAGGAGAGG - Intronic
1119428213 14:74549785-74549807 AGGGGAAACCCTGGCAGGAGAGG + Intronic
1120786222 14:88539536-88539558 AAGGGAAAGAAGGCCAGGCGTGG - Intronic
1121047621 14:90799586-90799608 AGCGAAGAGCATTCCAGGAGAGG + Intronic
1121098361 14:91233485-91233507 AGGGGGAAGGAAGGCAGGAGGGG - Exonic
1121100437 14:91246408-91246430 AGGGGACACCATGCCATTAGTGG - Intronic
1122676232 14:103416478-103416500 GGAGGAAAGCAAGCCAGGCGTGG + Intronic
1122885643 14:104709190-104709212 TGGGGAAACCCTGCCAGGTGGGG + Intronic
1122897518 14:104767670-104767692 AGGAGGCAGCATCCCAGGAGTGG - Intronic
1123722448 15:23071510-23071532 GGGGAAAAGCATTCCAAGAGAGG + Intergenic
1124624277 15:31299177-31299199 AGGGGAATGCAGGGAAGGAGGGG + Intergenic
1126896121 15:53258605-53258627 AGGGTACAACATTCCAGGAGAGG + Intergenic
1128738017 15:70064474-70064496 TGGGGAAAGAAGGCCAGGACAGG + Intronic
1129025685 15:72571508-72571530 AGGGGAAAACATACCCAGAGAGG - Intronic
1129063489 15:72880804-72880826 AGGGGAAAGCAGGGGAGGGGAGG + Intergenic
1129195030 15:73959154-73959176 AGGGGAAAGCATGCCAAACACGG - Intergenic
1129543929 15:76374934-76374956 AGCAGAAAGCAAGCCAGGTGTGG + Intronic
1129672935 15:77617116-77617138 ATGAGAAACCGTGCCAGGAGCGG + Intronic
1130059138 15:80557220-80557242 AGTGGGAAGAAAGCCAGGAGTGG - Intronic
1130367425 15:83253086-83253108 AGGAGAAAGAATGAGAGGAGAGG + Intergenic
1130430106 15:83839258-83839280 TGGGGAAAGCATTGCGGGAGGGG + Intronic
1131152419 15:90055328-90055350 AGGGGAAAGCATGTGTGAAGAGG + Intronic
1132145896 15:99429751-99429773 AGGGGGAAGCAGGGGAGGAGGGG + Intergenic
1132755188 16:1481035-1481057 AGGGCAAAGCCAGCCAGGCGTGG - Intergenic
1132872016 16:2119554-2119576 TGGGGAAACCAAGCCAGGAGAGG + Intronic
1132929145 16:2449801-2449823 GGAGGAAAGCAGGCCAGGGGTGG - Intronic
1133233330 16:4376602-4376624 AGGGGATAGCATGGCTGGGGTGG - Intronic
1133727343 16:8549911-8549933 AGGGGTAAGGAAGCCAGTAGTGG + Intergenic
1134192033 16:12129219-12129241 CAAGGAAAGGATGCCAGGAGAGG - Intronic
1134217955 16:12330923-12330945 GGGGGCTAGCATGCCTGGAGTGG - Intronic
1134520509 16:14917342-14917364 TGGGGAAACCAAGCCGGGAGAGG - Intronic
1134551065 16:15138632-15138654 TGGGGAAACCAAGCCGGGAGAGG + Intronic
1134708181 16:16315993-16316015 TGGGGAAACCAAGCCGGGAGAGG - Intergenic
1134715397 16:16356026-16356048 TGGGGAAACCAAGCCAGGAGAGG - Intergenic
1134951421 16:18352652-18352674 TGGGGAAACCAAGCCGGGAGAGG + Intergenic
1134959360 16:18396133-18396155 TGGGGAAACCAAGCCAGGAGAGG + Intergenic
1135047321 16:19166584-19166606 ATGGCAAGGCATGCCAGGTGGGG - Intronic
1135078147 16:19411597-19411619 AGGGAAAAGGATCCCAGAAGTGG - Intronic
1136736121 16:32469291-32469313 AGGGGGAAGGATGCCGGGTGTGG - Intergenic
1137938634 16:52658970-52658992 GGGGGCATGCCTGCCAGGAGGGG - Intergenic
1138331880 16:56221875-56221897 AGGGGAAACCAAGGCAGGAGGGG + Intronic
1138448414 16:57078806-57078828 AAGGGAATGAAGGCCAGGAGAGG + Intronic
1138452721 16:57103412-57103434 AGGGAAAAACAGGCCAGGTGTGG - Intronic
1138810221 16:60140322-60140344 TGTGGAAAGCATCCCAGCAGTGG - Intergenic
1139462712 16:67135434-67135456 AGGGGAGAGCTGGCCAGGTGCGG - Intronic
1141244867 16:82296486-82296508 AGGGGAAAGTGTGGGAGGAGGGG - Intergenic
1141821810 16:86451281-86451303 TGGGGAAAGCGAGGCAGGAGAGG - Intergenic
1141882198 16:86867509-86867531 GGGGAAGAGCATGCCAGGAGAGG - Intergenic
1203016951 16_KI270728v1_random:360283-360305 AGGGGGAAGGATGCCGGGTGTGG + Intergenic
1203035286 16_KI270728v1_random:633441-633463 AGGGGGAAGGATGCCGGGTGTGG + Intergenic
