ID: 1006256436

View in Genome Browser
Species Human (GRCh38)
Location 6:32836194-32836216
Sequence AGTATCTATGATGACAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006256436_1006256439 26 Left 1006256436 6:32836194-32836216 CCTTCTCTGTCATCATAGATACT 0: 1
1: 0
2: 0
3: 21
4: 265
Right 1006256439 6:32836243-32836265 TCCCTGCCCCCACAATTCTCTGG 0: 2
1: 0
2: 0
3: 26
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006256436 Original CRISPR AGTATCTATGATGACAGAGA AGG (reversed) Intronic
900873981 1:5328128-5328150 ATTATCTCTGATTGCAGAGAAGG - Intergenic
901095136 1:6672700-6672722 AGAATACATGATGCCAGAGAGGG + Intronic
901974556 1:12933782-12933804 AGTGTCTTTGAGGGCAGAGAGGG - Intronic
902010616 1:13267985-13268007 AGTGTCTTTGAGGGCAGAGAGGG + Intergenic
902178032 1:14666091-14666113 AATATCTATAATGACGGAGAGGG + Intronic
902393777 1:16121008-16121030 AGTGTCCATGATGGCAGAGAGGG + Intergenic
903877419 1:26484883-26484905 AGAATCTAGGCTGACAAAGAAGG - Intergenic
906258919 1:44371470-44371492 AGTAGCCATGATGGCAGGGATGG + Intergenic
908033791 1:60030037-60030059 AGTAACTCTGAACACAGAGAAGG - Intronic
908399012 1:63752815-63752837 AGTATTTCTGTTGTCAGAGAGGG + Intergenic
908984392 1:69999326-69999348 AGCATCTATGAACACTGAGAAGG + Intronic
909662001 1:78094329-78094351 AATATCCTTGAGGACAGAGATGG - Intronic
910154509 1:84199342-84199364 AGAATTTATGAAGACAAAGAAGG - Intronic
910204929 1:84740409-84740431 ATTATTTGTGCTGACAGAGAAGG - Intergenic
913421584 1:118675677-118675699 AGCAACTATGATGAAAGACAGGG + Intergenic
917104030 1:171474231-171474253 GGATTCTATGAGGACAGAGAGGG + Intergenic
920746856 1:208637123-208637145 ATTATCTATGAAGACAAAAAAGG - Intergenic
922639388 1:227212246-227212268 TGTTTCCATGATGACAGATATGG - Intronic
923048098 1:230370048-230370070 AGTTACGTTGATGACAGAGACGG + Intronic
1063647810 10:7903237-7903259 AGCATACATGATGACAGAAATGG - Intronic
1063877003 10:10490519-10490541 AATCTCTGGGATGACAGAGAGGG - Intergenic
1065370886 10:24984840-24984862 AGAATCTATAAAGACCGAGAGGG + Exonic
1067299317 10:44994656-44994678 AGGATCTATGCTGCCAGAGGAGG - Exonic
1067367998 10:45654120-45654142 AGTATATATGGAGACAAAGATGG + Intronic
1068038069 10:51786134-51786156 AGTATCAATGAAGTCAGAGAAGG + Intronic
1068244633 10:54348380-54348402 AGTACCTATGAGGACATCGAGGG + Intronic
1069154046 10:65002071-65002093 AGAATCTAAGAACACAGAGAAGG - Intergenic
1070735847 10:78863177-78863199 ATTACCTGTGATGACAGATAGGG - Intergenic
1071920133 10:90340452-90340474 AGTAGCTATGGTGGCAGGGATGG + Intergenic
1073060177 10:100729329-100729351 GGTATCTACGTAGACAGAGATGG - Intergenic
1073075316 10:100821843-100821865 AGACTTTATGATGACAGGGAAGG + Intronic
1073270571 10:102259717-102259739 AATATGTATGATGACATAGTGGG + Intronic
1073415365 10:103376665-103376687 AGTATCTATGTTGCCAAGGATGG - Intronic
1073818754 10:107236222-107236244 AGTAGCTATGGTGGCAGACATGG + Intergenic
1075435501 10:122437642-122437664 AGTAGCCATGATGAATGAGAAGG + Exonic
