ID: 1006256444

View in Genome Browser
Species Human (GRCh38)
Location 6:32836251-32836273
Sequence CTGGGGCTCCAGAGAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006256444_1006256451 13 Left 1006256444 6:32836251-32836273 CCCACAATTCTCTGGAGCCCCAG 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1006256451 6:32836287-32836309 CCATCTTTCATCCTTCGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006256444 Original CRISPR CTGGGGCTCCAGAGAATTGT GGG (reversed) Intronic
900296870 1:1956300-1956322 CTGGGGCTTCAGAGATGCGTCGG + Intronic
901402122 1:9021741-9021763 CTGGGAGTCCAGAGAAGGGTGGG - Intronic
904288415 1:29468546-29468568 CTTGGGCTCCTGAGAATTCTGGG + Intergenic
907717325 1:56939269-56939291 CAGGGGCTCCTGAGAAATCTGGG - Intronic
908316454 1:62937482-62937504 CTGGGGCTCCAGGACAATGTTGG - Intergenic
909412819 1:75374369-75374391 GTAGGTCTCCAGGGAATTGTGGG + Intronic
909499591 1:76319174-76319196 CTGGGGCTACAGAGGATTTCTGG + Intronic
914986157 1:152458929-152458951 CTGAAGCTCCAGAGTATAGTTGG + Intergenic
915631301 1:157155504-157155526 CTGTGGCTCCAGAGAAGAGTGGG + Intergenic
915636096 1:157187990-157188012 CTGGGGCTCCAGACATTGGTGGG - Intergenic
918303627 1:183226735-183226757 CTGGGGCTCCAGAGACAGGGCGG - Exonic
919105495 1:193145725-193145747 TTGCTGCTCCAGAGAATTATAGG + Intronic
919575380 1:199302380-199302402 CTGGAGATTCAGGGAATTGTAGG + Intergenic
919724472 1:200873044-200873066 CTGGGGCTCCAGGGCTCTGTGGG - Exonic
920080419 1:203368902-203368924 TTGGGGCTCCAGAGTCCTGTTGG + Intergenic
922760614 1:228127787-228127809 ATGGGACTCCAGCGAATTGTAGG + Intergenic
923063373 1:230497149-230497171 AGGGGGCTCCAAAGAATTGCAGG - Intergenic
924912015 1:248523308-248523330 CTTTGGTTCCACAGAATTGTGGG + Intergenic
1063454491 10:6173653-6173675 CTGGGTCTCCAGAGATCTGGGGG + Intronic
1065128482 10:22596900-22596922 CCTGGGCTCCAGAGTATGGTGGG + Intronic
1070549596 10:77480683-77480705 CTGTGGCTCCAGAGTCTTGGAGG - Intronic
1074798371 10:116972746-116972768 CTTGAGCTACAGAGAATCGTTGG - Intronic
1076063192 10:127429173-127429195 CTGGTGCTACAGAGAAGGGTGGG - Intronic
1076068774 10:127469484-127469506 CTGTGGCCCCAGTGAATTATGGG + Intergenic
1076223646 10:128756097-128756119 CTGGTGCTGGAGAGAATTGCGGG - Intergenic
1076686012 10:132198789-132198811 CTGGGGCTCCAGACCAGTGTGGG - Intronic
1078509338 11:11973989-11974011 CTGGGATTCCTGAGAAGTGTGGG - Intronic
1079574855 11:21990640-21990662 TTGTGGCTTCAGACAATTGTTGG + Intergenic
1081688051 11:45056452-45056474 CTGGGGGTCCACAGAAGTCTGGG - Intergenic
1082889691 11:58125677-58125699 CTGGGACTCCAGAGAATAGCCGG + Intronic
1083276691 11:61600888-61600910 CTGGGGCTTCAGAAGCTTGTAGG + Intergenic
1084929029 11:72538991-72539013 CTGAGGCTTCAGAGAAATGCTGG + Intergenic
1086171359 11:83840133-83840155 CTGGGGATTCAGAGAAGTGATGG - Intronic