1143496821 17:7317249-7317271 GGGGGAAAGCAGCACAGGAGGGG + Exonic
1143627468 17:8118766-8118788 AGCGGAAAGAATGCCACGCGGGG - Exonic
1143682865 17:8490633-8490655 AGTGGCCAGCATGCCACGAGTGG - Intronic
1143859424 17:9877597-9877619 AGGGGAAACTATGCCGGGGGCGG + Intronic
1143891338 17:10104799-10104821 AGGGAACAGCATGGCAGCAGTGG - Intronic
1143994700 17:10996562-10996584 GGGGGAATGCATCCCAAGAGAGG + Intergenic
1144531457 17:16043117-16043139 AGAGGAAAGCATTTCAGGAAAGG + Intronic
1144793261 17:17873739-17873761 AGGGAGAAGCAGGCCTGGAGAGG - Intronic
1146496700 17:33329077-33329099 AGGGGAAATAATGGCAGGAATGG + Intronic
1146726438 17:35160091-35160113 AGGGGAAAGACAGCCTGGAGGGG + Intronic
1146809872 17:35894535-35894557 AGGTGAAAGGAGGGCAGGAGAGG + Intergenic
1147219225 17:38918955-38918977 AGGGGGAAGCCTGCCAGAGGAGG - Exonic
1147236944 17:39065055-39065077 AAGGGAAAGAATGTCAGGAGTGG + Exonic
1147636156 17:41965795-41965817 AGGGGAAGGCCTGGGAGGAGAGG + Intergenic
1147670942 17:42176426-42176448 AGGAGATAGAAGGCCAGGAGAGG + Intronic
1148872836 17:50668756-50668778 AGGGGAAAGGAGGACAGGGGAGG - Intronic
1149515349 17:57276951-57276973 AGGGGAAAGGAGACCTGGAGAGG + Intronic
1149672215 17:58424628-58424650 AGGAGGAAGAAAGCCAGGAGTGG + Intronic
1149894978 17:60422299-60422321 AGCGCACAGCAGGCCAGGAGAGG - Intronic
1150764791 17:67994114-67994136 AGGGGAAGGGAAGCCAGGAGGGG + Intergenic
1150842119 17:68618421-68618443 AGAGGAAATCATGCAAGAAGGGG + Intergenic
1150937348 17:69651225-69651247 ATGGGAAAGCGAGCCAGGAAAGG - Intergenic
1151699034 17:75732794-75732816 ATGGGACAGCAGGCCAGGCGAGG + Intronic
1152368837 17:79872507-79872529 AGGGGAAAGCAGGGGAGGGGAGG - Intergenic
1152368851 17:79872536-79872558 AGGGGAAAGCAGGGGAGGGGAGG - Intergenic
1152872502 17:82764352-82764374 AGGAGAAAGCAGGCCGGGTGCGG + Intronic
1152928695 17:83099451-83099473 GGGGGAAGGAATGGCAGGAGGGG - Intergenic
1153632539 18:7085706-7085728 AGGGTAAAATAGGCCAGGAGCGG - Intronic
1153771682 18:8421933-8421955 AGGGGAAAGCAGCCCAGGCCGGG + Intergenic
1154205759 18:12335455-12335477 AGGGGAAAGAGTGGCAGGAAGGG - Intronic
1154473745 18:14730978-14731000 AGGGGAAAGGGTGGAAGGAGGGG - Intronic
1154966757 18:21366265-21366287 AGAGGAAAGCAGGGAAGGAGAGG - Intronic
1155088621 18:22483534-22483556 AGGGGAAAGAAAGTCAGGGGAGG + Intergenic
1155986298 18:32233943-32233965 AGGAGAAAGCAAAGCAGGAGGGG - Intronic
1157121247 18:44913275-44913297 AGGGGCAAGCATGTCAGGACTGG + Intronic
1158239499 18:55361013-55361035 AGGGGTTAGCAGGCCAGGTGTGG - Intronic
1161579396 19:5072368-5072390 AGGAGAGCACATGCCAGGAGAGG - Intronic
1162046125 19:8001584-8001606 AGGGGAAGGAATCACAGGAGAGG - Intronic
1164559196 19:29277058-29277080 AGGAGACACCATGCCATGAGGGG + Intergenic
1164796151 19:31032414-31032436 AGGGGAAGGAATGACTGGAGAGG - Intergenic
1164818027 19:31221626-31221648 AAGAGAAAGCATTACAGGAGAGG - Intergenic
1164857215 19:31534418-31534440 AGAGCAAAGCAGGCCAGGTGAGG - Intergenic
1165063143 19:33214638-33214660 TGAGGAAAGCATCCCAGGATGGG - Intronic
1165988927 19:39794804-39794826 AGGGGAAAGGGTGCCAAGAGAGG + Intergenic
1166662593 19:44657119-44657141 GGGGGAAAGCATTCCAGCAGAGG + Intronic
1167239290 19:48333755-48333777 AGAGGAAAGAATGACAGGAGGGG + Intronic
1167284559 19:48591744-48591766 AGGGTAAAGCGGGGCAGGAGGGG + Intronic
1168510079 19:56967054-56967076 AGGGACGAGCATTCCAGGAGAGG + Intergenic
925587228 2:5475832-5475854 TGGGGAAAGGATGGCAAGAGGGG - Intergenic