1076321820 10:129588669-129588691 ACTATCCATGATGACAGTGCTGG - Intronic
1076378471 10:130009126-130009148 AGGTTCTTTGAGGACAGAGAAGG + Intergenic
1076917223 10:133430332-133430354 AGTGTCTGTGAGCACAGAGAAGG + Intergenic
1077605413 11:3607338-3607360 AGTATCTAGGATGACAGGCACGG - Intergenic
1079583506 11:22096056-22096078 GATATCTATGATGAAATAGAGGG + Intergenic
1081362272 11:42195073-42195095 AGTATCTATTAATACACAGAAGG + Intergenic
1084018357 11:66401091-66401113 AGTAGCTGGGATTACAGAGATGG - Intergenic
1084462885 11:69306160-69306182 AATATCTATGAGAACTGAGAAGG - Intronic
1084609455 11:70193017-70193039 AGTGTCTATGAGGGCAGTGATGG + Intergenic
1085138910 11:74121815-74121837 AGTATCAGTGATGACTGTGAAGG + Intronic
1087438042 11:98147056-98147078 AGTATCATTGATTACAGAAATGG - Intergenic
1087624207 11:100578268-100578290 AATATCTATGATATTAGAGAGGG - Intergenic
1088003031 11:104905553-104905575 GTTATCTATGATGATACAGATGG + Intergenic
1088611995 11:111586414-111586436 AGTATCTTTGTTCACAGGGATGG + Intergenic
1089791352 11:120946899-120946921 ACTATCTCTGATCCCAGAGAAGG + Intronic
1089939151 11:122397236-122397258 AGTGGCTATGATGGCAAAGATGG + Intergenic
1090769760 11:129909537-129909559 AGGATCAATCATGACAAAGACGG + Intronic
1096591301 12:52661099-52661121 ATTATCTATCATGTCAGAAATGG + Intergenic
1097313842 12:58151283-58151305 AGTAGCCATGATGGCAGGGATGG - Intergenic
1097368832 12:58750217-58750239 ATTGTTTAAGATGACAGAGATGG + Intronic
1097554709 12:61122436-61122458 AGTGGCTATGGTGGCAGAGATGG + Intergenic
1097765050 12:63516609-63516631 AGTATTGATGATGACACTGATGG + Intergenic
1098014634 12:66091503-66091525 AGAATCTATGAACACAAAGAAGG - Intergenic
1098937905 12:76501630-76501652 AGTAGCCATGGTGACAGGGATGG + Intronic
1099720297 12:86353720-86353742 ACTTTCTATAATGAGAGAGAAGG - Intronic
1101278976 12:103230693-103230715 AGGATTAATGAAGACAGAGAAGG - Intergenic
1101531241 12:105575366-105575388 AGTGGCTATGATGGTAGAGAGGG - Intergenic
1102607043 12:114075940-114075962 AGTATCAATGATGGCAGCAATGG + Intergenic
1102693014 12:114776411-114776433 AGTAGCTAGGATGACAGGCATGG - Intergenic
1103196787 12:119050976-119050998 CCTTTCTATGATGACAGAGATGG - Intronic
1104399389 12:128463271-128463293 AGCATCTATGATGGCAGGGATGG + Intronic
1106403149 13:29448880-29448902 AGTAGCTAGGATTACAGACACGG + Intronic
1107209428 13:37835523-37835545 AGTAGCTAGTAAGACAGAGAAGG - Intronic
1107249439 13:38340834-38340856 AGTTTCTTTGATGACAGAGCTGG - Intergenic
1108005236 13:45939708-45939730 AGTTTCTACAAGGACAGAGAGGG - Intergenic
1108387848 13:49918016-49918038 AGTATCAATGATGACAAACTGGG - Intronic
1109575769 13:64255813-64255835 TATGTCTATGATGGCAGAGATGG - Intergenic
1109825123 13:67709032-67709054 AGTGTCTATTATGACATAGCTGG + Intergenic
1110969187 13:81739698-81739720 AGTATCTTTGGAGAGAGAGAAGG - Intergenic
1111491061 13:88976149-88976171 AGTATCTGGGATTACAGACATGG + Intergenic
1111500623 13:89115857-89115879 AGTATCTATGATGTCATTTAGGG - Intergenic
1111636689 13:90913857-90913879 CGTATCTGTAATGACAGAGGAGG + Intergenic
