ID: 1006258711

View in Genome Browser
Species Human (GRCh38)
Location 6:32851250-32851272
Sequence TGGGGTTCTAAGGAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006258705_1006258711 -2 Left 1006258705 6:32851229-32851251 CCAGGGTCAGGGGTGTCAACATG 0: 1
1: 0
2: 1
3: 13
4: 133
Right 1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG 0: 1
1: 0
2: 2
3: 28
4: 276
1006258704_1006258711 6 Left 1006258704 6:32851221-32851243 CCAGGATGCCAGGGTCAGGGGTG 0: 1
1: 0
2: 4
3: 43
4: 417
Right 1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG 0: 1
1: 0
2: 2
3: 28
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006258711 Original CRISPR TGGGGTTCTAAGGAGGCTGC AGG Intronic
900501384 1:3006590-3006612 TTGGCTTCTAAGGAGGCCTCAGG - Intergenic
900652304 1:3735690-3735712 AGGGGTTGGAGGGAGGCTGCTGG + Exonic
901628421 1:10636291-10636313 TGGGGGTCCTGGGAGGCTGCAGG + Intergenic
901959269 1:12811395-12811417 TGGGGTCCTGAGGATGGTGCAGG + Intergenic
901974524 1:12933525-12933547 TGGGGTCCTGAGGATGGTGCAGG + Intronic
902010648 1:13268242-13268264 TGGGGTCCTGAGGATGGTGCAGG - Intergenic
903193198 1:21668181-21668203 TGAGGCTCTCAGGAGGCTCCTGG - Intronic
904007887 1:27373381-27373403 AAGGGTTCTGAGGAGGCTGTGGG + Intronic
904236126 1:29118471-29118493 TGGGATTCTAAGGAGCCTTGAGG - Exonic
904411747 1:30328937-30328959 TGGGGTTCTGAGGTGGGCGCTGG - Intergenic
904889038 1:33764204-33764226 TGGGTCACAAAGGAGGCTGCTGG - Intronic
906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG + Intergenic
908720242 1:67117686-67117708 AGGGTTTCTAAGGATGATGCTGG + Intronic
909491027 1:76226599-76226621 TGTGGTTCTGAGGAGGCCTCAGG + Intronic
912333665 1:108843056-108843078 TGGGATTCTGATGTGGCTGCTGG - Intronic
913059556 1:115192575-115192597 TGGGGCCAGAAGGAGGCTGCTGG + Intergenic
913646517 1:120860911-120860933 TGGGTTTCTCAGATGGCTGCTGG - Intergenic
914080134 1:144401961-144401983 TGGGTTTCTCAGATGGCTGCTGG + Intergenic
914175039 1:145270496-145270518 TGGGTTTCTCAGATGGCTGCTGG + Intergenic
914529764 1:148511975-148511997 TGGGTTTCTCAGATGGCTGCTGG + Intergenic
915545871 1:156597403-156597425 AGGTGTTCTTAGGAGGCTGCTGG + Intronic
915733998 1:158073095-158073117 TGGGATTCTATGTTGGCTGCAGG + Intronic
916115892 1:161484836-161484858 TGGGGCTATAAGGATGCTGGTGG + Intergenic
916120153 1:161522449-161522471 TGGGGTTTTGAGGTGGCTGGGGG + Intronic
916129917 1:161604099-161604121 TGGGGTTTTGAGGTGGCTGGGGG + Intronic
916783483 1:168062261-168062283 TGGGGTACTTAGGAGACTTCAGG + Intronic
918011325 1:180589692-180589714 TGGGGTGCTAAGGAATCTCCTGG - Intergenic
919958153 1:202439212-202439234 TGGTGCTCCAACGAGGCTGCAGG - Intronic
921190014 1:212700201-212700223 TGGGGTCCTTCGGCGGCTGCCGG + Intergenic
922758609 1:228110018-228110040 TGGGAATCTAGGGAGGCTGAGGG + Intergenic