925865230 2:8221264-8221286 AGAGGAGAGCATGACTGGAGGGG + Intergenic
926841986 2:17090824-17090846 AGGGGAAAACATGCATGAAGAGG - Intergenic
927129377 2:20045032-20045054 AGATCAAAGGATGCCAGGAGCGG - Intronic
927314101 2:21662342-21662364 ATGGGAAATCATGGCAGGAGAGG - Intergenic
927485768 2:23487551-23487573 AGGTGATGGCATGGCAGGAGAGG - Intronic
927702310 2:25276301-25276323 GTGGGAAAACAGGCCAGGAGAGG - Intronic
927826877 2:26315486-26315508 AGGAGAAAGGAGGCAAGGAGAGG + Intronic
928089378 2:28364671-28364693 AGGGGAAAGGATGCTGGGAAGGG - Intergenic
928219990 2:29395572-29395594 AGGGGATAGAAAGGCAGGAGAGG - Intronic
929117319 2:38455547-38455569 ATAGGAAAGCAGGCCAGGTGTGG - Intergenic
929544103 2:42844517-42844539 AGGGCAAAGCAGGCCGGGTGCGG - Intergenic
929879477 2:45823597-45823619 AGCAGAAAGGAAGCCAGGAGTGG + Intronic
930824318 2:55681114-55681136 AGGGAAAAACAGGCCAGGCGTGG + Intronic
930879710 2:56257449-56257471 AGGGGCAAGCATACGACGAGGGG + Intronic
931629053 2:64283203-64283225 AGGGGAAGGCAGCCCAGGTGAGG + Intergenic
931757272 2:65385260-65385282 AGTGGAAAGCAGGCCGGGCGTGG - Intronic
932048887 2:68379670-68379692 AGGGGAAATCATAGCAGGAAAGG + Intronic
932089415 2:68791731-68791753 AGGGGACGGCAAGCCAGAAGAGG - Intronic
933087341 2:78072242-78072264 AAGGAAAAGCAGGCCAGGCGCGG + Intergenic
933252482 2:80044582-80044604 TGGGGAATGCACCCCAGGAGAGG - Intronic
933358379 2:81244393-81244415 TGGGGAAAGCATTACAGAAGAGG + Intergenic
934187286 2:89758403-89758425 AGGGGGAAGGATGCCGGGTGTGG - Intergenic
934309342 2:91849521-91849543 AGGGGGAAGGATGCCAGATGTGG + Intergenic
934662371 2:96150049-96150071 ATGGGAAACCATGGCAGAAGGGG - Intergenic
935007604 2:99095243-99095265 AGGGGAAAGGATGGGAGGTGGGG + Intronic
935106158 2:100045607-100045629 AGGGGAAAGGGAGGCAGGAGAGG - Intronic
936634179 2:114236423-114236445 ATGGAAGAGCATGTCAGGAGTGG + Intergenic
937237138 2:120437746-120437768 TGGGGAAATCATGCCAGGGAGGG + Intergenic
938071937 2:128313132-128313154 AGGTGGGAGCATACCAGGAGTGG + Intronic
938716942 2:134029604-134029626 GGGGGAAAGCATGCCAGAAATGG - Intergenic
938753998 2:134363022-134363044 TGGGGAAAGTATAACAGGAGAGG + Intronic
939202377 2:139053940-139053962 AGGTGAAAGTATGCCAAGAGTGG + Intergenic
940839451 2:158562100-158562122 ATGGGAAAAGAAGCCAGGAGAGG + Intronic
941021490 2:160411400-160411422 AGAGTAGAGCATGCCAGGAGTGG + Intronic
943734436 2:191339073-191339095 ATGAGAAAGCAGGCCTGGAGGGG + Intronic
945106101 2:206316307-206316329 AGTGAAAAGAATGCCAGGAAGGG - Intergenic
947505422 2:230704796-230704818 AAGGAAAAGCAGGCCAGGCGCGG - Intergenic
947944094 2:234084789-234084811 TGGGGAAACCATGCCAGGGTAGG + Intergenic
948126701 2:235569358-235569380 AGGGGACACCTGGCCAGGAGAGG - Intronic
948256364 2:236571341-236571363 AGGGGAAAGCTGCCCAGGATGGG + Intronic
948279722 2:236737852-236737874 AGGTCAGAGCATGGCAGGAGAGG - Intergenic
948367848 2:237470040-237470062 AGGGCAAGACATTCCAGGAGAGG + Intergenic
948825513 2:240571845-240571867 AGGGGACAGCAAGCAGGGAGTGG - Intronic
1168841609 20:913521-913543 AGGTGAATGGATGCCTGGAGAGG + Intronic
1169042483 20:2507974-2507996 AGGGAAAAGCAGTCCAGGAAAGG + Intronic
1169092560 20:2870656-2870678 AGGGGAAAGGAGGCCCCGAGAGG + Intronic
1169420749 20:5457276-5457298 AGGGGAAATCACACCAGGTGGGG - Intergenic
1170120062 20:12901762-12901784 AGGTGAAGGCAGGCCAGGTGTGG - Intergenic
1170331175 20:15212560-15212582 AGGGCAAGGCAAGCCAGGAGAGG + Intronic
1170973069 20:21134583-21134605 AGGGGAAAACATTCCAGGTGGGG - Intronic
