ID: 1006257938

View in Genome Browser
Species Human (GRCh38)
Location 6:32845804-32845826
Sequence AGGGTAGTCCCCGGCTCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006257938_1006257948 11 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257948 6:32845838-32845860 GACACCTGTGTTTCCAGGGCTGG 0: 1
1: 1
2: 3
3: 30
4: 222
1006257938_1006257952 26 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257952 6:32845853-32845875 AGGGCTGGGACTGACCTCACAGG 0: 1
1: 0
2: 1
3: 22
4: 259
1006257938_1006257947 7 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257947 6:32845834-32845856 GGGAGACACCTGTGTTTCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 227
1006257938_1006257949 12 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257949 6:32845839-32845861 ACACCTGTGTTTCCAGGGCTGGG 0: 1
1: 1
2: 3
3: 39
4: 461
1006257938_1006257946 6 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257946 6:32845833-32845855 AGGGAGACACCTGTGTTTCCAGG 0: 1
1: 0
2: 3
3: 28
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006257938 Original CRISPR AGGGTAGTCCCCGGCTCTGA CGG (reversed) Intronic
904738246 1:32651420-32651442 AGTGCAGTCCCCGGTACTGAAGG + Intronic
906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG + Intergenic
906696173 1:47824869-47824891 AGGGTGCTGCCTGGCTCTGAGGG - Intronic
906858270 1:49331367-49331389 AGGGTAGTGCCTGCCTCAGAAGG + Intronic
911019880 1:93375548-93375570 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
915977647 1:160401133-160401155 AGGAAAGTCCCCGGCTCTCCAGG - Intronic
917226381 1:172788366-172788388 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1063503880 10:6579591-6579613 AGGTTATTCCCCAGCTTTGAGGG - Intronic
1071026548 10:81120991-81121013 AGGCTAGTCCACTGCTCTGTTGG + Intergenic
1072262542 10:93694309-93694331 AGGGTTGTGCCCGGCTCAGCAGG + Intronic
1072898540 10:99387896-99387918 AGTGGAGTCCCCGTCTGTGAAGG - Exonic
1074183398 10:111082104-111082126 AGGGAAGACCATGGCTCTGAGGG + Intergenic
1076094637 10:127721104-127721126 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1077613841 11:3661151-3661173 AGAGTAGACCCTGGCTCTGATGG + Intronic
1077835517 11:5923607-5923629 AGGGGAGCCCCCTGCCCTGAAGG + Intronic
1079324293 11:19478293-19478315 AGGGGAGTCCCAGTCACTGAGGG + Intronic
1079530526 11:21447160-21447182 AGGGGAGCCCACTGCTCTGAAGG - Intronic
1082079434 11:48000684-48000706 AGGATAGTACCAGGCCCTGAGGG - Intronic
1090878595 11:130813688-130813710 AGGGCAGGCCCTGGTTCTGAAGG + Intergenic
1092501108 12:9049117-9049139 AGAGTAGGTCCCTGCTCTGAAGG - Intergenic
1096970250 12:55659767-55659789 AGGGGAGGCCCTGGCACTGAGGG + Intergenic
1104284871 12:127415830-127415852 AGGGAAGACCCAGGCTCTGGGGG + Intergenic
1104475744 12:129069072-129069094 AGGGTAGGGCGAGGCTCTGAGGG + Intergenic
1105585118 13:21736591-21736613 AGGGCAGTGCCCGCCACTGAGGG + Intergenic
1108355865 13:49628356-49628378 AGAGAGGTCCCCGGCTCTGCAGG - Exonic
1108684219 13:52804773-52804795 AGTGTCTTCCCTGGCTCTGATGG + Intergenic
1109211223 13:59538104-59538126 AGGGGAGCCCACAGCTCTGAAGG - Intergenic
1111463934 13:88582798-88582820 AGGGTGTTTCTCGGCTCTGATGG + Intergenic