1112213878 13:97410005-97410027 GATATCTATGATCACAGAGATGG + Intergenic
1113212134 13:107995443-107995465 AATGTCTATGATGGCAGAAATGG + Intergenic
1113698790 13:112367119-112367141 AGTATCAATGAGGGCAGAGAGGG + Intergenic
1115793006 14:36900756-36900778 AGTATTTATCATGTCAGGGAAGG + Intronic
1117265274 14:54079986-54080008 AATAGCTATGATGGCAGAAAGGG - Intergenic
1117665227 14:58049674-58049696 AGTGCCCATGATGACAGAGGTGG + Intronic
1118070729 14:62244522-62244544 ATTATTTATGATGACTGATATGG + Intergenic
1120366110 14:83572132-83572154 TTTATCTATTATGACATAGAAGG + Intergenic
1120915390 14:89705833-89705855 AGTATCTATGGTGATAGAAATGG - Intergenic
1122531347 14:102429633-102429655 ATTACCTCTGATGTCAGAGAGGG + Intronic
1123765293 15:23471830-23471852 AGTGTTTATGGTGACAGGGAAGG - Intergenic
1124260193 15:28182784-28182806 GGTATTTAAGATGAAAGAGAAGG - Intronic
1125336767 15:38634510-38634532 AGTGTCTATCAAGACAGGGATGG + Intergenic
1125614141 15:40994735-40994757 AGTAACTATGAAGATAGAAATGG + Intronic
1126173303 15:45712395-45712417 AGTAGATAGGATGACAGAAATGG - Intergenic
1126990184 15:54365661-54365683 AGGATTTATGATGAAAGAGTTGG + Intronic
1128420044 15:67483386-67483408 AGTATCTGGGATTACAGGGATGG - Intronic
1129111847 15:73341742-73341764 ATTACTTATGCTGACAGAGAGGG - Intronic
1131137194 15:89946459-89946481 AGTATCTAGGATTACAGGCATGG - Intergenic
1131986143 15:98044333-98044355 TGGATGTATGATGACAGAAAAGG - Intergenic
1133182806 16:4071199-4071221 AGTAGCTAGGATTACAGACATGG - Intronic
1135546260 16:23368942-23368964 AGTATATATGATTCCAGTGAAGG + Intronic
1135852218 16:25974326-25974348 ACTATCTAAGATGTCACAGAGGG - Intronic
1137504422 16:49040890-49040912 AGTATCTAGGGTCACAGAGATGG + Intergenic
1137994517 16:53195630-53195652 AGTATCTCTGAGCTCAGAGAAGG + Intronic
1138837648 16:60458003-60458025 AATAGCTATAGTGACAGAGATGG - Intergenic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1139546122 16:67650428-67650450 CGTATATGTGAGGACAGAGATGG - Intronic
1140239781 16:73190584-73190606 AGGATCTTTCATGACAGTGAAGG + Intergenic
1141233006 16:82188108-82188130 AGTTTCTATGAGGACTGAGTTGG - Intergenic
1141747326 16:85934348-85934370 AGGAGCTAAGATGACAGGGAGGG + Intergenic
1143105861 17:4530334-4530356 AGTGCCTATGAGGACAGAGGGGG + Intronic
1143247989 17:5501773-5501795 AGTACCAATGAAGCCAGAGAGGG - Intronic
1144398523 17:14870512-14870534 AGTCTCAAGGAGGACAGAGATGG + Intergenic
1146433312 17:32819813-32819835 AGGATCTAATATTACAGAGAAGG + Intronic
1146748762 17:35356448-35356470 AGTATCTGTGATAAGGGAGAAGG - Intronic
1149411593 17:56413846-56413868 AGTAGCTGGGATTACAGAGATGG + Intronic
1150905956 17:69337694-69337716 AGTAACTGGGATGACAGACATGG - Intergenic
1150930542 17:69580010-69580032 AGTATTTCTGAAGACAAAGAAGG + Intergenic
1151105197 17:71605454-71605476 AGTATTTATGATCTCAGGGAAGG - Intergenic
1151505547 17:74524837-74524859 AATATCTATGGGGGCAGAGAGGG - Intronic
1152262075 17:79272701-79272723 ATTATCTGCGATGACAGAGCTGG - Intronic