1171472735 20:25385045-25385067 AGGAAAAAGCAGGCCAGGCGCGG + Intronic
1173260595 20:41431622-41431644 AGGGAAATGCATCCCAGAAGCGG - Intronic
1173728744 20:45314152-45314174 AAGGGAGGGCATGCCTGGAGGGG + Intronic
1173880651 20:46409423-46409445 GGGGAAGAGCATTCCAGGAGAGG - Intronic
1174092491 20:48060471-48060493 AGGGGAAAGCTTGTTAAGAGTGG - Intergenic
1174426134 20:50432751-50432773 AGGGAAAAGCATCTGAGGAGAGG - Intergenic
1175064940 20:56276732-56276754 AGGGGAAATGATGGCAGTAGCGG + Intergenic
1175111754 20:56653363-56653385 AGAGGAAAGAATGCTAGGCGTGG - Intergenic
1175163884 20:57029489-57029511 AGAGGAAAGCCTTCCAGGAGAGG + Intergenic
1175519678 20:59592195-59592217 AGGAAAGAGCATGCCAGGCGTGG - Intronic
1175540566 20:59745166-59745188 AGGGAAGAGCATGGCAGCAGTGG + Intronic
1176070242 20:63222461-63222483 GGAGGAAACCATGCCAGGAGGGG + Intergenic
1176138720 20:63536049-63536071 AGGGGACGGGAGGCCAGGAGAGG - Intronic
1177842136 21:26246425-26246447 AAGGGAAATCAGGCCAGGTGCGG + Intergenic
1179089697 21:38253163-38253185 TGGGGAAAGCAAGTCAGGAAGGG - Intronic
1179183702 21:39067010-39067032 AGGGCAGAGCATGCCAGGTCAGG + Intergenic
1179611284 21:42552927-42552949 AGGGCAAAGCCTGCCAGGCTAGG - Intronic
1179629162 21:42666085-42666107 AGGGGAAAGCAGCCCTGGGGTGG + Intronic
1180536432 22:16396646-16396668 AGGGGGAAGGATGCCAGGTGTGG + Intergenic
1181131024 22:20732426-20732448 AGGGCAAAGCATTCCAGGGAAGG - Intronic
1181242669 22:21486255-21486277 AGGGCAAAGCATTCCAGGGAAGG - Intergenic
1181337696 22:22153192-22153214 AGTGGAAAGGAGGCCAGGCGCGG + Intergenic
1181466735 22:23114447-23114469 AAGGGAAGGCATTGCAGGAGGGG - Intronic
1181720221 22:24768540-24768562 AAGGGAAAACAGGCCAGGCGTGG - Intronic
1181776844 22:25166083-25166105 AGGGCGAAGGATGCCAGGGGAGG + Intronic
1182022238 22:27090823-27090845 ATGGGAAGGCCTGCCAGGGGAGG + Intergenic
1182230980 22:28837320-28837342 AGGGGAGAACATGCCAGGCAGGG + Intergenic
1182236362 22:28880031-28880053 AGGGGAAGGCAGGCCAAGGGAGG + Intergenic
1182800744 22:33029938-33029960 AGGGAAGGGCATGCCAAGAGAGG - Intronic
1182963500 22:34499459-34499481 AGGGGCTAGCAGGGCAGGAGTGG + Intergenic
1183086180 22:35488684-35488706 CGGGGAAAGCTTCCCAGCAGAGG + Intergenic
1183643624 22:39108967-39108989 AGGGGGAAACTGGCCAGGAGTGG + Intergenic
1183736675 22:39648397-39648419 GGGGGCAAGAGTGCCAGGAGAGG - Intronic
1184167247 22:42737124-42737146 AAGGGAAAACTGGCCAGGAGTGG - Intergenic
1184370815 22:44080950-44080972 AGGGGAATGGATGCGGGGAGTGG + Intronic
1184434425 22:44461578-44461600 CTGGGAGAGTATGCCAGGAGTGG + Intergenic
1184652191 22:45924555-45924577 AGAGGACAGCATTCCAGGAGGGG + Intronic
1185170570 22:49291405-49291427 AGGCCAAAGCATGGCAGGGGAGG - Intergenic
949519029 3:4832871-4832893 AGGGGCAGAGATGCCAGGAGCGG + Intronic
951557926 3:23939450-23939472 ATGGGAAACCAGGCCAGGAACGG + Intronic
951661059 3:25067155-25067177 AGAGGGAAGCCTGCCTGGAGAGG + Intergenic
951918515 3:27827281-27827303 AGGGGTAATCAAGCCAAGAGTGG - Intergenic
952162575 3:30708907-30708929 AGGAGAAAGAAAGCCAGTAGTGG + Intergenic
955569203 3:60285994-60286016 AAAGAAAAGCATCCCAGGAGAGG + Intronic
956667141 3:71652592-71652614 ATGGGAAAGCAGGGAAGGAGAGG + Intergenic
956691426 3:71881267-71881289 ACAGGGCAGCATGCCAGGAGGGG - Intergenic
956989953 3:74751634-74751656 AGCGGAGAGCAGGCCTGGAGTGG + Intergenic
957268183 3:77994830-77994852 CAGGGAAGGCATGCCATGAGTGG + Intergenic
957861611 3:85959257-85959279 AGATGGAAGCATGCCAGGAGAGG - Intronic