1116354853 14:43914928-43914950 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1116793685 14:49366611-49366633 AAGATAGTCCCAGGCTCTGTGGG + Intergenic
1117742202 14:58830424-58830446 GATGTAGTCCCCTGCTCTGAAGG + Intergenic
1121845424 14:97168352-97168374 AGGGGGATCCCCTGCTCTGAAGG - Intergenic
1125831492 15:42719913-42719935 ACTGCAGTCCCCGGCTCTGCTGG - Exonic
1129642424 15:77393885-77393907 AGGGGAGCCCACTGCTCTGAAGG + Intronic
1131950145 15:97673131-97673153 AGGGGAGTCCACTGCACTGAAGG - Intergenic
1133418523 16:5625311-5625333 AGGGTGGTCCCCAGCTGTCAGGG + Intergenic
1134407008 16:13969680-13969702 AGGGAAGCCCACTGCTCTGAAGG - Intergenic
1140646605 16:77038244-77038266 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1141472004 16:84245161-84245183 AGGATAGTCCTCGCCTCTCAGGG + Intergenic
1141533294 16:84661499-84661521 AGGCTGTTCCCCGGCTCGGAGGG + Intronic
1145817496 17:27805979-27806001 GGGGTAGTCCCAGGGTGTGATGG + Intronic
1147256857 17:39186698-39186720 ATGGTTGTCCCTGGCCCTGAGGG - Intronic
1149231296 17:54537219-54537241 AGGGGAGTCCACTGCCCTGAAGG + Intergenic
1150158786 17:62876208-62876230 AGGGCAGGCCCAGGCTGTGAAGG - Intergenic
1151897436 17:76989912-76989934 AGGGTGGTCCCCAGCTTTAAGGG - Intergenic
1154491499 18:14925596-14925618 AGGGTTGTGGCCAGCTCTGAGGG + Intergenic
1160986673 19:1842328-1842350 GGGGTTGTCCCCAGCACTGAAGG + Intronic
1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG + Intronic
1164574330 19:29396897-29396919 AGGGGAGTGCCCTGCCCTGAGGG + Intergenic
1165496021 19:36152266-36152288 CGGGGAGTCCCAGGCCCTGAAGG + Intronic
1168011223 19:53534743-53534765 AGGGTAATCTCCGTATCTGAAGG + Intronic
937333707 2:121047590-121047612 ATGGTGGTCTCTGGCTCTGATGG + Intergenic
940443926 2:153754089-153754111 AGTGTAGTCCACTGCCCTGAAGG - Intergenic
944616374 2:201464981-201465003 AGGGTAGCCCACTGCCCTGAAGG - Intronic
945551772 2:211229349-211229371 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
946203518 2:218086298-218086320 AGAGAATTCCCCAGCTCTGATGG + Intronic
1178673360 21:34611910-34611932 AAGGGAGTCCCAGTCTCTGAGGG - Intronic
1179373060 21:40824782-40824804 AGGGAAGTCCCCGGGTGTGGAGG - Intronic
952132785 3:30384291-30384313 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
952203106 3:31151523-31151545 AGGGGAGTGCACTGCTCTGAAGG - Intergenic
952992853 3:38846974-38846996 AGGGTACTCGGTGGCTCTGATGG - Exonic
954374861 3:50188848-50188870 ACGGGAGGCCCCAGCTCTGAGGG + Exonic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
959913694 3:111793421-111793443 AGGGGAGTCCACTGCCCTGAAGG - Intronic
959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG + Intronic
963021064 3:140873506-140873528 AAGATAGTCCCCTGCCCTGACGG - Intergenic
963448071 3:145440259-145440281 AGGGTAGTCCACTGCCCTAAAGG + Intergenic
963765048 3:149325798-149325820 AGGGAAGTCCCTTGCCCTGAAGG - Intronic
964527789 3:157633284-157633306 AGGGTAGGGTCCGGGTCTGATGG + Intronic
975936079 4:79582528-79582550 AGGATGGTCCCAGGCTTTGATGG + Intergenic
977798013 4:101191856-101191878 ATGGCAGGCCCCGGCACTGAGGG + Intronic
980887209 4:138776099-138776121 AGGGTATTCCTCAGCTCTGCCGG - Intergenic
983421707 4:167526837-167526859 AGCGGAGTCCACTGCTCTGAAGG - Intergenic
989641863 5:43590520-43590542 AGGGCTGCCCCAGGCTCTGAGGG + Intergenic