1087632144 11:100662286-100662308 CTGGGGAATCAGAGAATTATGGG + Intergenic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1089208174 11:116782101-116782123 CTGGGGCTCCAGTGAACAGGAGG - Intronic
1090362207 11:126181567-126181589 CTAGGGCTGGAGAGAATTGGGGG + Intergenic
1090420535 11:126572254-126572276 CTTGGCCTCAAGAGAACTGTAGG - Intronic
1091101779 11:132881292-132881314 CTGGGGTTCCAGATACTTATTGG + Intronic
1096503297 12:52078559-52078581 CTGGGGCATCAGAGAGTTGGAGG + Intergenic
1099357488 12:81657205-81657227 CTGGGTCTCCAGAAGATTGGCGG - Intronic
1106099329 13:26681098-26681120 CTGGGGGTGCAGAGAATGGTTGG - Exonic
1106577877 13:30992716-30992738 ATGTGGCTCCAGAGAAATGAGGG + Intergenic
1106924727 13:34601734-34601756 ATAGGGCTGTAGAGAATTGTGGG + Intergenic
1108160564 13:47633837-47633859 CTGGTACTCCAGTCAATTGTGGG - Intergenic
1108585652 13:51867583-51867605 CTGAGGCTTCAGAAGATTGTGGG + Intergenic
1109816995 13:67597820-67597842 CTGGGGCTCCAGACATGTGAAGG + Intergenic
1115190944 14:30746555-30746577 CCCGGGCTCAACAGAATTGTAGG + Intergenic
1115257165 14:31415396-31415418 GTGCTGCTCCAGACAATTGTGGG - Intronic
1117819020 14:59629441-59629463 CTGCTGCTCCAGAGTATTCTTGG + Intronic
1121494681 14:94383974-94383996 CTGGGACCACAGAGCATTGTGGG - Intronic
1122270072 14:100565038-100565060 CTGGGACCCCAGAGCATTGTGGG + Intronic
1124722114 15:32119457-32119479 CTGTGGCTGGAGAGAATTGGTGG + Intronic
1126284431 15:46995428-46995450 CAGGTACTCCAGTGAATTGTAGG + Intergenic
1128494926 15:68192190-68192212 CTGGAGCTCAAAAGAACTGTGGG + Exonic
1131902872 15:97107916-97107938 CAGGGACTCCAGTCAATTGTAGG - Intergenic
1133007964 16:2895115-2895137 CTGGGGCTCCAGGCCAGTGTGGG - Intronic
1133746459 16:8690750-8690772 CTGGGTTTCTATAGAATTGTGGG + Intronic
1136010949 16:27363193-27363215 CTGTGTCCCCAGAGAAATGTGGG + Exonic
1136988407 16:35135268-35135290 CTGGGTGTCCAGAGGCTTGTGGG + Intergenic
1139955437 16:70690869-70690891 CTGGGGGTCCAGGGCATTGAAGG + Intronic
1140116168 16:72043380-72043402 CTGAGGCTGCAAAGAATTGAAGG - Intergenic
1140213229 16:72987083-72987105 CTGAGGCTGCAGTGAGTTGTGGG + Intronic
1142266154 16:89064824-89064846 CTGGGGCTGCAGGGATTTGCCGG + Intergenic
1144181485 17:12756473-12756495 CTTGGGCTCCAGAGAAGGGCGGG - Exonic
1145269716 17:21398311-21398333 CTCGGGTACCAGAGAAGTGTGGG - Intronic
1145921771 17:28615000-28615022 CTCAGGCTCCAGGGACTTGTGGG - Exonic
1146262427 17:31430784-31430806 GTGGGGCTCCTGAGAGGTGTGGG + Intronic
1147121392 17:38337321-38337343 CTGGGGCTCCAGGGACAAGTGGG + Intronic
1148349931 17:46933847-46933869 CTCAGGCTCCAGAGAGTAGTTGG - Intronic
1148578900 17:48729493-48729515 CAGGGCCTCCAGAGCATTCTGGG - Intergenic
1148587590 17:48791794-48791816 CTGGGGCTCTGGAGACTTGGAGG - Intronic
1149440722 17:56671535-56671557 CTGTGGTTCCAGAGACTGGTAGG + Intergenic