958169940 3:89926786-89926808 AGGGCAAATCATGCAAAGAGGGG - Intergenic
958942409 3:100331032-100331054 AGGGCAAAGTATGGGAGGAGGGG - Intergenic
959301242 3:104604739-104604761 AGGGGGAAACATGTCAGGAAAGG + Intergenic
960078633 3:113516269-113516291 AGGGGAAAGCATTCCTGCAGAGG + Intergenic
961017579 3:123479614-123479636 AGGGGAAGGCATGCCAGGCAGGG - Intergenic
961674830 3:128558333-128558355 AGAGGATACCATGCCAGGAGGGG - Intergenic
961855420 3:129865439-129865461 AAGTGCAAGGATGCCAGGAGTGG - Intronic
962194945 3:133353492-133353514 AGGGAAATGAATGCCAGGAGGGG + Intronic
962438489 3:135389390-135389412 AGGGGAAAGTAAGACAGAAGAGG + Intergenic
962479603 3:135787097-135787119 AGAAGAGGGCATGCCAGGAGTGG - Intergenic
962525780 3:136236381-136236403 AGGGGAAAGAACGGCAGGAGGGG - Intergenic
962893521 3:139693556-139693578 AGAGAAAAGCATGCCTGGAAAGG - Intergenic
963345952 3:144096946-144096968 AGGGGAAAGCAAGCAAAGGGTGG - Intergenic
963488832 3:145972805-145972827 AGGAGCAAGGAAGCCAGGAGTGG - Intergenic
964194309 3:154045127-154045149 AGGGGAATGCCTGCCAGGTTGGG - Intergenic
965198384 3:165626754-165626776 ATGGGGAAGCATTCCAGGAAAGG + Intergenic
968085128 3:195870752-195870774 TGGCCACAGCATGCCAGGAGTGG + Intronic
968453786 4:687217-687239 AGGGGAAGGCCTCCTAGGAGAGG + Intronic
968876265 4:3269393-3269415 AGGAGGAAGGAGGCCAGGAGTGG + Intronic
969384273 4:6832790-6832812 GGAGGGAAGCATGCTAGGAGTGG + Intronic
969479634 4:7441088-7441110 AGGGGATAGCACCCCAAGAGGGG + Intronic
970378575 4:15482753-15482775 AAGGGAAAGACTGCCAGGAGAGG + Intronic
970485873 4:16524336-16524358 AGGGCAAAGCGTGTCAGGAAGGG + Intronic
971325326 4:25638730-25638752 AGGGGGAAGCAGGCCAGGTGCGG + Intergenic
972923662 4:43975653-43975675 ACTGGAAAACATGCCAGGAATGG - Intergenic
975060256 4:69988444-69988466 AGGGGCAAGGAAGCCAGCAGTGG + Intergenic
975258278 4:72265827-72265849 AGGAGAAACCATGACAGGAAGGG - Intergenic
975582259 4:75917754-75917776 AAGTGAAAGCAGGCCAGGTGCGG - Intronic
975653004 4:76613237-76613259 GTGGGAAACCATGCAAGGAGAGG - Intronic
975756988 4:77580774-77580796 AGGGGAGAGGAGGGCAGGAGAGG - Intronic
976925343 4:90488891-90488913 AGGGATAGGCATGTCAGGAGAGG + Intronic
977301086 4:95268491-95268513 AGGGCAAAGGATGCCAAAAGTGG - Intronic
977431812 4:96939566-96939588 AGCAGAAAGCAAGCTAGGAGGGG - Intergenic
977709357 4:100106993-100107015 AGAGGGAAGCCTGCCAGGATGGG + Intergenic
978146871 4:105385176-105385198 AGGGGATAAAATGCCAGAAGTGG - Intronic
982222539 4:153137315-153137337 AGTGAGAAGCATGCCAGGAGAGG - Intergenic
982786486 4:159543084-159543106 TGGGTAGAGCATGCCTGGAGAGG + Intergenic
983121521 4:163891081-163891103 AGGGGACATCATGTGAGGAGAGG + Intronic
984324312 4:178231981-178232003 TGGGGAAAGGATGGGAGGAGAGG + Intergenic
984753397 4:183300269-183300291 AGGGAAAAGCATGCCGAGAGAGG + Intronic
985831936 5:2240368-2240390 AGGGGACTGCATGCACGGAGGGG - Intergenic
986266630 5:6196689-6196711 AGGGGAAAGCCTGCATGTAGAGG + Intergenic
986286596 5:6363496-6363518 ACAGGAGAGCATGCCAGGTGAGG - Intergenic
989312457 5:40036025-40036047 AGGGAAGAGAATGCCAGGAAAGG + Intergenic
990149470 5:52800301-52800323 ATGGGAATGCAGGCCAGGAAGGG - Exonic
990666496 5:58078292-58078314 AGGGGAAAGCGTCCCATGAGGGG - Intergenic
992272830 5:75083431-75083453 AGGGGAAAGCAGGCCAGGCCAGG + Intronic
994305656 5:98201059-98201081 TGTGTAAGGCATGCCAGGAGGGG + Intergenic
995341852 5:111069863-111069885 AGGGGAAGGCATGTCAGGTGAGG + Intergenic
998058741 5:139102630-139102652 AGGGGAAGGAATGGGAGGAGGGG - Intronic