1153166466 18:2267265-2267287 AGTCTCTCTGATGATAGAGTAGG - Intergenic
1153254270 18:3155084-3155106 AGCATCTGTGGAGACAGAGAAGG + Exonic
1153497492 18:5714585-5714607 AGTACATATAATGACAAAGATGG - Intergenic
1153772138 18:8424830-8424852 ATTATCTGTGTTAACAGAGAGGG - Intergenic
1154439364 18:14374007-14374029 AGTCTCTATGATATCAGAAATGG + Intergenic
1156062384 18:33096038-33096060 AGCATTTTTGCTGACAGAGAAGG - Intronic
1164898651 19:31899252-31899274 AGTAGCTATGGTGGCAGGGATGG - Intergenic
1165955690 19:39500619-39500641 GGTTTCGATGATGAAAGAGAAGG - Exonic
925778034 2:7354172-7354194 GGGCTCTGTGATGACAGAGATGG - Intergenic
927119842 2:19948064-19948086 AGTAACTGTGATTACAGACATGG + Intronic
927660540 2:24989460-24989482 AGTGGCTATGGTGGCAGAGACGG + Intergenic
931202874 2:60117074-60117096 AGAATTTATGAAGACAAAGAAGG - Intergenic
931484205 2:62673818-62673840 AGTATCTGTGATGACATAATGGG - Intergenic
933896079 2:86810330-86810352 AGGAAATATGATGACAGTGATGG - Intergenic
935429864 2:102964195-102964217 TGTATATTTGATGAAAGAGATGG - Intergenic
935526955 2:104182218-104182240 AGTGGCTATGATGTCAGGGATGG + Intergenic
936918558 2:117664454-117664476 AGAATCTATGATCACAAACAAGG + Intergenic
937100515 2:119264673-119264695 AGCATCTTTGAAGACAAAGAGGG + Exonic
937146351 2:119648462-119648484 TGTATCTGTGACGACAGAGTCGG + Intronic
937810236 2:126191428-126191450 AGTATCTATGAATACCAAGATGG - Intergenic
938150086 2:128874958-128874980 AGCATCTCTGATGGCAGGGAAGG - Intergenic
939103590 2:137924363-137924385 AGTCTCTATGATACCAGAAATGG - Intergenic
939373665 2:141335473-141335495 AATATCTTTGATGGCAGACAAGG - Intronic
941572998 2:167194770-167194792 AGTATCTCTGATGTCAGATGAGG - Intronic
943416800 2:187617405-187617427 AGAGTGAATGATGACAGAGAAGG + Intergenic
944766847 2:202872487-202872509 AATCTGTATGATGACAAAGATGG + Intergenic
945196108 2:207238958-207238980 AGCTTCCATGATTACAGAGAAGG + Intergenic
945499932 2:210559357-210559379 TCTCTCTTTGATGACAGAGACGG + Intronic
945519916 2:210813404-210813426 AGTATCTATGACATCAGAAATGG - Intergenic
946950612 2:224870709-224870731 AATATCTATGACCATAGAGAAGG - Intronic
947023023 2:225704563-225704585 AGAATCTGAGATCACAGAGATGG - Intergenic
947603456 2:231468568-231468590 AGTAACTCTGTTGACAGGGAGGG - Intronic
1171937792 20:31292569-31292591 AGTATGTATGAACACAAAGAAGG + Intergenic
1173867553 20:46322333-46322355 AGTGTCTATGATGGGAGTGAAGG + Intergenic
1174224773 20:48988578-48988600 AGCATCTATGAAGAGATAGAAGG + Exonic
1174307543 20:49624906-49624928 AGTATATATGATGTTAGAGAGGG + Intergenic
1176456319 21:6915401-6915423 AGTCTCTATGATATCAGAAATGG - Intergenic
1176834493 21:13780461-13780483 AGTCTCTATGATATCAGAAATGG - Intergenic
1179099005 21:38340166-38340188 AGTAGCTAAGGTGACAGAGAAGG + Intergenic
1179449531 21:41459046-41459068 AGTTTCTAGGAATACAGAGAAGG - Exonic
1180138442 21:45876242-45876264 AATATCTCTGATGAGAGACAGGG - Intronic
1185230209 22:49675963-49675985 AGTATCTCTGATCTCAGAAAAGG + Intergenic