1150503941 17:65679680-65679702 CTGTGACTCCATAGATTTGTTGG + Intronic
1150730219 17:67686217-67686239 CTGGGGGTCCTGTGCATTGTAGG + Intronic
1151382254 17:73734002-73734024 CTGGGGCTCCAGGCAATCCTTGG + Intergenic
1151489602 17:74424968-74424990 CTGGGGCCCCAGGTAATGGTGGG - Intronic
1155176475 18:23305717-23305739 CTGGCGCTCCTGAGAAAGGTTGG + Intronic
1155317911 18:24590708-24590730 CTGGGGAACCTGAGAACTGTGGG + Intergenic
1156288425 18:35722236-35722258 GTGGGCCTCCAGAGAGCTGTGGG + Intergenic
1156294154 18:35774698-35774720 CTGGGGCTCCTGGGGAGTGTAGG - Intergenic
1156717579 18:40029520-40029542 CTGAGCCTCCACAGAATAGTGGG + Intergenic
1158498613 18:57979709-57979731 CCTGGGCTCAAGAGATTTGTCGG + Intergenic
1158935204 18:62358149-62358171 CTGGGACTCCAGAGGACTGGAGG - Intronic
1159109780 18:64043005-64043027 CTGGGGCTGCACAGGCTTGTGGG + Intergenic
1160078830 18:75703886-75703908 CTGGGGGTGCAGAGAGCTGTGGG + Intergenic
1161874982 19:6901395-6901417 CTGGGCCTCAAGAGACCTGTTGG - Intronic
1162027107 19:7900642-7900664 CAGGGCCTCCAGGGCATTGTAGG - Exonic
1162264224 19:9557793-9557815 CTGGGGCTCCAGTTATGTGTGGG + Intergenic
1163035850 19:14568405-14568427 CTGGGGCTCAAGCGAGGTGTGGG - Intronic
1164484565 19:28643726-28643748 CTGGAGCTCCAGGGAGTTCTGGG - Intergenic
1164878795 19:31713581-31713603 CTGTGCCTCCAGAGCATTGCTGG - Intergenic
1165354286 19:35294029-35294051 CTGGGGTGTCAGAGAACTGTGGG - Intronic
1165429996 19:35767094-35767116 CTGGGTCCCCAGAGAACTGAGGG - Intronic
1166879704 19:45920344-45920366 CTGGGGGTCCAGAGACGAGTGGG + Intergenic
1167509680 19:49889493-49889515 GTGGGGCTCCAGAGGAGGGTGGG - Intergenic
1167635351 19:50651224-50651246 TTGGGGCTCAAGGGAATTCTGGG + Intronic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
925579283 2:5394358-5394380 TTGGGACTCCAGTGAATTATTGG - Intergenic
927450596 2:23206276-23206298 GAGGGGCTCAAGAGAATTGAGGG - Intergenic
927941206 2:27104013-27104035 CTGTGGCGCCAGAGAAGTGGGGG - Intronic
931219798 2:60278603-60278625 CTTGGGCTCCAAATATTTGTTGG + Intergenic
932471564 2:71962716-71962738 CTGGGGGGCCAGAGAACTGTGGG - Intergenic
933477491 2:82809843-82809865 TTGTGGGTCCAGAGAATTGTGGG + Intergenic
934157481 2:89216933-89216955 CTGGGAGACCACAGAATTGTAGG - Intergenic
934209839 2:89965810-89965832 CTGGGAGACCACAGAATTGTAGG + Intergenic
937087152 2:119179030-119179052 CTGAGGCTCCAGAGAGATGTTGG + Intergenic
937370422 2:121293715-121293737 CTGCGGCTCCAGAGACATGGAGG + Intergenic
937931661 2:127209879-127209901 CTGGTGCTCCAGTCGATTGTAGG - Intronic
939805564 2:146771940-146771962 CTGAAGCACCAGAAAATTGTGGG + Intergenic
942594465 2:177579942-177579964 ATGTGGCCCCAGAGCATTGTGGG + Intergenic
943528402 2:189047729-189047751 CTGGGGCTTCAGAGAAAGTTGGG + Intronic