923084560 1:230693836-230693858 GGGCTTTCTAAAGAGGCTGCGGG + Exonic
923410202 1:233700595-233700617 TGGGGTAGAAAGGAGGCTGGGGG - Intergenic
923708300 1:236363777-236363799 TGGGCTTCTAGGGAGGCCTCAGG - Intronic
924847844 1:247790827-247790849 TGGGGACCTGAGGAGGCTCCAGG - Intergenic
1062823956 10:555473-555495 TGGGGTTCCAAGGAGATTGGGGG - Intronic
1063624896 10:7679817-7679839 TTGGCTTCTAAGGAGCCTCCAGG + Intergenic
1063707027 10:8440533-8440555 TGGGGTGGGAAGGAGGCAGCTGG - Intergenic
1064185590 10:13159144-13159166 TGGGGTTCTAAGGAGAGGCCTGG - Intergenic
1065162495 10:22937540-22937562 TGTGGTTCTTAGGAGTTTGCGGG + Intronic
1066375736 10:34856483-34856505 AGGGGTTCTTATGATGCTGCAGG - Intergenic
1066464717 10:35641659-35641681 GGGGGTTTGAAGGCGGCTGCAGG + Exonic
1066986606 10:42474241-42474263 TGAGGTTTTAAGGAGTATGCAGG + Intergenic
1067878775 10:50025992-50026014 TGGGGTTCTCATGAGAATGCTGG - Intergenic
1068132220 10:52909036-52909058 TTGGCTTCTAGGGAGGCTTCAGG + Intergenic
1069359616 10:67626581-67626603 TGTGGTTCTCAAGAGGCTTCAGG - Intronic
1069903782 10:71720501-71720523 TGGGCTCCTAAGCAGGCAGCTGG - Intronic
1071390982 10:85175108-85175130 TTGGCTTCTAAGGAGGCCTCAGG - Intergenic
1071491981 10:86142482-86142504 TGGTGTTCTAAGGAAGAGGCAGG - Intronic
1073327426 10:102650797-102650819 TGGGATGGAAAGGAGGCTGCTGG + Intronic
1073869531 10:107847224-107847246 TGGGGTTTTAAGGAGAGTGGAGG - Intergenic
1074951597 10:118342288-118342310 CGGGGTCCTAAGATGGCTGCTGG - Exonic
1074969663 10:118525709-118525731 TTGGCTTCTAAGGAGGCCTCAGG - Intergenic
1075016638 10:118914458-118914480 TGGGCTTCTGGGGAGGCTTCGGG + Intergenic
1075702921 10:124480956-124480978 GGGGGTTATAAGGAGGCTGCAGG + Intronic
1075844113 10:125531246-125531268 TGTGGTTCTAAGGCAGCTGGTGG - Intergenic
1075897398 10:126008943-126008965 TGGGGTTGCAGGGGGGCTGCTGG + Intronic
1076462036 10:130654426-130654448 TGGGGTTCTCAGGAGTCCTCAGG - Intergenic
1076818199 10:132924903-132924925 GGGGATTCTAGGGAGGTTGCTGG + Intronic
1077119243 11:899274-899296 TGGTGTTTGAAGGAGGCTGGAGG - Intronic
1079374019 11:19875918-19875940 GTGGGTTCTGAGGAGGCTGCAGG + Intronic
1079834085 11:25309121-25309143 TGGGCTTGTAAGGAGGCCTCAGG - Intergenic
1081552086 11:44122945-44122967 TGAAGTTCTAGGGAGTCTGCTGG + Intronic
1081938314 11:46919377-46919399 TGGGGCTGGAAGGAGGCTGAGGG - Intergenic
1083232825 11:61333762-61333784 TGGGGTACCCTGGAGGCTGCAGG - Intronic
1083889312 11:65588112-65588134 TGGGGATCAGAGGAGGCTTCTGG + Intronic
1084970918 11:72771673-72771695 TGGAGGTCCAGGGAGGCTGCTGG - Intronic
1085241807 11:75062721-75062743 TTGGCTTCTCGGGAGGCTGCAGG - Intergenic
1085703048 11:78762283-78762305 TGTGGTTCAAGGGAGGCTCCTGG - Intronic
1086774400 11:90812272-90812294 TTGGCTTCTAGGGAGGCTTCAGG + Intergenic