990181153 5:53162305-53162327 AGGGTAGGGCCCTGATCTGATGG - Intergenic
990827962 5:59922965-59922987 AGGGTAGCCCACTGCTCTGAAGG + Intronic
992284983 5:75225917-75225939 AGGGGAGCCCACTGCTCTGAAGG + Intronic
992291401 5:75283520-75283542 AGGGTAGTCCACAGCCCTGAAGG + Intergenic
992746757 5:79827997-79828019 AGGGTAGGGCCCTGCTCTGTGGG - Intergenic
994869016 5:105319756-105319778 AGGTTAGTCTCCGGATCTCAGGG + Intergenic
997610946 5:135215333-135215355 GGAGAAGTCCCTGGCTCTGAGGG - Intronic
998716422 5:144889683-144889705 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
1001865397 5:175099768-175099790 AGGGTAGCACAGGGCTCTGAAGG - Intergenic
1003085028 6:3053913-3053935 AGGGTCCTCCCCAGCCCTGAAGG - Intergenic
1003247682 6:4398226-4398248 AGGGAAGACCCCAGCTCAGAGGG + Intergenic
1003870199 6:10396410-10396432 AGGGTAGTCAGCGGCTAAGACGG - Intronic
1004152699 6:13135256-13135278 AGGGCAGTCCTGGGATCTGAAGG + Intronic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1007023833 6:38549676-38549698 AGGGTGGTTCCCTACTCTGAAGG - Intronic
1011341000 6:86313992-86314014 AGGGGATTCCACAGCTCTGAAGG + Intergenic
1012098536 6:94998758-94998780 AGGGTAGTTCTCAGCTCTGCTGG + Intergenic
1012800480 6:103820591-103820613 AGGGAAGCCCACTGCTCTGAAGG + Intergenic
1015210580 6:130693413-130693435 AATGAAGTCCCAGGCTCTGAAGG + Intergenic
1017905567 6:158755568-158755590 AGGGCCGTCCCCTGCTCTGTTGG - Intronic
1018316588 6:162562455-162562477 TGGGAAGTCCACTGCTCTGAAGG + Intronic
1020394544 7:7699555-7699577 AGGGTGGTCCCTGGATGTGATGG + Intronic
1026840953 7:73669658-73669680 TGGGAAGTGCCAGGCTCTGATGG + Intronic
1033354164 7:140586027-140586049 ATGGCATTCCCCGGCTCTAAAGG + Intronic
1038871861 8:31503902-31503924 AGTGGAGTCCACTGCTCTGAAGG - Intergenic
1047536586 8:125725647-125725669 AGGGCAGTCCCTGGCTCTGAAGG - Intergenic
1050725295 9:8642672-8642694 AGGGTAGTAGCCTGGTCTGAAGG + Intronic
1052198305 9:25745202-25745224 AGGGTAGTCTTTGGCTCTGGAGG - Intergenic
1062344890 9:136110056-136110078 AGGGCAGCCCCCGCCTCCGAGGG + Intergenic
1062373504 9:136252115-136252137 AGGGTGGGCGCCGGCTCTGCGGG - Intergenic
1187612893 X:20961541-20961563 AGGGTAGCCCACTGCCCTGAAGG + Intergenic
1188068854 X:25695130-25695152 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
1189751772 X:44229980-44230002 AGCATAGGCCCCAGCTCTGAGGG + Intronic
1189868027 X:45351876-45351898 AGGGTAATCCTCTGCACTGAGGG + Intergenic
1190523037 X:51299303-51299325 AGGGCAGTCCACTGCCCTGAAGG + Intergenic
1190541213 X:51480706-51480728 AAGATAGTCCCCCGCTCCGACGG - Intergenic
1195021442 X:100832785-100832807 GGGGTGGTCCTCGGCTCTCATGG - Exonic
1195834869 X:109102819-109102841 AGGGGAGTCCACTGCCCTGAAGG - Intergenic
1195984534 X:110614850-110614872 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1197954843 X:131934990-131935012 ATTGTAGTCCCTGGCTCTCAGGG + Intergenic
1198537594 X:137601590-137601612 AGGGGAGCCCACTGCTCTGAAGG + Intergenic
1199439625 X:147853994-147854016 AGGGGAGCCCACTGCTCTGAAGG - Intergenic
1200003440 X:153073300-153073322 AGGGAAATCCCCGGCACTGGGGG + Exonic
1200004283 X:153076709-153076731 AGGGAAATCCCCGGCACTGGGGG - Intergenic
1200315891 X:155132847-155132869 AGGGGAGCCCCCTGCCCTGAAGG + Intronic