951397438 3:22186476-22186498 AATGTCTCTGACGACAGAGATGG - Intronic
951441909 3:22733175-22733197 AGAATCTTCGATGGCAGAGATGG + Intergenic
951817254 3:26768017-26768039 ACTTTCTGTGATGACAGAAATGG - Intergenic
952294523 3:32049466-32049488 AGTCTCTCTAAAGACAGAGAGGG + Intronic
954473455 3:50720328-50720350 AGTATACATGAACACAGAGAAGG - Intronic
955044353 3:55345948-55345970 AGTATCTCTCATTACAGATAAGG - Intergenic
955192460 3:56774029-56774051 AGTATCTGGGAAGACAGAAAAGG + Intronic
955868128 3:63407616-63407638 AATATATATGATTACAAAGAAGG - Intronic
956498324 3:69853210-69853232 AATATCTGTGAGAACAGAGATGG + Intronic
963598704 3:147359026-147359048 AGTGTGTCCGATGACAGAGAAGG - Intergenic
965178451 3:165367007-165367029 AGTATCTATGTTGAAGGACAAGG + Intergenic
965806997 3:172552078-172552100 AGTAGCCATGGTGACAGAGAGGG - Intergenic
965925823 3:173978484-173978506 AGTACCTATGAAAACAAAGAAGG + Intronic
966084058 3:176045126-176045148 ATTATTTAAGATAACAGAGAGGG + Intergenic
966537639 3:181052237-181052259 GGTATGTATGTTGACAGAGCAGG + Intergenic
967389846 3:188945042-188945064 AGTCTCTCTGATGACATGGAGGG - Intergenic
967700594 3:192587811-192587833 CGTATATATGATGAGAAAGAGGG - Intronic
969164101 4:5290051-5290073 AGTACCTATGAACACAAAGAAGG - Intronic
972607369 4:40626141-40626163 AGTTCCTATGATGACAAAAATGG + Intronic
972978494 4:44666606-44666628 ATCATCTATTATGACAAAGAAGG + Intronic
973019916 4:45190151-45190173 AGTATCTTTCAGGTCAGAGAAGG + Intergenic
973222368 4:47743251-47743273 AGCATCTATGATGGAATAGAAGG - Intronic
974629996 4:64476662-64476684 ATTGTCTATTAAGACAGAGAAGG + Intergenic
976495396 4:85723725-85723747 TGTATCTTTGAAGACAGAGCTGG + Intronic
977753040 4:100632494-100632516 AGTAGCTATGCTGTCAGAGGTGG - Intronic
978672601 4:111268695-111268717 GTTCTCTATGATGAGAGAGAAGG + Intergenic
979373507 4:119916884-119916906 AATATCAAAGATGACAAAGAAGG + Intergenic
980509462 4:133766093-133766115 TGTAACTAATATGACAGAGACGG - Intergenic
982107952 4:152027307-152027329 GGTAGCTATAATGAAAGAGATGG + Intergenic
983745470 4:171192817-171192839 GGTTTCTATGAGGGCAGAGAAGG - Intergenic
985136927 4:186795376-186795398 CCTATCTCTGAGGACAGAGAAGG - Intergenic
985599778 5:821222-821244 ACTCTCCATGATGACAGAGATGG + Intronic
986471877 5:8084016-8084038 AGTGTCCATGGTGACAGGGAAGG - Intergenic
987397282 5:17436515-17436537 AGAAACTATGAGGACAGAGGTGG - Intergenic
988276675 5:29089871-29089893 AATATCTCAGCTGACAGAGAAGG + Intergenic
991299369 5:65114089-65114111 CGTATTTCTAATGACAGAGACGG + Intergenic
991703976 5:69340471-69340493 AGTATCTATTATGGTAGAGTAGG + Intergenic
993299237 5:86185978-86186000 ACTAGCTATGCTGACAGAAAAGG + Intergenic
994816657 5:104594547-104594569 AGCATCTATGAAGAGAGATAGGG - Intergenic
994936680 5:106262115-106262137 AGAATCTTTGAACACAGAGATGG + Intergenic
995496368 5:112748688-112748710 AGTAGCTGGGATTACAGAGATGG - Intronic
996924123 5:128802789-128802811 AGTATCTATTAGGAAAAAGAAGG + Intronic
997075506 5:130670545-130670567 AGTAATCATAATGACAGAGACGG - Intergenic