998380562 5:141722092-141722114 ATGGAAAAGCAGGCCAGGTGTGG - Intergenic
998550101 5:143069087-143069109 AGGAGAGAGGATGGCAGGAGGGG - Intronic
998890372 5:146739435-146739457 GGAGGAAAGAATGCCAGGGGTGG + Intronic
999156760 5:149463785-149463807 AAGGGAAAGAAAGCCAGGCGCGG - Intergenic
1000119082 5:158179643-158179665 AGAGGAGAGAATGCCTGGAGTGG - Intergenic
1000204569 5:159046554-159046576 AAGAGACAGCATGCCAGGACTGG + Intronic
1000665731 5:163993840-163993862 AGGTTAAAGCAGGCCAGGTGGGG + Intergenic
1000886956 5:166758432-166758454 ATGGGAAAGAATGCAAAGAGTGG + Intergenic
1001041575 5:168339349-168339371 GGGGGAAAGAATGCCAGTGGAGG + Intronic
1001529823 5:172454155-172454177 AGGGGAGAGCAGGGGAGGAGGGG + Intronic
1002198285 5:177512931-177512953 AGGGGACAGAGTGCCAGGGGAGG - Intronic
1002261515 5:177996563-177996585 AGGGGAAAGGGACCCAGGAGTGG + Intergenic
1003414782 6:5898096-5898118 AGGGAAATGACTGCCAGGAGGGG + Intergenic
1003823330 6:9924860-9924882 AAGGCAGAGCAGGCCAGGAGGGG + Intronic
1004423247 6:15489842-15489864 TGGGGAAAGGGTGACAGGAGAGG - Intronic
1005047190 6:21653620-21653642 AGGGGCAAGGAAGCCAGGAGTGG - Intergenic
1005680251 6:28199587-28199609 AGAGGAAAGCAGTCCAGGGGTGG + Intergenic
1005749232 6:28867831-28867853 AGGGAAAAGCAGGCCGGGTGGGG - Intergenic
1005886037 6:30098444-30098466 AGGAAAAAGCATGGCAGGAGTGG - Intergenic
1006256405 6:32835874-32835896 AGGGGAAAGCATGCCAGGAGGGG + Intronic
1006258961 6:32853013-32853035 AGGGGAACGCAGGGCAAGAGGGG - Intronic
1006354375 6:33545858-33545880 AGGGCAAAACAGGCCAGGCGCGG + Intergenic
1007054806 6:38872005-38872027 AGAGGAAAGCAGGACAGGAATGG - Intronic
1007223858 6:40299393-40299415 AGGGAAGGGCATGCCAGGACAGG - Intergenic
1007278979 6:40696306-40696328 AGAGGAAAGGATGCCAAAAGAGG - Intergenic
1007317717 6:41002857-41002879 AGGTGGAAGCACACCAGGAGGGG - Intergenic
1007650482 6:43417351-43417373 AGGAGAAAGTAAGCCAAGAGGGG + Intergenic
1008489198 6:52067829-52067851 AGGGGATAGCAAGCCATAAGAGG + Intronic
1010937848 6:81883177-81883199 AGGGGCAAGGAAGCCAGTAGTGG + Intergenic
1010938585 6:81889131-81889153 AGGGGCAAGGAAGCCAGTAGTGG + Intergenic
1013471930 6:110473813-110473835 AGGGGAAAACAGGCCAGGTGCGG - Intronic
1014651754 6:124048156-124048178 AGAGGAAAGCATCCAATGAGGGG - Intronic
1015116209 6:129652141-129652163 AGGGGCAGGGATGCCAGGAAGGG - Intronic
1015936590 6:138410928-138410950 AGGGAACTGCATGCCAGGAATGG + Intronic
1016563039 6:145418400-145418422 AGGGGAAAGGATGCCTCAAGTGG + Intergenic
1016569166 6:145493033-145493055 AAGGGAAAGCATGGAATGAGAGG - Intergenic
1017837268 6:158189800-158189822 TAGGGAAAGCATGACTGGAGTGG - Intronic
1018219752 6:161566209-161566231 AGGGGAAAGCCTGCCTCGAATGG - Intronic
1018224058 6:161610759-161610781 AGGAAAGAGGATGCCAGGAGGGG + Intronic
1018570028 6:165199940-165199962 ACTGAAAGGCATGCCAGGAGGGG - Intergenic
1018747241 6:166772175-166772197 AAGGGAGTGCTTGCCAGGAGGGG - Intronic
1018907209 6:168082532-168082554 CTGGGAAAACATGCAAGGAGAGG - Intergenic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1022124445 7:27341938-27341960 AGTGGGAAGCAGGCCTGGAGAGG - Intergenic
1022315549 7:29241664-29241686 AGGGCAAAGCTGGGCAGGAGGGG + Intronic
1022368444 7:29748015-29748037 AGGGGAAAGCAGGAAGGGAGGGG - Intergenic
1023263223 7:38379232-38379254 AGGGGAAGGCATCCCAGGAGAGG + Intergenic
1024116109 7:46195445-46195467 AAGGGAAAGAATGCCAGGCCAGG + Intergenic
1024864070 7:53882746-53882768 ACAGGAAAGCATGCCACCAGTGG - Intergenic