944281367 2:197902127-197902149 CTGTGGCTCCAGAGACTGTTGGG + Intronic
945196039 2:207238448-207238470 CTTGGACCCCAGAGTATTGTAGG - Intergenic
1170572823 20:17642047-17642069 CTGGGACTCCAGATACTTGTGGG + Intronic
1170609117 20:17897327-17897349 GTGGGGTTCTAGAGATTTGTGGG - Intergenic
1172817572 20:37700049-37700071 CCGGGGCTCCAGAGATTTCAAGG + Intronic
1174714036 20:52737772-52737794 CAGGGGCTCCAGAGAGGTATGGG - Intergenic
1175177357 20:57120276-57120298 CTGGGACTCCACAGAACTGGCGG + Intergenic
1175308185 20:57992391-57992413 ATGGGGCTCCAGAGAGGTGTCGG + Intergenic
1175330743 20:58162133-58162155 CTGGGGCTTCTGAGATTTGGGGG - Intergenic
1175757377 20:61538332-61538354 CTGGTGCACCAGAGATTGGTAGG + Intronic
1177800903 21:25827659-25827681 CTGGGACTCCTCAGAATTATAGG + Intergenic
1178744068 21:35230742-35230764 ATGAGACTCCAGATAATTGTCGG + Intronic
1179157053 21:38859741-38859763 GTGGGGCTCCAGTGAAGGGTGGG + Intergenic
1180014101 21:45071863-45071885 CTGGGTCTCCACAGAAGTGCTGG - Intergenic
1181790612 22:25262891-25262913 CTGGGGCCCCAGAGGAGTGAGGG + Intergenic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1182260333 22:29069495-29069517 CTGGGCCTCCAGAAAGATGTTGG - Intergenic
1182814913 22:33153717-33153739 AGTGGGCTACAGAGAATTGTTGG - Intergenic
1184115199 22:42418047-42418069 CTGGAGCTGCAGAGAAGTGAGGG - Intronic
1184147030 22:42617753-42617775 CTGGTGCTCCGGAGACTTGCTGG - Intergenic
1184785633 22:46670385-46670407 GAGGGGCTCCAGGGCATTGTCGG - Intronic
949887045 3:8703904-8703926 CTGAGGCTCCAGAAAGTTCTGGG + Intronic
950437024 3:12986283-12986305 CTGGGGCTCCAGGGAACTCTAGG - Intronic
951564055 3:23994915-23994937 CTGAGGCTGCAGATAATTGAAGG - Intergenic
952624997 3:35392997-35393019 GTGGGCCTCCAGTTAATTGTGGG - Intergenic
953413436 3:42702528-42702550 CTGGGGCTCTTGAGACTTGTGGG - Intronic
954932609 3:54297168-54297190 CTGGGGCTACAGGGAATGGCAGG - Intronic
955920904 3:63954546-63954568 GTGGTGCCCCAGAGAATTGATGG + Intronic
958268630 3:91470381-91470403 GTGGGGACCCAGAGAATGGTTGG - Intergenic
963294925 3:143535993-143536015 TTGGGGCGCCAAATAATTGTAGG + Intronic
964731192 3:159867001-159867023 CTGGGGCTTCATAGAAATGGAGG - Intronic
966233200 3:177671688-177671710 CTGGGAATCCAGAGAACTTTGGG - Intergenic
967156793 3:186700281-186700303 CTGGTTCTCCTGAGAATTTTTGG + Intergenic
967594368 3:191312809-191312831 CTGGGGCTATAGAGAATAGGTGG + Intronic
985060906 4:186077810-186077832 CTGGTGCTCTAAAGCATTGTAGG - Intronic
986034904 5:3927938-3927960 TTGGAGCTCCAGAGAAGAGTCGG - Intergenic
987861991 5:23500631-23500653 CTGGGGCTTCACAGAACAGTGGG + Intergenic
988590614 5:32545648-32545670 CTGTGGCTCCAGATAAGCGTGGG + Intronic
992660561 5:78956346-78956368 CTGGGGCTGTAGGAAATTGTGGG + Intronic
997348246 5:133209640-133209662 CTTGGGCTCCAGAGATCCGTGGG - Intronic
997412746 5:133702613-133702635 CTGGGGCTCCAGGGAAACCTTGG + Intergenic