1089340122 11:117751678-117751700 TGGGTTACTGAGGAGGCTGTGGG - Intronic
1089456362 11:118628134-118628156 GGGGACTCTCAGGAGGCTGCAGG - Exonic
1089473002 11:118735924-118735946 TGGGCTACTCAGGAGGCTGAGGG - Intergenic
1089555245 11:119312422-119312444 TGGGGTTCTAGGGAGGATTGGGG + Exonic
1089709504 11:120305051-120305073 TGGGGTTCTAAAGAGGATCCTGG - Exonic
1089762727 11:120740247-120740269 TGGGGTTGTAGTTAGGCTGCTGG + Intronic
1092601613 12:10072257-10072279 TTGGCTTCTGAGGAGGCTTCAGG - Intronic
1092673197 12:10886319-10886341 TGGGGGACTGAGGAAGCTGCAGG + Intronic
1092940396 12:13402393-13402415 TGGGCTTCTAGGGAGGCCTCAGG - Intergenic
1094554170 12:31481860-31481882 AGGGGTTCCAAAGAGGCAGCAGG + Intronic
1095641815 12:44494591-44494613 TGGGCTTCTAGGGAGGCCTCAGG + Intergenic
1097104285 12:56611934-56611956 GGGACTTCTAAGGAGACTGCTGG + Exonic
1097606576 12:61762064-61762086 TAGGCTTCTGGGGAGGCTGCAGG - Intronic
1098611994 12:72470160-72470182 AGGGGCTCCAAAGAGGCTGCTGG - Intronic
1100437419 12:94584360-94584382 TCTGGTTCTGGGGAGGCTGCGGG - Intronic
1101073005 12:101096419-101096441 AGGAGTCCTGAGGAGGCTGCAGG - Intronic
1101888600 12:108691338-108691360 TGTGGTTATAAGGTGGCTTCTGG + Intronic
1105243614 13:18628714-18628736 TGGGGTTCTAACCAGGCAGCAGG - Intergenic
1106242408 13:27921929-27921951 CGGGGTTCTTAGGAGGCGGGAGG + Intronic
1106358723 13:29010359-29010381 TTTGGTTCCAAGGAGGCTGGAGG - Intronic
1106373336 13:29158878-29158900 TGGGCTTCTCTGGAGGCAGCTGG - Intronic
1111898433 13:94170421-94170443 TGAGGTTGTGAGGTGGCTGCTGG + Intronic
1114439137 14:22732219-22732241 TGGGGTTCTCAGATGGCTGCTGG - Intergenic
1114542645 14:23473351-23473373 TAGGGATCTAAGAAGGATGCTGG - Intronic
1114557274 14:23569228-23569250 TGGTGTCCTAAGGAGACTCCTGG - Exonic
1116290285 14:43026463-43026485 TCTGCTTCTGAGGAGGCTGCAGG - Intergenic
1118964152 14:70563791-70563813 TTGGCTTCTAGGGAGGCTTCAGG - Intergenic
1119705133 14:76778580-76778602 TGGGGTACTAAGCAGGCCTCTGG + Intronic
1121545268 14:94758526-94758548 AGGGGTTCTACGCAGGCTTCTGG - Intergenic
1122273896 14:100581371-100581393 TGAGGCTCTAAGGATGCTGCCGG + Intronic
1122413350 14:101537135-101537157 TGGGATTCTGTGGAGGGTGCTGG + Intergenic
1122764256 14:104054657-104054679 TGAGGCTCCAAGGAGGCAGCAGG + Intergenic
1123487686 15:20755918-20755940 TGGGGTTCTTACCAGGCAGCAGG + Intergenic
1123544178 15:21324976-21324998 TGGGGTTCTTACCAGGCAGCAGG + Intergenic
1123774516 15:23565792-23565814 TGGGCTTCTGAGGGAGCTGCAGG - Exonic
1125733721 15:41909228-41909250 TGGGGCTCTGCGGACGCTGCTGG - Intronic
1125744471 15:41989204-41989226 TGTGGTGCTGAGCAGGCTGCAGG + Intronic
1127151990 15:56085300-56085322 TGGGGGTAGAAGGAGGCTTCAGG + Intergenic
1128643381 15:69357144-69357166 TTGGCTTCTAGGGAGGCTGCAGG - Intronic