1025101484 7:56138957-56138979 AAGGAGAAGCATGCCAGGAATGG + Intergenic
1026010264 7:66630298-66630320 AAGGGAAACGATGCCAGGTGTGG + Intronic
1026845107 7:73694300-73694322 AGGAGACAGCCTGCCAGGCGTGG - Intronic
1029058451 7:97771613-97771635 AGGGGAAAGCAGGGAAGGAAAGG + Intergenic
1029620778 7:101688650-101688672 AGGGCTAAGGATGCCAGGGGTGG - Intergenic
1030028206 7:105345161-105345183 AGGGGAAGGCAAGGGAGGAGAGG + Intronic
1031109334 7:117587114-117587136 GGGAGAAAGGATGACAGGAGGGG + Intronic
1031964130 7:128015184-128015206 TTGGGAAAGCAGGGCAGGAGAGG - Intronic
1032300271 7:130680214-130680236 AAGGAAAAGCAGGCCAGGTGCGG + Intronic
1032852980 7:135811009-135811031 AGGGAGTAGCATGCCAGGACTGG + Intergenic
1033277618 7:139984474-139984496 AGGAGAGAGCAACCCAGGAGTGG - Intronic
1033672758 7:143508914-143508936 TGGGAAGAGCATTCCAGGAGTGG + Intergenic
1033836458 7:145318375-145318397 AGGGAAAAGCAAGGCAGGAAAGG + Intergenic
1034933398 7:155182266-155182288 AGGTGGAAGCATGGCTGGAGTGG + Intergenic
1035049623 7:155991005-155991027 AAGGGAAGGAAGGCCAGGAGCGG - Intergenic
1035072797 7:156157355-156157377 AGGGGAAAGCCAGGCAGGTGCGG + Intergenic
1036401033 8:8408514-8408536 ATGGGGAAGCATCCCAGGAGAGG + Intergenic
1036432015 8:8700513-8700535 AGAGGAAAAAATCCCAGGAGTGG + Intergenic
1036644040 8:10601184-10601206 AGGGGACAGCAGGCTAGGACAGG + Intergenic
1037085083 8:14838580-14838602 AGGGAAAAGCAAGGCAGGGGAGG - Intronic
1038190882 8:25319285-25319307 AGGAGAATGCATGCCTGGGGAGG + Intronic
1038262785 8:26011906-26011928 AGGAGGAGGCATTCCAGGAGGGG - Intronic
1038352108 8:26786161-26786183 AGTGAAAGGCAGGCCAGGAGCGG - Intronic
1039803815 8:40982287-40982309 AGGTGAAAGGAGGCCAGGAAAGG - Intergenic
1040543564 8:48380302-48380324 AGGGGAAAGGTTGACAAGAGCGG + Intergenic
1041218594 8:55626476-55626498 AGTGGAAAGCAGGGAAGGAGGGG + Intergenic
1043927895 8:86058690-86058712 AAGGGAAAGAATGACAGAAGTGG + Intronic
1044416711 8:91947975-91947997 AGGAGACAGTATCCCAGGAGAGG - Intergenic
1044857926 8:96494655-96494677 AGGGGAAAGGGTGGCAGGAGGGG + Intronic
1044951842 8:97442806-97442828 AGGGGAAAACATTCTAGGGGAGG - Intergenic
1045494047 8:102693393-102693415 AGGGCATAGCAGGCCAGGAGTGG + Intergenic
1045897739 8:107239036-107239058 AGTGGAAAGCATGCCAAAAATGG + Intergenic
1047114006 8:121820295-121820317 AGGGAAAAGCATGCCTCCAGAGG + Intergenic
1047180745 8:122585319-122585341 GTGGGAAAGCTTGCCAGGCGAGG - Intergenic
1047362699 8:124183729-124183751 AGGGGAAATGAGGCCAGGTGTGG + Intergenic
1047441096 8:124879380-124879402 AAGGAAAAGCATGCCAGGGATGG + Intergenic
1047646308 8:126874122-126874144 AAGGGAAATGAGGCCAGGAGCGG - Intergenic
1048287172 8:133150971-133150993 AGAGGAGAGCATGCCAGGCAGGG - Intergenic
1048539847 8:135332835-135332857 AGGGTGAAGAATTCCAGGAGAGG + Intergenic
1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG + Intergenic
1049361570 8:142214554-142214576 AGGGAAAATCATTCCAGCAGAGG - Intronic
1049463029 8:142738912-142738934 AGGGGAAGTCATGCGGGGAGCGG - Intergenic
1049810201 8:144564360-144564382 AGGGGAAGCCATCCCAGCAGGGG - Intronic
1050525613 9:6543874-6543896 AGGGGCAAGGAGGACAGGAGGGG + Intronic
1051076002 9:13237150-13237172 AATGGTAAGCAGGCCAGGAGCGG + Intronic
1051408034 9:16760110-16760132 GGGGGAAGGCAGGACAGGAGAGG + Intronic
1051425394 9:16927078-16927100 AAGGGAAACCTTGCCAGGCGTGG + Intergenic
1054785498 9:69206334-69206356 AGGGTAAAGCAAGGCAGGTGCGG - Intronic
1056174119 9:84017633-84017655 AAGGGAAAGCAAGGCAGGACAGG - Intergenic