1000124127 5:158226896-158226918 CTGGGTCTCCCGAGTAATGTGGG - Intergenic
1000639616 5:163686057-163686079 CTGGTGCTACTGTGAATTGTGGG + Intergenic
1002454717 5:179339443-179339465 CTGGGGGTCCTGAGGAGTGTTGG - Intronic
1003384629 6:5655756-5655778 CTCAGGTTCCAGAGAATTGGAGG + Intronic
1004879261 6:19990324-19990346 TTTGGGCTCCAGAGAATAGGAGG - Intergenic
1006256444 6:32836251-32836273 CTGGGGCTCCAGAGAATTGTGGG - Intronic
1006515167 6:34541623-34541645 CAGGGGCTGGAGAGAATGGTGGG - Intronic
1011109266 6:83818927-83818949 GTGGGGCAGCAGAGGATTGTTGG + Intergenic
1014499871 6:122173467-122173489 CTGGGGCTGTAGAGAATTGTGGG - Intergenic
1014841307 6:126223782-126223804 CAGGGACTCCAAAGAGTTGTAGG + Intergenic
1016085248 6:139905453-139905475 CTGGGGCCTCAGTGAATTCTAGG + Intergenic
1017016214 6:150101628-150101650 CTGGGGCTCCACAAACATGTTGG + Intergenic
1018915643 6:168130874-168130896 CTGGGGCAGCAGGGAATTGGCGG + Intergenic
1019274076 7:166770-166792 CTGTGGCTCCAGAAAATTCCTGG + Intergenic
1022511258 7:30936129-30936151 CTGAGGCACCAGTGATTTGTTGG - Intergenic
1022517932 7:30987588-30987610 CTGAGGCACCAGGGACTTGTAGG + Intronic
1024208306 7:47182612-47182634 CTGGGGTTCCAGTGAGTCGTGGG - Intergenic
1026141624 7:67711844-67711866 CCGGAGCTCCAGTGAAGTGTAGG + Intergenic
1027578934 7:79968323-79968345 CTGGGGCTGCAGACATTTGAAGG - Intergenic
1032007935 7:128319049-128319071 CTGGGGCACCAAAGTATGGTAGG + Intronic
1033677458 7:143556876-143556898 CTGGGGCTCAAGAGAAGTGCAGG - Intergenic
1033694376 7:143772560-143772582 CTGGGGCTCAAGAGAAGTGCAGG + Intergenic
1035757070 8:2042610-2042632 CTGGGGTTCCACAGGATTGAAGG + Intergenic
1036226293 8:6960547-6960569 CTGGGGCTCCAGACAGTGGCAGG - Intergenic
1041988364 8:63954420-63954442 CTGGGGCTCCAGGGTGTCGTGGG - Intergenic
1047248989 8:123167375-123167397 CTGGGGCCCCAAGGAACTGTGGG + Intergenic
1048049742 8:130805942-130805964 CTGGACCTCGAGACAATTGTGGG - Intronic
1053420194 9:37972445-37972467 CTGGGGCTCCAGAAAGGTGATGG + Intronic
1057124902 9:92609373-92609395 CTGCTGCTCCAGAGACTTGCCGG - Intronic
1060486963 9:124054065-124054087 CTGGGGCCCCAGAGAACTCTGGG - Intergenic
1188739817 X:33764277-33764299 CTGAGGCACAAGAGAAGTGTGGG - Intergenic
1191012817 X:55778456-55778478 CTGGAGCTCCAAAGCACTGTGGG - Intergenic
1192546267 X:72017453-72017475 CAGGTGCTCCAGCAAATTGTAGG + Intergenic
1194122888 X:89981143-89981165 GTGGGGCTGCAGAGAATACTAGG + Intergenic
1194923420 X:99795590-99795612 CTGTGACTCTAGAGAATTCTGGG + Intergenic
1196607149 X:117670326-117670348 CTGGTACTCCAGTCAATTGTAGG + Intergenic
1199975562 X:152893230-152893252 CTGGGGCCCCAGAGAGGTCTGGG + Intergenic
1200066792 X:153507812-153507834 CGGTGGCTCCAGAGAGTTGGAGG + Intronic
1200475748 Y:3638581-3638603 GTGGGGCTGCAGAGAATACTAGG + Intergenic