1128680220 15:69646152-69646174 TGGGGTTCCACGGAGAATGCAGG + Intergenic
1129233035 15:74207250-74207272 TGAGGTTCTGGGGATGCTGCTGG - Intronic
1129250399 15:74305614-74305636 TGGGGGTCTGAGGAGGTTGGGGG - Intronic
1129325996 15:74800577-74800599 TGGGGTTCTCTGGAGGTTCCTGG - Intronic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1130397561 15:83516533-83516555 TTGGGTTCTAGGGAGGCTTCGGG + Intronic
1131417805 15:92276078-92276100 TGAGTTACTAAGGAGGATGCCGG - Intergenic
1202952521 15_KI270727v1_random:52247-52269 TGGGGTTCTTACCAGGCAGCAGG + Intergenic
1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG + Intergenic
1134375411 16:13667694-13667716 TTGGCTTCTGAGGAGGCTTCAGG + Intergenic
1134863724 16:17585549-17585571 TCTGGTTCTAAGGAGGCCTCAGG + Intergenic
1135663269 16:24314988-24315010 TGGGTTCCTCAGGAGGCTCCTGG + Intronic
1138291756 16:55853965-55853987 TTGGGTCCTCAGGAGGCTGGTGG + Intronic
1138539343 16:57679093-57679115 TGGGGTTCCTAGGAGCCTCCAGG - Intronic
1138795860 16:59968222-59968244 TCGGCTTCTGAGGAGGCTTCAGG + Intergenic
1140404375 16:74698694-74698716 TGGCTTTCTGATGAGGCTGCTGG - Intronic
1141849917 16:86638050-86638072 TGGGGGTCAGGGGAGGCTGCTGG + Intergenic
1142121341 16:88388050-88388072 TGGGGTTGTAAAGAGACTCCAGG - Intergenic
1142699330 17:1649746-1649768 TGGGGGTCTCGGGAGGCCGCGGG - Exonic
1142934682 17:3318522-3318544 TGGGGTGTGAAGGAGGCTGGAGG - Intergenic
1143303045 17:5925132-5925154 TGGGGTTACAAGGAGGGAGCAGG + Intronic
1144032787 17:11337073-11337095 TGGGGTCCTAAGGAAGATGTAGG - Intronic
1144427912 17:15161761-15161783 TGGGATTCTTCGGAGACTGCTGG - Intergenic
1144661318 17:17072650-17072672 TGGGGAGCTGAGGAGGCTGGGGG + Intronic
1144872563 17:18380191-18380213 AGGTGCTCTATGGAGGCTGCAGG + Intronic
1145979321 17:29002537-29002559 CGGGCTTCCAAGGAGGCTGGAGG - Intronic
1147328791 17:39684265-39684287 TGGGGGGCTAAAGAGGATGCTGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149304556 17:55335342-55335364 TGTAGTTCTGGGGAGGCTGCAGG - Intergenic
1149369690 17:55980632-55980654 AAGGGTTCTCAGGAGGCTCCTGG + Intergenic
1149658997 17:58324717-58324739 TGGGGTTCTGAGCACGGTGCAGG + Intronic
1150292038 17:63987731-63987753 CGGGGTTCTGAGAAGGCTCCTGG - Intergenic
1151120581 17:71788582-71788604 TTGGCTTCTAAGGAGGCCTCAGG + Intergenic
1151187519 17:72374798-72374820 TGGGGTTTGGAGGAGGGTGCCGG - Intergenic
1151340552 17:73468069-73468091 TGGGGCTTTGAGGGGGCTGCTGG + Intronic
1151748693 17:76024831-76024853 AGGTGCTCTATGGAGGCTGCAGG - Intronic
1152012506 17:77727100-77727122 TCGGGGTCTAAGGAGTCTGCGGG + Intergenic
1153954029 18:10080920-10080942 TCGGCTTCTAAGGAGGCCACTGG - Intergenic
1154345547 18:13540895-13540917 TGGGGTTCTTTGGAGCCTGTGGG + Intronic
1154445331 18:14431171-14431193 TGGGGTTCTAACCAGGCAGCAGG + Intergenic