1056174134 9:84017683-84017705 AAGGGAAAGCAAGGCAGGACAGG - Intergenic
1056771671 9:89482021-89482043 AGGGGAAAGGAGGCAGGGAGAGG + Intronic
1057586267 9:96331518-96331540 AGGGGAAAGGGTGGCAGGAGGGG - Intronic
1059088625 9:111332616-111332638 AGGGGAAAGGATGCGAGGCTGGG + Intergenic
1059730555 9:117052927-117052949 ACTGGATATCATGCCAGGAGAGG + Intronic
1059853456 9:118368769-118368791 AGGGGAAAGTTTGGGAGGAGAGG + Intergenic
1060212207 9:121717602-121717624 AGGAGTAAACACGCCAGGAGGGG - Intronic
1060526486 9:124323993-124324015 AGGGGGAACCATGCCAGGTGAGG - Intronic
1060815342 9:126632335-126632357 TGGGGAGGGCATTCCAGGAGGGG + Intronic
1060865170 9:126989570-126989592 AGTGGAAGGCAGGCCAGGGGTGG + Intronic
1060992299 9:127856115-127856137 TGAGGAAAGCATGCCAGGCAGGG + Intergenic
1061087887 9:128409747-128409769 TGGGGAAAGCAGGCTGGGAGAGG - Intergenic
1061307430 9:129740157-129740179 GGGGGAGAGTATGGCAGGAGTGG - Intronic
1061499272 9:130992880-130992902 AGGGGACAGGATGGCAGGTGTGG + Intergenic
1061656433 9:132094802-132094824 AGGAGCAAGAATGCCAGTAGTGG + Intergenic
1061784059 9:133014520-133014542 AAGGGCAAGCATCCCAAGAGAGG + Intergenic
1062181457 9:135193310-135193332 AGGGAAGAGCATGCCAGGCTCGG - Intergenic
1062324949 9:136008324-136008346 AGAGGAAGGCAGGGCAGGAGAGG + Exonic
1185640588 X:1587997-1588019 AGGGGAAAGGAAGGGAGGAGAGG - Intergenic
1185647970 X:1628582-1628604 AGGGGAGAGCAGGGGAGGAGAGG - Intronic
1185839922 X:3379457-3379479 AAGGGAATGAATGCCAGGAGTGG + Intergenic
1185869192 X:3649721-3649743 AGGGGAAAGAATGGGAGGGGAGG + Intronic
1186095165 X:6092496-6092518 TGGGGAAAGAATGCCAGCATAGG + Intronic
1186103603 X:6182403-6182425 TGAGGAAAGCATCCCAGGAAAGG + Intronic
1186194986 X:7100892-7100914 AAGGGAAAGCAAGCCAGAGGAGG - Intronic
1186843515 X:13508694-13508716 TAGAGAAATCATGCCAGGAGTGG - Intergenic
1187406690 X:19010624-19010646 AGGGGCCAGCATGTCAGGCGGGG + Exonic
1188306058 X:28561017-28561039 ATGGGAAAACATGCCGGGAAAGG - Intergenic
1189766542 X:44378123-44378145 AGAGGAAAATATGCTAGGAGAGG + Intergenic
1190701593 X:52993323-52993345 TGGGGAAGGCATCCCTGGAGAGG - Intronic
1190753959 X:53384655-53384677 AAGAGAAAGCAAGCCAGGAATGG + Intronic
1190964750 X:55288390-55288412 AGAGGAAAGCAGGCCAGGCTCGG - Intronic
1191754233 X:64577001-64577023 AGAGGAAAGCATGTCAAAAGGGG - Intergenic
1192137817 X:68620683-68620705 AAAGGAAACCATGCCAGGCGTGG - Intergenic
1192262043 X:69511287-69511309 AGGGGCATGCAGGCCAGAAGAGG - Intronic
1192621768 X:72683145-72683167 AGTGGAAAACAGGCCAGGTGTGG + Intronic
1193249601 X:79273657-79273679 GGAGGAAAGCATTGCAGGAGTGG + Intergenic
1193450157 X:81655630-81655652 AGGGGCAAGAAAGCCAGTAGTGG + Intergenic
1195001049 X:100643751-100643773 GAGGGAAAGCATGCCTGGAGAGG - Intergenic
1195572996 X:106417359-106417381 GGGGAAAAGCATTCTAGGAGAGG + Intergenic
1195843727 X:109203650-109203672 AGGGGATGGCAGGCCAGGGGAGG - Intergenic
1198743073 X:139861906-139861928 AGGTGAAAGGAAGACAGGAGAGG - Intronic
1199342252 X:146694515-146694537 AGAGGAATGCAGGCCAGGCGTGG - Intergenic
1199777850 X:151031309-151031331 AGTGGAAAGAATGCCTAGAGTGG - Intergenic
1200282346 X:154787760-154787782 AAGGGAAAGCTGGCCAGGTGTGG - Intronic
1200954216 Y:8928777-8928799 GGGAGAAAGCATGTCAGGGGAGG + Intergenic
1201077881 Y:10200430-10200452 AGGGGCAGGCATGGCAGGAGAGG - Intergenic
1201416514 Y:13753063-13753085 AGAGGTAAGAATGACAGGAGAGG - Intergenic
1201928871 Y:19319540-19319562 TTTGGAATGCATGCCAGGAGAGG - Intergenic