997363475 5:133310466-133310488 ATTGCCTATGATGAAAGAGAAGG - Intronic
999240868 5:150126673-150126695 GGGATCTATGATGCCAAAGATGG - Intronic
1001148417 5:169204790-169204812 AGGAGGTATGATGACTGAGAAGG + Intronic
1001288262 5:170439027-170439049 AGGATCTAAGTTGATAGAGAGGG - Intronic
1001322528 5:170694440-170694462 AGTCTCTGTGATGACAGAAGGGG - Intronic
1003220811 6:4159413-4159435 AGAATCTATGAAGACAGACTTGG - Intergenic
1003397810 6:5768160-5768182 AACATGAATGATGACAGAGAAGG - Intronic
1003899467 6:10640672-10640694 AGTGGCTATGGTGGCAGAGATGG - Intergenic
1005321976 6:24664472-24664494 AGTGTCTCTGATGAGAGACAAGG - Intronic
1006256436 6:32836194-32836216 AGTATCTATGATGACAGAGAAGG - Intronic
1008527963 6:52426557-52426579 AGTCTCAATGATGTCAGAGTTGG - Intronic
1010520767 6:76832941-76832963 AGTAGCCATGATGACCGGGAAGG - Intergenic
1011180667 6:84616460-84616482 ACTATTTATGATGAAAGAAAAGG - Intergenic
1011312488 6:85995405-85995427 ATTATCTATGACTGCAGAGACGG + Intergenic
1012027421 6:94014408-94014430 AGTATTTATGATAGCAGAAAAGG + Intergenic
1012107849 6:95188239-95188261 AGTATAGATTATGGCAGAGAAGG - Intergenic
1012511170 6:100003360-100003382 AGTAGCCATGATGGCAGAGATGG - Intergenic
1013645847 6:112140347-112140369 AGTATCTGGGATGAGAGAGGGGG - Intronic
1013649575 6:112180950-112180972 AATATCTGTGATGGCACAGAGGG - Intronic
1014426928 6:121318608-121318630 CTTATTTATGATGACAGAGCTGG - Intronic
1015840632 6:137473277-137473299 AGTTTTTAAGATGAAAGAGATGG + Intergenic
1015963237 6:138671547-138671569 AGTCTCTAGGATGACAGTGAAGG + Intronic
1018109635 6:160522756-160522778 AGTAGCTAGGATTACAGATATGG - Intergenic
1019067421 6:169313869-169313891 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067439 6:169314041-169314063 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067454 6:169314173-169314195 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067494 6:169314533-169314555 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067529 6:169314814-169314836 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1019067546 6:169314945-169314967 AGTATCTGTGTGGACAGAGGTGG - Intergenic
1020232061 7:6326881-6326903 AGTATGTATGAACTCAGAGATGG - Intergenic
1020729313 7:11861960-11861982 CCTATCTTTGATGACATAGAGGG - Intergenic
1021471669 7:21009582-21009604 ATTTTATATGATGACAGATAAGG - Intergenic
1022297061 7:29066117-29066139 AGTATCTAGGTTGGGAGAGAGGG + Exonic
1024643940 7:51355814-51355836 AGTATCTATGATATGAGAGTGGG - Intergenic
1024736739 7:52313127-52313149 AGTAACCATGATGACAGATATGG - Intergenic
1025201267 7:56963238-56963260 AGAATCTAGAATGAGAGAGAGGG - Intergenic
1025670677 7:63613695-63613717 AGAATCTAGAATGAGAGAGAGGG + Intergenic
1026436694 7:70405327-70405349 TGAGTCTATGAAGACAGAGATGG - Intronic
1028348923 7:89819226-89819248 AGGATCTATGATGTAGGAGAAGG - Intergenic
1030157980 7:106476253-106476275 AGTAGCTATGGTGGCAGAGTTGG + Intergenic
1030360570 7:108590940-108590962 AGTAACAATGATGACAGATGTGG + Intergenic