1156519773 18:37712448-37712470 TGAGTATCTAAGGAGGCTTCTGG - Intergenic
1157927390 18:51781150-51781172 TAGGGCTCTAAGGAAGCTGGTGG + Intergenic
1158014052 18:52763419-52763441 TGGGATTCAAAGGATGCTCCTGG - Intronic
1158572266 18:58606667-58606689 TGGGGCTCTGAGGAGCCTGAGGG - Intronic
1159244534 18:65788621-65788643 TGGTGTTTTCAGAAGGCTGCAGG - Intronic
1160887922 19:1360649-1360671 TGGGGAGCAAAGGAGGCAGCTGG + Exonic
1161015575 19:1981155-1981177 TGGGGTGCCCTGGAGGCTGCCGG + Exonic
1161405344 19:4088381-4088403 TGGGGCTCCAATGAAGCTGCAGG + Intergenic
1161725202 19:5924554-5924576 TGGGCTTCCCTGGAGGCTGCAGG - Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163585382 19:18160987-18161009 TGGGGTTGGGAGGAGGCTGGGGG + Intronic
1164575388 19:29402661-29402683 TGGGCTTCTGAGGGGTCTGCTGG - Intergenic
1164597486 19:29539792-29539814 TGGGAGTGTAAGCAGGCTGCCGG + Intronic
1165160066 19:33810883-33810905 TGGGATTCTAAGGCAGCAGCAGG + Intronic
1165906243 19:39196548-39196570 TGGGGACCTAAGGAGGGGGCTGG + Intergenic
1166736615 19:45089649-45089671 TGGGCTACTCAGGAGGCTGAGGG - Intronic
1166781763 19:45346832-45346854 TGGGATTCTAAGGAGGGTCTGGG - Intronic
1166781772 19:45346861-45346883 TGGGATTCTAAGGAGGATCTTGG - Intronic
1167780378 19:51594954-51594976 GGGGGTGCTCAGGAGGCTGTGGG + Intergenic
925009119 2:468512-468534 GGGCGGTCTTAGGAGGCTGCGGG + Intergenic
925070703 2:965055-965077 TGGGGGACTAAGGAGGATTCAGG - Intronic
926166025 2:10522538-10522560 GGGGGTGCTGAGGAGGCTGGCGG - Intergenic
926166034 2:10522574-10522596 GGGGGTGCTGAGGAGGCTGTGGG - Intergenic
926166054 2:10522645-10522667 TGGGGTGCTGAGGAGGCTGGAGG - Intergenic
926166081 2:10522744-10522766 TGGGGGGCTGAGGAGGCTGGGGG - Intergenic
927403759 2:22744357-22744379 TTGGTTGCTAAGGAAGCTGCAGG + Intergenic
929531299 2:42754688-42754710 TGGGGTTACTAGGAGGCAGCTGG + Exonic
929549291 2:42879342-42879364 TGCTGTTCTGAGGAGGATGCAGG + Intergenic
931410588 2:62026284-62026306 TTGGCTTCTAGGGAGGCTTCAGG + Intronic
932472265 2:71967723-71967745 TGGGTTTCTGGGGAGGCTTCAGG - Intergenic
933935231 2:87198557-87198579 CATGGCTCTAAGGAGGCTGCAGG - Intergenic
935349266 2:102139779-102139801 TGGGCTTCTGAGGAGGCCTCAGG - Intronic
936357918 2:111767342-111767364 CACGGCTCTAAGGAGGCTGCAGG + Intronic
936395286 2:112122380-112122402 TGGGGTTCAGTGGAGTCTGCTGG + Intergenic
936974383 2:118204660-118204682 GGGGGTTCCCAGGAGGCAGCAGG - Intergenic
940104600 2:150084088-150084110 TGGGGTTGTAAGGTGGCAGCAGG + Intergenic
941234395 2:162951681-162951703 TGGGGCATTAAGGAGGCTTCTGG + Intergenic
941261950 2:163307987-163308009 TGGGCTTCTGGGGAGGCTTCAGG - Intergenic
942483618 2:176416286-176416308 TGAGGTTCTAAAGAGGCTATGGG - Intergenic
943029363 2:182668237-182668259 AGGGGTTCTGAGAAGGATGCTGG + Intergenic
