ID: 1006257938

View in Genome Browser
Species Human (GRCh38)
Location 6:32845804-32845826
Sequence AGGGTAGTCCCCGGCTCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006257938_1006257952 26 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257952 6:32845853-32845875 AGGGCTGGGACTGACCTCACAGG 0: 1
1: 0
2: 1
3: 22
4: 259
1006257938_1006257947 7 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257947 6:32845834-32845856 GGGAGACACCTGTGTTTCCAGGG 0: 1
1: 0
2: 0
3: 22
4: 227
1006257938_1006257946 6 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257946 6:32845833-32845855 AGGGAGACACCTGTGTTTCCAGG 0: 1
1: 0
2: 3
3: 28
4: 318
1006257938_1006257948 11 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257948 6:32845838-32845860 GACACCTGTGTTTCCAGGGCTGG 0: 1
1: 1
2: 3
3: 30
4: 222
1006257938_1006257949 12 Left 1006257938 6:32845804-32845826 CCGTCAGAGCCGGGGACTACCCT 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1006257949 6:32845839-32845861 ACACCTGTGTTTCCAGGGCTGGG 0: 1
1: 1
2: 3
3: 39
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006257938 Original CRISPR AGGGTAGTCCCCGGCTCTGA CGG (reversed) Intronic