1030780023 7:113589106-113589128 AGTAACTGTGATGAGAGAGGAGG + Intergenic
1031323573 7:120364268-120364290 AGTATGGTTGATGACACAGAGGG - Intronic
1032158681 7:129492607-129492629 ACTACTAATGATGACAGAGAGGG - Intergenic
1032496938 7:132369584-132369606 ACCATCTGTGTTGACAGAGAAGG + Intronic
1036163582 8:6410509-6410531 AGTAAATCTGATAACAGAGATGG - Intronic
1038232609 8:25717254-25717276 AGTATTTATTGTTACAGAGAGGG + Intergenic
1039545508 8:38407987-38408009 AGAATCTATGAAGACACAGATGG + Intronic
1043323608 8:79022145-79022167 AGTATCTATGTTTACAGCAAAGG + Intergenic
1043833940 8:85023721-85023743 AGTTTCTTAGAGGACAGAGACGG + Intergenic
1045311979 8:101010687-101010709 AAGCTCTATGAGGACAGAGACGG - Intergenic
1046232550 8:111376009-111376031 AATATCTATTTTGACAGGGACGG + Intergenic
1046721313 8:117622103-117622125 AGTATGAAAGATAACAGAGATGG + Intergenic
1046847948 8:118939638-118939660 AATAACTATGAAGAAAGAGAAGG + Intronic
1047680366 8:127248342-127248364 AGTATCTATGACCTCAGAGAAGG + Intergenic
1048314129 8:133349734-133349756 AGTATCAAGGTTGACAGAGGTGG + Intergenic
1050030612 9:1381614-1381636 AGTATCCATGATGACAGGGGTGG + Intergenic
1050890718 9:10820798-10820820 AGTTGATCTGATGACAGAGATGG + Intergenic
1051702754 9:19841892-19841914 AGTGTCTATGGTGGCAGGGATGG + Intergenic
1051808166 9:21020221-21020243 AGTGTTTATTATGACACAGAGGG + Intronic
1052141127 9:24985735-24985757 AGTTTCTATGATCTCAGAGCAGG + Intergenic
1052636472 9:31112490-31112512 AGTGTCAATGCTGACAGAGTTGG + Intergenic
1055075584 9:72212007-72212029 AAAATCTCTTATGACAGAGATGG + Intronic
1055157574 9:73082885-73082907 AGTATATATTAAGACATAGAAGG - Intergenic
1057465516 9:95310748-95310770 AGGGTCTGTTATGACAGAGAAGG + Intronic
1060503805 9:124182770-124182792 TGTATCTATAATGGCAGAGCTGG - Intergenic
1061130648 9:128706039-128706061 AGTCTCTAGTGTGACAGAGAAGG + Intronic
1061287142 9:129630477-129630499 AGCAACTATGAGGAAAGAGAAGG - Intronic
1186360145 X:8832564-8832586 AATGTCTATGGTGACAGAGTGGG + Intergenic
1186653540 X:11588142-11588164 AGAATGTCTAATGACAGAGATGG - Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187582208 X:20620199-20620221 AATATCTATGATGTAAAAGAAGG + Intergenic
1190398278 X:50006660-50006682 AGTATCAAGGATTAAAGAGAAGG - Intronic
1191923433 X:66281651-66281673 TGTATAAATGAGGACAGAGAAGG + Intergenic
1192661461 X:73046954-73046976 AGTGGCTATGGTGACAGGGATGG - Intergenic
1192868554 X:75162805-75162827 AGTATTAATAATTACAGAGAAGG + Intergenic
1196484850 X:116194385-116194407 ATTATCTATGGTGAAAGACAGGG - Intergenic
1196837831 X:119829650-119829672 TGTATCTACAAAGACAGAGAAGG - Intergenic
1198510261 X:137343364-137343386 AGACTCTTTGATGACAGAGGAGG - Intergenic
1198809915 X:140524707-140524729 AGTATGTATGAGGACAGGGGAGG + Intergenic
1199200159 X:145077888-145077910 GGCATCTATGGTGACAGTGAGGG - Intergenic
1199341559 X:146683670-146683692 TTTATATATGATGACAGATAAGG + Intergenic
1200976717 Y:9219264-9219286 AGCGTCTATGATGGCAGGGATGG + Intergenic