945199761 2:207269626-207269648 TGGGGCTCAAAGGAGTCTGGAGG - Intergenic
947812064 2:233010926-233010948 TGGTGTCTTCAGGAGGCTGCTGG - Intronic
948899073 2:240947024-240947046 TGGGTTTCTGCAGAGGCTGCAGG - Intronic
1169467237 20:5852086-5852108 TAGGCTTCTAAGGAGGCCTCAGG - Intronic
1171048744 20:21836086-21836108 TGGTGTGGTAAGGAGGCTGATGG + Intergenic
1174444529 20:50581641-50581663 TGGGGTTTTAAGGAGCCCTCTGG + Intronic
1176299040 21:5090025-5090047 TGGGGGTATGAGGGGGCTGCCGG - Intergenic
1176450655 21:6858691-6858713 TGGGGTTCTAACCAGGCAGCAGG - Intergenic
1176828825 21:13723709-13723731 TGGGGTTCTAACCAGGCAGCAGG - Intergenic
1177231708 21:18330195-18330217 TGGGGTTCAAAGGATGTTGGAGG - Intronic
1178121549 21:29474838-29474860 TGGGGCTTTAAGGAGTTTGCTGG + Intronic
1178415372 21:32400608-32400630 TCTGCTTCTAGGGAGGCTGCAGG - Intergenic
1179857985 21:44171923-44171945 TGGGGGTATGAGGGGGCTGCCGG + Intergenic
1180119453 21:45737081-45737103 TGGGGCAGTGAGGAGGCTGCGGG + Intronic
1181115278 22:20628979-20629001 TGGTGTTCTGAGGAGGGTCCTGG + Intergenic
1181459698 22:23078735-23078757 AGGGCTTCTAAGGGGGCTGAGGG + Intronic
1181940412 22:26471440-26471462 TGGAAGTCTGAGGAGGCTGCTGG - Intronic
1184569045 22:45310473-45310495 GGGGCTTCTGAGGAGGTTGCTGG - Intronic
1184838291 22:47036965-47036987 TGGGGTTCTGAGGCGGGCGCAGG + Intronic
1185155123 22:49188878-49188900 CGAGGTTCTAAGGATGCTGACGG + Intergenic
949608185 3:5676965-5676987 TTGGCTTCTGAGGAGGCTGCAGG - Intergenic
949943278 3:9171125-9171147 TGGGGCTCTGTGGAGGCTGCTGG - Intronic
954716684 3:52530326-52530348 TGGGGTCCCAAGGAGGCAGATGG + Intronic
954894358 3:53963375-53963397 TGTGGTTCTCAGGTGGCGGCCGG + Intergenic
954999985 3:54918713-54918735 TGTGGTTCTCAGGAGGCCTCAGG + Exonic
955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG + Intergenic
956578705 3:70784742-70784764 TCTGCTTCTAGGGAGGCTGCAGG - Intergenic
956670593 3:71685913-71685935 TGGGGTTCTAGGGAGGCAGATGG + Intronic
960195643 3:114764471-114764493 GGTGGTTCTAAGCAGGATGCGGG - Intronic
961138142 3:124531581-124531603 TGGGCTTCTAGGGAGGCCTCAGG + Intronic
961567009 3:127771079-127771101 TGGGGGTTTAAGCAGGCTTCTGG - Intronic
962372031 3:134828704-134828726 TGGGGATTGAAGGAGGCTGCAGG + Intronic
965603806 3:170480415-170480437 TGGGGTTCTCTGGCTGCTGCAGG + Exonic
968605371 4:1532720-1532742 TGGGGGTCCCTGGAGGCTGCTGG - Intergenic
968645829 4:1740071-1740093 TGGGGTCCTAGGCAGGGTGCAGG - Intronic
968652213 4:1764788-1764810 GGAGGCTCTAAGGAGGCTGGGGG - Intergenic
969828325 4:9775708-9775730 TTGGCTTCTAAGGAGGCCTCAGG - Intronic
970223498 4:13834199-13834221 TGGGCTTCCAAGGAGCCTCCAGG + Intergenic
970357060 4:15265574-15265596 TTGGCTTCTAAGGAGGCTTCAGG - Intergenic
971014476 4:22473178-22473200 TCGGCTTCTAAGGAGGCCTCAGG - Intronic
979362107 4:119776884-119776906 TTGGCTTCTAGGGAGGCTTCAGG + Intergenic
983031703 4:162811047-162811069 TTGGCTTCTAAGGAGGCCTCTGG + Intergenic
985669609 5:1200720-1200742 TGGGGATCTGGGGTGGCTGCAGG + Intergenic
986233294 5:5885949-5885971 GGAGGTTCTCAGGAGGCAGCTGG - Intergenic
988419221 5:30985390-30985412 TGGGCTTCTGAGGAGGCCTCTGG + Intergenic
989684438 5:44068756-44068778 TGTGGTTCTAAAGCTGCTGCTGG - Intergenic
990458525 5:56012304-56012326 TGGTGTGCTAAGGAGGATACTGG + Intergenic
991507127 5:67337086-67337108 TGGTCTTCAAAGGGGGCTGCAGG - Intergenic
994589653 5:101758032-101758054 TGGGGTCCGAAGGAAGCTGCTGG + Intergenic
995040446 5:107581809-107581831 TTGGGTTCTCATGAGGCTTCAGG - Intronic
995744819 5:115392626-115392648 TGGGGTGCCAAGGTGGCAGCTGG - Intergenic
995761248 5:115564574-115564596 TTGGCTTCTAAGGAGGCATCAGG - Intergenic
1000291959 5:159878982-159879004 TGAGGATGTAAGGAGGCAGCTGG - Intergenic
1000539219 5:162519673-162519695 TGGTGTTCTAAGGAAGATCCAGG + Intergenic
1005126404 6:22451240-22451262 TGGGCTTCTAGGGAGGCCTCAGG + Intergenic
1006129865 6:31862696-31862718 TGGGCTTCTGGGGAGGCTGTAGG - Exonic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1007229200 6:40336698-40336720 TGGGGGTGTAAGGATGCTCCTGG - Intergenic
1007260982 6:40562913-40562935 TGTGGCTCTCAAGAGGCTGCAGG + Intronic
1008678058 6:53842794-53842816 TGTGTTTCTAATTAGGCTGCTGG + Intronic
1013827476 6:114231370-114231392 TGGGCTTCTAGGGAGGCCTCAGG - Intronic
1014198392 6:118583513-118583535 TGGGGCTGTAAAGATGCTGCAGG - Intronic
1016046126 6:139482441-139482463 TTGGGGTCTAAGGAGTCTGTGGG + Intergenic
1018392344 6:163350126-163350148 TGGGGATCTAGGGCTGCTGCAGG - Intergenic
1018973994 6:168550461-168550483 TGGGGTTCTGAGGTGGCTGCTGG - Intronic
1020792283 7:12641774-12641796 TGGGGTGTGAAGGAGGCAGCGGG - Intronic
1022829193 7:34047685-34047707 GGAGATTCTAAGGAGGTTGCTGG - Intronic
1023707531 7:42957398-42957420 TGGGCTTCTAGGGAGGCCTCAGG - Intergenic
1023848108 7:44134655-44134677 TGGGTTTATGAGGAGGCTTCTGG + Intergenic
1024663321 7:51520503-51520525 TGGGTCTCTCATGAGGCTGCAGG + Intergenic
1024949753 7:54847776-54847798 TGGGGATCTATGGAGGGTCCTGG + Intergenic
1026548110 7:71342200-71342222 TTGGCTTCTAAGGAGGCCTCAGG + Intronic
1026902351 7:74044278-74044300 GGGGGTACTAGGGAGGCTGAGGG - Intronic
1028871783 7:95778338-95778360 TGGCTTTCTAAAGAGCCTGCAGG - Intronic
1029218715 7:98970813-98970835 ATGGGTTCTGAGCAGGCTGCTGG - Intronic
1029428801 7:100515819-100515841 TGGGGAACTCAGGAGGCTGTTGG - Intergenic
1029546595 7:101213353-101213375 TTGGGTTCTGACCAGGCTGCTGG + Intronic
1030111991 7:106034729-106034751 TGAGGTTCTGAGAAGGCTGAAGG + Intergenic
1031592335 7:123609150-123609172 TGGGGTTCTGAGGGAGATGCAGG - Intronic
1031822865 7:126526571-126526593 GGGGGTTCTGAGGAAGCTGTGGG - Intronic
1032965064 7:137086925-137086947 TAGGGCTGTAAGGAGCCTGCAGG + Intergenic
1033472944 7:141665439-141665461 TGGCGTTCTGAGGAGACTGGAGG + Intronic
1034447088 7:151119257-151119279 TAGGGTTCAAGGGAGGCAGCCGG + Intronic
1035110817 7:156480152-156480174 TGAGGTTCTAAGAAGGGTGAAGG + Intergenic
1035313440 7:157983937-157983959 AGGGATTCCAGGGAGGCTGCAGG - Intronic
1035597532 8:870702-870724 TGGGGTGCTGAGGAGGTTTCTGG - Intergenic
1037790429 8:21934704-21934726 TGGGGAGCTAAGGAGGCAGTGGG + Intronic
1038287866 8:26222091-26222113 TGAGGGTCTAAGGAGCCTCCAGG + Intergenic
1041196523 8:55407112-55407134 TGGAGTCCTAAGGTGGCTGCAGG + Intronic
1042328505 8:67554256-67554278 TGGGCTTCTAGGGAGGCCTCAGG + Intronic
1043846700 8:85171794-85171816 TGAGGGTCTCAGGAGGCTGCTGG + Intergenic
1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG + Intergenic
1045333017 8:101172777-101172799 TGATGTGCTAACGAGGCTGCAGG + Intergenic
1046134001 8:110003472-110003494 TGGGCTTCTGAGGAGGCCTCAGG + Intergenic
1047610291 8:126514536-126514558 TGGGCTTCTAGGGAGGCCTCAGG + Intergenic
1048446124 8:134494564-134494586 TGGGGTTCCGTGGAGGCTTCAGG - Intronic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1049573371 8:143379712-143379734 TGAGGTGCCAGGGAGGCTGCTGG + Intronic
1050916438 9:11140935-11140957 TGGGCTTCTAAGAAGGTTGAAGG - Intergenic
1051612527 9:18975187-18975209 TGGGGAAGCAAGGAGGCTGCAGG + Intronic
1057385776 9:94604904-94604926 TGGTGTTCCCAGCAGGCTGCAGG - Intronic
1057391658 9:94645851-94645873 TGGGGTTATAAGGAGCCTCAAGG - Intergenic
1059247866 9:112863706-112863728 TGGGGTTCAGAGGAGGCAGCTGG + Intronic
1059600943 9:115778019-115778041 TGTGGTTTTATGGAGGCTTCAGG - Intergenic
1060219750 9:121758110-121758132 GGGGGTTCTGTGGAGGGTGCAGG + Intronic
1060885650 9:127150257-127150279 TGGGGCTCAAATGAGGCTCCTGG - Intronic
1062027271 9:134346403-134346425 TGGGGGTCTGGGGAGGCTCCTGG - Intronic
1062072188 9:134562224-134562246 TGGGGTTCTGAGGACAGTGCTGG - Intergenic
1203518527 Un_GL000213v1:25826-25848 TGGGGTTCTAACCAGGCAGCAGG + Intergenic
1185498597 X:580133-580155 TGGGCTTCTGAGGAGGCCTCAGG + Intergenic
1185734408 X:2486031-2486053 AGGGGTGATAAGGAGGCTGGGGG + Intronic
1186666227 X:11720303-11720325 TGGGGTTCTAAGAAGGCCTTTGG + Intergenic
1190780806 X:53593017-53593039 TGGGCTTCTAGGGAGGCCTCAGG - Intronic
1192232192 X:69273115-69273137 GGGGGTTTGAAGGAGGCTGAGGG - Intergenic
1192350898 X:70355423-70355445 TGGGGTTTTAAGGAGCCTTCCGG - Intronic
1199423515 X:147675216-147675238 TTGGCTTCTAAGGAGGCCTCAGG - Intergenic
1201612422 Y:15858119-15858141 TGGATTTTTAAGGAGGCTTCAGG + Intergenic
1202379365 Y:24262244-24262266 TGTGGGTGTCAGGAGGCTGCAGG + Intergenic
1202491417 Y:25407877-25407899 TGTGGGTGTCAGGAGGCTGCAGG - Intergenic